scholarly journals First Report of Anemone Plants Infected by Ranunculus white mottle virus

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1046-1046 ◽  
Author(s):  
A. M. Vaira ◽  
M. Vecchiati ◽  
V. Lisa ◽  
R. G. Milne
Keyword(s):  
Mixed Infection ◽  
Viral Infections ◽  
Disease Incidence ◽  
Severe Disease ◽  
Mottle Virus ◽  
Tobacco Necrosis Virus ◽  
First Report ◽  
Clear Cut ◽  
Molecular Tests ◽  
Field Samples

Ranunculus white mottle virus (RWMV) (1), genus Ophiovirus, has been reported in crops of several cultivars of commercial ranunculus (Ranunculus asiaticus hybrids) during the 1990s in Liguria in Northwest Italy. Symptoms associated with RWMV in ranunculus are not clear-cut owing to the presence of mixed viral infections. During autumn 1999, a severe disease in commercial crops of anemone (Anemone coronaria) was noted in the same area. Plants appeared stunted with young leaves showing curling, deformation, and necrotic spotting. Disease incidence in some fields reached 40 to 50%. DAS- and TAS-enzyme-linked immunosorbent assays (ELISAs) for presence of RWMV and for the viruses most frequently infecting anemone in Italy were run on 24 field samples. Seven proved to be infected by RWMV in mixed infection with Cucumber mosaic virus subgroup II or with Tobacco necrosis virus. Ophiovirus-like particles were detected by negative staining and electron microscopy from sap extracts of field plants that were RWMV-positive by ELISA. Sap from these plants was also mechanically inoculated to indicator plants. Total RNAs were extracted from RWMV-infected field samples and from inoculated Nicotiana benthamiana and N. clevelandii and used in molecular tests. A DIG-DNA probe targeting the 1.8-kb RNA2 of RWMV was used in Northern blots and dot blots of total RNAs, confirming the infection in field samples and multiplication of the virus in test plants, unfortunately still in mixed infection. At present, it is difficult to evaluate RWMV symptomatology in anemone, but the presence of this virus in mixed infection seems to produce serious effects. This is the first report of RWMV in anemone. Reference: (1) A. M. Vaira et al. Arch. Virol. 142:2131, 1997.

scholarly journals METODE PENAPISAN CABAI (CAPSICUM ANNUUM L.) UNTUK KETAHANAN TERHADAP CHILLI VEINAL MOTTLE VIRUS (Chi VMV) DAN CUCUMBER MOSAIC VIRUS (CMV)

2011 ◽  
Vol 8 (2) ◽  
pp. 146-153
Author(s):  
Latifah Latifah ◽  
Sri Hendrastuti Hidayat ◽  
Sriani Sujiprihati
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Plant Protection ◽  
Disease Incidence ◽  
Severe Disease ◽  
Screening Method ◽  
Mottle Virus ◽  
Inoculation Methods ◽  
Virus Sequence ◽  
Chilli Veinal Mottle Virus

Screening Method for Chilli Veinal Mottle Virus  (Chi VMV) and Cucumber Mosaic Virus  (CMV) Resistance in Chillipepper.  ChiVMV and CMV have been reported as the causal agents of main diseases in chillipepper in Indonesia and other Asian countries.  Mix infection of this two viruses was commonly occurred in the field, causing severe disease .  The use of resistance varieties has been proposed for dealing with the yield losses causing by  the viruses.  Breeding program is undergoing for development of chillipepper varieties resistant to ChiVMV and CMV.  Methodology for routine screening activity of chillipepper for resistance to both ChiVMV and CMV needs to be established. This research was conducted in Cikabayan Glass House and Plant Virology Laboratory, Plant Protection Department, Bogor Agricultural University from May 2006 to June 2007. Aim of the research was to develop screening method for simultaneous infection by the two viruses, ChiVMV and CMV.  Inoculation of ChiVMV and CMV was done by single inoculation or repetitive inoculation methods.  In both methods, ChiVMV and CMV were inoculated in different sequences, either ChiVMV or CMV first.  The result showed that incubation period was shorter when CMV was inoculated in advance both in single and repetitive inoculation method.  Mosaic, mottle and malformation type symptom was observed in infected plants. Based on disease incidence, infection of ChiVMV was higher compared to CMV in repetitive inoculation as well as in single inoculation.  Repetitive inoculation methods with virus sequence ChiVMV-CMV-ChiVMV-CMV  was selected for resistance evaluation of chillipepper genotypes.

