Burkholderia glumae and B. gladioli Cause Bacterial Panicle Blight in Rice in the Southern United States

Bacterial panicle blight (BPB) is among the three most limiting rice diseases in Louisiana and the southern United States. The identity and characterization of pathogens associated with this disease was unclear. This research details studies carried out on the pathogens causing BPB on rice in Louisiana and other rice producing southern states. Bacterial strains were isolated from BPB-infected sheath, panicle, or grain samples collected from rice fields in Louisiana, Arkansas, Texas, and Mississippi. In greenhouse inoculation tests, 292 of 364 strains were pathogenic on rice seedlings or panicles. Identification of strains in the pathogen complex by growth on S-PG medium, carbon source utilization profile (Biolog), cellular fatty acid analysis, and polymerase chain reaction (PCR) methods revealed that 76 and 5% of the strains were Burkholderia glumae and B. gladioli, respectively. The other strains have not been conclusively identified. Although strains of both species produced similar symptoms on rice, B. glumae strains were generally more aggressive and caused more severe symptoms on rice than B. gladioli. Virulent strains of both species produced toxoflavin in culture. The two species had similar growth responses to temperature, and optima ranged from 38 to 40°C for B. glumae and 35 to 37°C for B. gladioli. PCR was the most sensitive and accurate method tested for identifying the bacterial pathogens to the species level. The 16S rDNA gene and 16S-23S rDNA internal transcribed spacer (ITS) region sequences of the B. glumae and B. gladioli strains from rice showed more than 99% sequence homology with published sequences. A real-time PCR system was developed to detect and quantify this pathogen from infected seed lots. Our results clearly indicate that B. glumae and B. gladioli were the major pathogens causing BPB in the southern United States.

Download Full-text

Geographic variation in ectoparasitic mites diversity in Tadarida Brasiliensis (Chiroptera, Molossidae)

Iheringia Série Zoologia ◽

10.1590/1678-476620141044451456 ◽

2014 ◽

Vol 104 (4) ◽

pp. 451-456

Author(s):

Tatiana C. Pesenti ◽

Sâmara N. Gomes ◽

Ana M. Rui ◽

Gertrud Müller

Keyword(s):

United States ◽

South America ◽

United States Of America ◽

Its Region ◽

Southern United States ◽

Lower Prevalence ◽

Southern Brazil ◽

Tadarida Brasiliensis ◽

Southern South America ◽

Prevalent Species

Tadarida brasiliensis (Geoffroy, 1824), the Brazilian free-tailed bat, is an insectivorous bat that occurs from southern United States of America to southern South America. In this study we present the first data on diversity of ectoparasitic mites of T. brasiliensis in Brazil. A compilation and analysis of the studies of mite diversity conducted in different points the geographic distribution this bat species are provided. The mites were collected from March 2010 to November 2011 on 160 T. brasiliensis adult bats captured in southern Brazil. Four species of mites have been found: Chiroptonyssus robustipes (Ewing, 1925), Ewingana longa (Ewing, 1938), Ewingana inaequalis (Radford, 1948), and specimens of Cheyletidae. Chiroptonyssus robustipes was the most prevalent species (100%), followed by E. longa (20%), E. inaequalis (10%), and specimens of Cheyletidae (1.25%). The data currently available show that C. robustipes parasitizes T. brasiliensis throughout its region of occurrence, and this mite is highly prevalent and abundant. The two species of Ewingana accompany the geographical distribution of T. brasiliensis, but with much lower prevalence and abundance.

Download Full-text

Investigating Intraspecific Variation of Acidovorax avenae subsp. citrulli Using DNA Fingerprinting and Whole Cell Fatty Acid Analysis

Phytopathology ◽

10.1094/phyto.2000.90.2.191 ◽

2000 ◽

Vol 90 (2) ◽

pp. 191-196 ◽

Cited By ~ 58

Author(s):

R. R. Walcott ◽

D. B. Langston ◽

F. H. Sanders ◽

R. D. Gitaitis

Keyword(s):

United States ◽

Fatty Acid ◽

Fatty Acid Methyl Esters ◽

Methyl Esters ◽

The United States ◽

Cellular Fatty Acid ◽

Fatty Acid Analysis ◽

Pulse Field ◽

Pulse Field Gel Electrophoresis ◽

Group I

To assess the diversity of Acidovorax avenae subsp. citrulli, 121 strains from watermelon, cantaloupe, and pumpkin were compared using pulse field gel electrophoresis of SpeI-digested DNA and gas chromatographic analysis of fatty acid methyl esters. Twenty-nine unique DNA fragments resulted from DNA digestion, and 14 distinct haplotypes were observed. Based on cluster analysis, two subgroups, I and II, were recognized, which accounted for 84.8% (eight haplotypes) and 15.2% (six haplotypes) of the strains, respectively. Results of cellular fatty acid analysis varied quantitatively and qualitatively for the A. avenae subsp. citrulli strains and supported the existence of the two subgroups. Group I includes strains from cantaloupe and pumpkin as well as the ATCC type strain, which was first described in the United States in 1978, whereas group II represents the typical watermelon fruit blotch-causing strains that appeared in the mainland United States in 1989. Knowledge of the two A. avenae subsp. citrulli groups may be useful in screening for watermelon fruit blotch resistance.