scholarly journals Occurrence of Chilli veinal mottle virus in Solanum aethiopicum in Tanzania

Plant Disease ◽  
2001 ◽  
Vol 85 (7) ◽  
pp. 801-801 ◽  
Author(s):  
R. Nono-Womdim ◽  
I. S. Swai ◽  
M. L. Chadha ◽  
K. Gebre-Selassie ◽  
G. Marchoux
Keyword(s):  
Green Peach Aphid ◽  
Disease Incidence ◽  
Mottle Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Natural Occurrence ◽  
Solanum Aethiopicum ◽  
Field Samples ◽  
Arusha Region ◽  
Chilli Veinal Mottle Virus ◽  
Das Elisa

African eggplant, or garden egg (Solanum aethiopicum) is an important vegetable in most sub-Saharan African countries. Since June 1997, viral symptoms, including mosaic, vein clearing, and stunting, have been observed on several crops of African eggplant cv. Tengeru White at a number of sites in the Arusha region of northern Tanzania. Field inspections revealed disease incidence ranging from 50 to 90%. During the same period, high populations of the green peach aphid Myzus persicae were observed in affected crops of African eggplant. These aphids were also found to reproduce in African eggplants. Flexuous, rodshaped virus-like particles, approximately 750 nm long and 12 nm wide, were found in electron microscope leaf dips from field samples of naturally affected African eggplants. The particle size suggested a species of Potyviridae. Thus, 20 field-infected samples of S. aethiopicum (randomly collected from four farms) were assayed in double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for the presence of Potato virus Y (PVY) and Pepper veinal mottle virus (PVMV), known to infect tomato and other solanaceous crops in the region (2). However, all samples gave negative results. Further DAS-ELISA were performed with the same extracts from naturally infected plants of S. aethiopicum with antisera directed against Tobacco etch virus, Tobacco vein mottling virus, Pepper mottle virus, and Chilli veinal mottle virus (ChiVMV). All 20 samples were positive only for ChiVMV. ChiVMV, a single-stranded RNA virus transmitted in a nonpersistent manner by several aphid species, is one of the most important viruses of pepper in Asia (1). To confirm DAS-ELISA results, an isolate of ChiVMV from African eggplant was transmitted by mechanical inoculations, resulting in disease on tobacco (Nicotiana tobacco cv. Xanthi nc), pepper (Capsicum annuum cv. Yolo Wonder), tomato (Lycopersicon esculentum cv. Tengeru 97), and African eggplant (S. aethiopicum cv. Tengeru White). Extracts from the inoculated plants tested positive for the presence of ChiVMV in DAS-ELISA. This mechanically transmitted isolate did not infect melon (Cucumis melo), cucumber (C. sativus), or cowpea (Vigna unguiculata), which are nonhosts of ChiVMV. To our knowledge, this is the first report of the natural occurrence of ChiVMV in African eggplant. References: (1) S. K. Green et al. PETRIA 9:332, 1999. (2) R. Nono-Womdim et al. J. S. Afr. Soc. Hort. Sci. 6:41–44, 1996.

scholarly journals First report of twig blight of ban tulsi (Croton bonplandianus Bail.) caused by Choanephora cucurbitarum (Berk. & Ravenel) Thaxt. in India

2018 ◽  
Vol 0 (0) ◽  
Author(s):  
Siddhartha Das ◽  
Subrata Dutta ◽  
Sujit Kumar Ray
Keyword(s):  
Present Report ◽  
Monsoon Season ◽  
Disease Incidence ◽  
Severe Disease ◽  
First Report ◽  
Rdna Its ◽  
Rdna Its Sequences ◽  
Twig Blight ◽  
Choanephora Cucurbitarum ◽  
Blight Disease

Abstract In August 2015, twig blight disease of ban tulsi (Croton bonplandianus Bail.) caused by Choanephora cucurbitarum (Berk. & Ravenel) Thaxt. was observed for the first time, in the Gangetic alluvial region of West Bengal, India. A severe disease incidence (40-50%) showed twig blight symptoms starting with shoot apical meristem (SAM), leaf, and blossom blight symptoms. Typical symptoms were characterized by over-projecting black pin head like emerging sporangiola which formed mycelial cushion on the infected surface. The present report describes the identification of the causal pathogen as C. cucurbitarum based on its morphology and the internal transcribed spacer of its ribosomal DNA (rDNA - ITS) sequences with 100% identity of NCBI-GenBank published Choanephora database. Optimum temperatures, 28-30°C, coupled with high relative humidity (80-90%) during the monsoon season enhances the disease’s progress. To the best of our knowledge this is the first report of twig blight of C. bonplandianus, caused by C. cucurbitarum, in India as well as globally.