Download Full-text

Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama

Plant Disease ◽

10.1094/pdis-91-6-0767c ◽

2007 ◽

Vol 91 (6) ◽

pp. 767-767 ◽

Cited By ~ 26

Author(s):

R. Nandakumar ◽

M. C. Rush ◽

F. Correa

Keyword(s):

United States ◽

Fatty Acid ◽

16S Rdna ◽

Latin American ◽

The United States ◽

Unknown Etiology ◽

Rice Grain ◽

Burkholderia Glumae ◽

Specific Primers ◽

Panicle Blight

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

Download Full-text

Deteksi Molekuler Burkholderia glumae, Penyebab Penyakit Hawar Malai Padi

Jurnal Perlindungan Tanaman Indonesia ◽

10.22146/jpti.30259 ◽

2018 ◽

Vol 22 (1) ◽

pp. 98

Author(s):

Methy Handiyanti ◽

Siti Subandiyah ◽

Tri Joko

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Selective Medium ◽

Rice Seed ◽

Disease Area ◽

Burkholderia Glumae ◽

Rice Varieties ◽

Blight Disease ◽

Spreading Potential ◽

Panicle Blight

The presence of bacterial panicle blight disease caused by Burkholderia glumae have been reported to infect rice plants in Indonesia. There have been no reports of yield losses due to B. glumae infection, but this pathogen is seed-borne so that it can increase the spreading potential to other areas. This study aims to determine the spread of the disease area of bacterial panicle blight in Java and to detect B. glumae based on ITS region of 16-23S rDNA. Methods for this research include surveys and random sampling of rice seeds directly from farmers and the Food Crop and Horticulture Center, Agriculture Office of Yogyakarta. The bacteria were isolated using S-PG selective medium, then DNA extraction was performed and amplified using a pair of primers BGF 5’-ACACGGAACACCTGGGTA-3’ and BGR 5’-TCGCTCTCC CGAAGAGAT-3’. 101 isolates were obtained from 21 seed samples consisting of 11 rice varieties from nine regions in Java that has different morphological characteristics. The eight isolates were detected as B. glumae by using ITS primers, i.e., isolates ChgCM.4, IRP.3, IRP.6b, InSB.1a, InSB.2a, InSB.3a, InSB.5a, and InSB.6a. The eight isolates were isolated from seed samples of Cirebon, Purworejo and Banyuwangi. This study shows that bacterial panicle blight disease has found in several rice varieties and locations in Java, and the ITS primer can be used for early detection of B. glumae in rice seed samples. IntisariPenyakit hawar malai yang disebabkan oleh bakteri patogen Burkholderia glumae mulai banyak dilaporkan menginfeksi tanaman padi di Indonesia. Belum ada laporan mengenai kerugian akibat infeksi B. glumae di Indonesia, namun sifatnya yang tular benih dapat meningkatkan potensi menyebar ke wilayah lain. Penelitian ini bertujuan untuk mengetahui wilayah sebar penyakit hawar malai di Jawa dan mendeteksi secara molekuler berdasarkan urutan basa gen 16-23S rDNA internal transcribed spacer (ITS). Metode yang dilakukan meliputi survei dan pengambilan sampel biji padi secara acak langsung dari petani dan UPT Balai Pengembangan Perbenihan Tanaman Pangan dan Hortikultura, Dinas Pertanian Yogyakarta. Sampel biji padi diisolasi menggunakan media selektif S-PG, kemudian dilakukan ekstraksi DNA, dan diamplifikasi menggunakan primer BGF 5’-ACACGGAACACCTGGGTA-3’ dan BGR 5’-TCGCTCTCC CGAAGAGAT-3’. Hasil survei di lapangan diperoleh 21 sampel biji yang terdiri dari 11 varietas padi dari sembilan wilayah di Jawa. Hasil isolasi diperoleh 101 isolat dan masing-masing isolat tersebut memiliki karakteristik morfologi yang berbeda. Delapan isolat dari total isolat yang diuji terdeteksi B. glumae menggunakan primer ITS, yaitu isolat ChgCM.4, IRP.3, IRP.6b, InSB.1a, InSB.2a, InSB.3a, InSB.5a, dan InSB.6a. Kedelapan isolat tersebut merupakan hasil isolasi sampel biji dari wilayah Cirebon, Purworejo, dan Banyuwangi. Hasil penelitian menunjukkan bahwa penyakit hawar malai bakteri sudah terdeteksi pada varietas padi di beberapa lokasi wilayah Jawa, dan penggunaan primer ITS dapat digunakan untuk deteksi dini B. glumae pada sampel biji padi secara molekuler.