scholarly journals First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (10) ◽  
pp. 1073-1073 ◽  
Author(s):  
L. P. Wang ◽  
N. Hong ◽  
G. P. Wang ◽  
R. Michelutti ◽  
B. L. Zhang
Keyword(s):  
North America ◽  
Sweet Cherry ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Prunus Species ◽  
Indicator Plants ◽  
First Report ◽  
Green Ring ◽  
Field Samples

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata ‘Kwanzan’ for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals First Report of Lasiodiplodia pseudotheobromae Causing Stem End Rot of Mango Fruit in Pakistan

Plant Disease ◽  
2021 ◽  
Author(s):  
Muhammad Waqar Alam ◽  
Arif Malik ◽  
Abdul Rehman ◽  
Mubeen Sarwar ◽  
Tahir Shafeeq ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Mangifera Indica ◽  
Morphological Characteristics ◽  
Aerial Mycelium ◽  
Postharvest Disease ◽  
Single Spore ◽  
Mango Fruit ◽  
First Report ◽  
Field Samples ◽  
Rot Disease

Mango (Mangifera indica L.) is considered a desirable fruit in international markets and is grown throughout tropical and sub-tropical countries around the world (Alemu, 2014). Stem end rot is the most damaging and complex postharvest disease of mango, resulting in losses of up to 40% in Pakistan, which is the leading producer and exporter (Alam et al. 2017). A field survey was conducted in June of 2017 and 2018 in the Rahim Yar Khan and Multan- major mango producing regions of Punjab Province. After mature but unripe mango fruit (cv. Samar Bahisht Chaunsa) were stored at 12°C for 2 weeks to permit ripening, water-soaked, dark brown to purplish black decay began to appear around the stem end portion. The decay gradually enlarged and covered the whole fruit after 7 days. Disease incidence was estimated at 30%. Small pieces (3 to 4 mm2) from the periphery of 15 diseased fruit were surface disinfected with 1% sodium hypochlorite for 2 min, rinsed three times in sterilized distilled water, air dried, and then placed aseptically onto potato dextrose agar (PDA) medium and incubated at 25°C under a 12-h light/dark photoperiod for 7 days. Twelve single-spore isolates with similar morphology were isolated from the infected tissues. Initially the fungus produced thick, fluffy and greyish-white aerial mycelium, that later turned into dark gray colonies. Conidia were unicellular, ellipsoidal, and initially hyaline, but with age became dark brown and developed a central septum. Conidia measured 24.5 to 31.5 × 11.4 to 15.7 µm (n = 60). Conidiophores were inflated at their base with one diaphragm which reduced to conidiogenous cells. Conidiogenous cells were hyaline and cylindrical. On the basis of morphological characteristics, the fungus was tentatively identified as Lasiodiplodia sp., a member of the family Botryosphaeriaceae (Alves et al. 2008). For molecular identification, genomic DNA was extracted from mycelium following the CTAB method. The internal transcribed spacer (ITS) region of rDNA and translation elongation factor 1-alpha (TEF1-α) gene were amplified using ITS1/ITS4 (White et al. 1990) and EF1-728F/EF1-986R primer sets (Carbone and Kohn 1999), respectively. BLASTn searches of sequences revealed 99% to 100% identity with the reference sequences of various Lasiodiplodia pseudotheobromae isolates (GenBank accession nos. MH057189 for ITS; MN638768 for TEF-1a). The sequences were deposited in GenBank (accession nos. MW439318, MW433883 for ITS; and MW463346, MW463347 for TEF-1a). To fulfill Koch’s postulates, a suspension of 105 conidia/ml from a 7-day-old culture of L. pseudotheobromae was used to inoculate fully mature but unripe mango fruit (cv. Samar Bahisht Chaunsa). Fruit were pricked with a sterilized needle to a depth of 4 mm at the stem end portion, injected with 50 μl of the prepared spore suspension (Awa et al. 2012), and stored at 12°C for 3 weeks under 70 to 80% RH. Twenty mango fruit were inoculated, and 10 were inoculated with sterile water only. After 15 days, most fruit showed typical symptoms at the stem end. Reisolations from symptomatic fruit following the procedures described above for isolating and identifying the fungal cultures from infected field samples, consistently yielded a fungus identical to L. pseudotheobromae. Control fruit remained disease-free. Although L. pseudotheobromae was previously reported on several forest and fruit trees (Alves et al. 2008; Awan et al. 2016), this is the first report of the pathogen causing stem end rot disease of mango in Pakistan. This report is important for the new studies aiming at management of stem end rot disease of mango caused by L. pseudotheobromae in Pakistan.