Download Full-text

Evaluation of Cotton Cultivar and At-Plant Nematicide Application on Seasonal Populations of Reniform Nematode

Agronomy ◽

10.3390/agronomy11112166 ◽

2021 ◽

Vol 11 (11) ◽

pp. 2166

Author(s):

Whitney D. Crow ◽

Angus L. Catchot ◽

Darrin Dodds ◽

Jeffery Gore ◽

Donald R. Cook ◽

...

Keyword(s):

United States ◽

Plant Growth ◽

Plant Biomass ◽

Southern United States ◽

Cotton Production ◽

Growth Responses ◽

Reniform Nematode ◽

Rotylenchulus Reniformis ◽

History Of ◽

Cotton Cultivar

The reniform nematode, Rotylenchulus reniformis (Linford and Oliveira), remains a common, widespread nematode pest of cotton across the southern United States. Trials were conducted during 2017 at three non-irrigated locations: one location in Hamilton, MS, and two locations in Tchula, MS, in field settings with a history of cotton production and documented economically-damaging reniform nematode populations. Trials were designed to evaluate the response of two cotton cultivars to in-furrow nematicides consisting of aldicarb, 1,3-dichloropropene, and a non-treated control applied for nematode suppression. No significant interactions between cotton cultivar and nematicide were observed. However, treatment with 1,3-dichloropropene produced greater plant biomass, and plant height compared to aldicarb-treated cotton and the nontreated. Nematode densities were suppressed with the use of 1,3-dichloropropene compared to aldicarb and the non-treated control. The use of 1,3-dichloropropene resulted in positive early-season plant growth responses; however, these responses did not translate into greater yield.

Download Full-text

Olsenella umbonata sp. nov., a microaerotolerant anaerobic lactic acid bacterium from the sheep rumen and pig jejunum, and emended descriptions of Olsenella, Olsenella uli and Olsenella profusa

INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY ◽

10.1099/ijs.0.022954-0 ◽

2011 ◽

Vol 61 (4) ◽

pp. 795-803 ◽

Cited By ~ 54

Author(s):

Mareike Kraatz ◽

R. John Wallace ◽

Liselott Svensson

Keyword(s):

Lactic Acid ◽

Type Strain ◽

Culture Media ◽

Sequence Similarity ◽

Cellular Fatty Acid ◽

Fatty Acid Analysis ◽

Rrna Gene ◽

Bacterial Strains ◽

Biochemical Tests ◽

Sheep Rumen

Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of ‘Olsenella (basonym Atopobium) oviles’. Three phenotypically similar bacterial strains (lac15, lac16 and lac31T) were isolated in concert with Veillonella magna lac18T from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31T formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella–Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31T were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA–DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31T represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31T ( = CCUG 58604T = DSM 22620T = JCM 16156T) as the type strain and A2 ( = CCUG 58212 = DSM 22619 = JCM 16157) as an additionally available reference strain. Also, based on our data, we propose emended descriptions of the genus Olsenella and the species Olsenella uli and Olsenella profusa.

Download Full-text

A 4-year study of the diversity and persistence of coliforms and Aeromonas in the water of a Swedish drinking water well

Canadian Journal of Microbiology ◽

10.1139/m97-002 ◽

1997 ◽

Vol 43 (1) ◽

pp. 9-16 ◽

Cited By ~ 15

Author(s):

I. Kühn ◽

G. Huys ◽

R. Coopman ◽

K. Kersters ◽

P. Janssen

Keyword(s):

Drinking Water ◽

Fatty Acid ◽

Sampling Period ◽

Cellular Fatty Acid ◽

Fatty Acid Analysis ◽

Well Water ◽

Aflp Analysis ◽

Bacterial Strains ◽

Water Well ◽

Liquid Chromatographic

Coliforms and Aeromonas, isolated over a sampling period of 4 years from a Swedish drinking water well, were analysed for their phenotypical diversity and for their ability to persist in the well water. From each of the 40 water samples collected from the well, 32 bacterial isolates were subjected to typing by the PhenePlate (PhP) biochemical fingerprinting system. Strains able to persist in the well water were further characterized using the API 20E system, gas–liquid chromatographic cellular fatty acid analysis, and the DNA fingerprinting technique AFLP. Using the PhP system, a total of 170 different phenotypes were identified among 1143 studied isolates. Most phenotypes were only represented by a few isolates and (or) were restricted to one or two sampling occasions. However, one particular phenotype (RV-C01), identified as Aeromonas hydrophila using the API 20E system and fatty acid analysis, reoccurred in 28 samples distributed over the whole study period and often dominated the bacterial population in the well water. AFLP analysis revealed that the RV-C01 isolates displayed basically identical fingerprints. Our results thus suggest that a genetically stable Aeromonas clone resided in the well water over the whole 4-year study, whereas other bacterial strains studied were only transient inhabitants of the well.Key words: Aeromonas, coliform, water, diversity.

Download Full-text