scholarly journals First Report of Southern Blight of Okra (Abelmoschus esculentus) Caused by Sclerotium rolfsii in Côte d'Ivoire

Plant Disease ◽  
2010 ◽  
Vol 94 (11) ◽  
pp. 1379-1379 ◽  
Author(s):  
D. Koné ◽  
D. Mohamed ◽  
S. Soro ◽  
B. A. Bolou Bi ◽  
Y. J. Kouadio ◽  
...  
Keyword(s):  
Cote D'ivoire ◽  
Côte D’Ivoire ◽  
Disease Incidence ◽  
Sclerotium Rolfsii ◽  
Abelmoschus Esculentus ◽  
Cote D’Ivoire ◽  
First Report ◽  
Southern Blight ◽  
Côte D'ivoire ◽  
Field Samples

Southern blight caused by Sclerotium rolfsii Sacc. was observed on okra (Abelmoschus esculentus) cv. Clemson Spineless in January 2010 during a survey of vegetable fields in Rubbino, Côte d'Ivoire, which is one of the most important areas for vegetable production. Plants exhibited symptoms of a dark brown lesion on the stems near the soil line. Upper roots became light to dark brown, the lower leaves wilted, turned yellow, and a white mat of fungal mycelium developed on the stem lesion. Numerous, white, spherical sclerotia formed on the infected stem and on soil surfaces around the infected plants. Sclerotia (0.5 to 1.2 mm in diameter) later turned tan to dark brown and the entire plant wilted. Eleven fields, with a total of approximately 26 ha surveyed, were affected and disease incidence reached approximately 15% in the fields. Sclerotia were collected and the fungus cultured on acidified potato dextrose agar (PDA) plates. The fungus grew rapidly on PDA and the hyphae at the edge of the colonies were large straight cells with one or more clamp connections at each septum. Secondary and tertiary hyphae were slender and lacked clamp connections. Whitish sclerotia were observed on the mycelial mats 5 to 7 days after incubation, which later turned tan to brown when mature. The fungus was identified as S. rolfsii based on the characteristics of mycelia and sclerotia (1). Sclerotia produced on PDA were used to inoculate okra seedlings under greenhouse conditions at rates of 10, 20, and 30 sclerotia per plant. Sclerotia were placed just under the soil surface around the root of 4-week-old seedlings of okra cv. Clemson Spineless. Symptoms identical to those on field samples developed on all inoculated plants. S. rolfsii was reisolated from diseased plants and the identity was confirmed. S. rolfsii has previously been reported as causing disease in Côte d'Ivoire (2). To our knowledge, this is the first report of southern blight caused by S. rolfsii on okra in this country. Okra is an important vegetable crop in Côte d'Ivoire and therefore the occurrence of southern blight and susceptibility of okra cultivars to this disease needs to be taken into account in okra production. References: (1) Z. K. Punja and A. Damiani. Mycologia 88:694, 1996. (2) R. Resplandy et al. Ann. Epiphyt. 1:1, 1954.

scholarly journals First Report of Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidiae in Turkey

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 452-452 ◽  
Author(s):  
K. K. Bastas ◽  
A. Karakaya
Keyword(s):  
Pseudomonas Syringae ◽  
Disease Incidence ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Bacterial Strains ◽  
First Report ◽  
Molecular Tests ◽  
Leaf Spots ◽  
National University ◽  
Phytosanitary Measures

A new disease was observed during the spring and autumn of 2009 and 2010 on kiwifruit plants (Actinidia deliciosa cv. Hayward) in Rize Province of Turkey. Disease incidence was estimated as 3% in approximately 10 ha. Symptoms were characterized by dark brown spots surrounded by yellow halos on leaves and cankers with reddish exudate production on twigs and stems. Eight representative bacterial strains were isolated from leaf spots and tissues under the bark on King's B medium (KB) and identified as Pseudomonas syringae pv. actinidiae on the basis of biochemical, physiological (1,2), and PCR tests (3). Bacteria were gram negative, rod shaped, and nonfluorescent on KB; positive for levan production, sucrose and inositol utilization, and tobacco (Nicotiana tabacum cv. White Burley) hypersensitivity; and negative for growth at 37°C, oxidase, potato soft rot, arginine dihydrolase, urease, arbutin, erythritol, lactic acid, aesculin hydrolysis, gelatin liquefaction, and syringomycin production. Identity of the eight isolates was confirmed by PCR using P. syringae pv. actinidiae-specific primers PsaF1/R3 to generate a 280-bp DNA fragment (3). P. syringae pv. actinidiae reference strain NCPPB 3739, and CJW7 from Jae Sung Jung, Department of Biology, Sunchon National University, Korea, were employed in all biochemical, physiological, and molecular tests as positive controls. Pathogenicity was confirmed by artificial inoculation of 2-year-old A. deliciosa cv. Hayward. A bacterial suspension (108 CFU ml–1) was injected into kiwifruit twig tips, stems, and leaves with a hypodermic syringe, and the inoculated plants were placed at 25 to 28°C and 80% relative humidity growth chamber for 3 weeks. First symptoms were observed on leaves within 5 days after inoculation and on twigs after 20 days. No symptoms were observed on control plants that were inoculated with sterile water. Reisolation was made from dark brown lesions surrounded by yellow halos on leaves and cankers on twigs and stem and their identities were confirmed using the techniques previously described. All tests were performed three times and pathogenicity tests employed three plants for each strain. To our knowledge, this is the first report of P. syringae pv. actinidiae causing disease on kiwifruit in Turkey. Kiwifruit production in Turkey has expanded rapidly during the last 10 years ( http://www.tuik.gov.tr ) and phytosanitary measures are needed to prevent further spread of the bacterium to other kiwifruit orchards. References: (1) Y. J. Koh et al. N. Z. J. Crop Hortic. Sci. 38:4, 275, 2010. (2) R. A. Lelliott and D. E. Stead. Methods for the Diagnosis of Bacterial Diseases of Plants. Blackwell Scientific, Sussex, UK, 1988. (3) J. Rees-George et al. Plant Pathol. 59:453, 2010.

scholarly journals First Report of Soybean Rust Caused by Phakopsora pachyrhizi in Ghana

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1057-1057 ◽  
Author(s):  
R. Bandyopadhyay ◽  
P. S. Ojiambo ◽  
M. Twizeyimana ◽  
B. Asafo-Adjei ◽  
R. D. Frederick ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Its Region ◽  
Spore Suspension ◽  
Soybean Rust ◽  
Plant Management ◽  
Phakopsora Pachyrhizi ◽  
Adaxial Side ◽  
First Report ◽  
Field Samples ◽  
Detached Leaves

Nigeria is the only country in West Africa where soybean rust, caused by Phakopsora pachyrhizi, has been officially reported (1). During a disease survey in Ghana during October 2006, soybean (Glycine max) leaves with rust symptoms (tan, angular lesions with erumpent sori exuding urediniospores) were observed in 11 fields in the following districts: Kassena Nankana in the Upper East Region; East Gonja, Central Gonja, and Tolon-Kumbungu in the Northern Region; and Ejisu-Juabeng in the Ashanti Region. Disease incidence in these fields ranged from 50 to 100% and disease severity ranged between 3 and 40% of the leaf area on infected plants. Urediniospores were hyaline, minutely echinulate, and 23 to 31 × 14 to 18 μm. Within a week of collection, leaf samples were sent to the USDA-ARS Foreign Disease-Weed Science Research Unit for verification of pathogen identity. DNA was extracted from leaf pieces containing sori with the Qiagen DNeasy Plant Mini kit (Valencia, CA), and all 11 field samples amplified in a real-time fluorescent PCR with the P. pachyrhizi-specific primers Ppm1 and Ppa2 (2). Sequence alignment of the internal transcribed spacer (ITS) region 2 further confirmed the identification as P. pachyrhizi (2). Infected leaves from three fields were separately washed in sterile water to collect urediniospores that were used to separately inoculate three detached leaves (for each isolate) of susceptible cultivar TGx 1485-1D (3). The abaxial surface of detached leaves was sprayed with 400 μl of spore suspension (1 × 106 spores per ml). A single leaf piece was placed in a 9-cm-diameter petri dish with adaxial side appressed on 1% technical agar amended with 10 μg/ml of kinetin. Lactic acid (1.5 ml/liter) and benomyl (12.5 mg/liter) were added to the agar medium to inhibit growth of saprophytic fungi and bacteria. Petri dishes were incubated at 20°C with a 12-h light/12-h dark cycle. Lesions on inoculated leaves developed 5 to 6 days after inoculation (DAI), and pustules (105 to 120 μm) formed 7 to 8 DAI and erupted 3 days later exuding columns of urediniospores similar in size to the initially collected isolates. Inoculating another set of detached leaves with a spore suspension (1 × 106 spores per ml) from the first set of detached leaves resulted in typical rust symptoms. The PCR assay, alignment of ITS region 2, morphological characters of the isolates, and pathogenicity tests demonstrate that P. pachyrhizi occurs in Ghana. To our knowledge, this is the first report of P. pachyrhizi in Ghana. References: (1) O. A. Akinsanmi et al. Plant Dis. 85:97, 2001. (2) R. D. Frederick et al. Phytopathology 92:217, 2002. (3) M. Twizeyimana et al. Online publication. http://www.plantmanagementnetwork.org/ infocenter/topic/soybeanrust/2006/posters/41.asp. Plant Management Network, 2006.

scholarly journals First Report of Tomato Powdery Mildew Caused by Leveillula taurica in Taiwan

Plant Disease ◽  
2021 ◽  
Author(s):  
Chu-Ping Lin ◽  
Yu-Lun Dai ◽  
Jin-Hsing Huang ◽  
Jyh-Nong Tsai
Keyword(s):  
Powdery Mildew ◽  
Disease Incidence ◽  
Adaxial Side ◽  
Internal Transcribed Spacer Region ◽  
Transparent Plastic ◽  
First Report ◽  
Leveillula Taurica ◽  
Solanum Lycopersicum L ◽  
Field Samples ◽  
Tomato Powdery Mildew

Tomato (Solanum lycopersicum L.) is one of the common and important economic crops in Taiwan. In July 2018, tomato leaves with unusual yellowing and lesions were observed in Taichung, Changhua, Nantou, and Yunlin counties in Taiwan. Symptomatic leaves initially showed chlorotic, irregularly shaped patches on adaxial side of leaves; and days later, necrosis appeared in the patches center. The disease incidence was 4 to 25% and occurred mostly on large type tomato in the field and greenhouse while rarely on cherry tomato. Since the pathogen could not be cultured in potato dextrose agar, for initial pathogen observation, symptomatic leaves were examined directly under light microscope. Conidiophores were found emerged through abaxial stomata of the lesion, and were erect, single and sometimes branched, with single-celled and dimorphic conidia, suggesting the lesions were associated with a powdery mildew. The white to hyaline pathogens collecting directly from fresh signs were also examined. Primary conidia were lanceolate, tip point, 50 to 78 × 14 to 22 μm, ratio of 2.3 to 5.9; secondary conidia were cylindrical to clavate, 47 to 72× 14 to 22 μm, ratio of 2.5 to 4.6. Conidial germ tubes were mainly terminal to subterminal and sometimes lateral. Conidial appressoria were alobate to multilobed, and hyphal appressoria were nipple-shaped, lobed to multilobed or even coralloid. No chasmothecia were found in the field samples. One representative specimens of isolates TARI_PM-3 was deposited in the National Museum of Natural Science in Taiwan (accession number F0034683), and DNA extracted from the fresh conidia was amplified respectively with primers PMITS1 and PMITS2 (Cunnington et al. 2003) for the sequences of internal transcribed spacer region (ITS1+5.8S+ITS2, partial sequence). The segment of sequence (accession numbers MT370494 in GeneBank) showed 99.8% identity with the sequence of AB045000, which was identified as Leveillula taurica (Khodaparast et al., 2001). Based on morphology and molecular analysis, the fungus was identified as L. taurica (Braun and Cook 2012; Choi et al. 2019). To confirm the pathogenicity, conidial suspensions (4 × 104 conidia/ml) of L. taurica (isolate TARI_PM-3) were used to inoculate by dropping (10 μl/site) on the abaxial side of leaves of 4-week-old potted tomato (cv. Golden Lucky). The plants were covered with transparent plastic bags for 1 day and then maintained at 16 to 26°C in a greenhouse. Lesion symptoms of leaves similar to those in the field were observed 4 weeks after inoculation, while the controlled plants inoculated with ddH2O showed symptomless. The same fungus was observed on the necrotic patches of the inoculated leaves. In Taiwan, the recorded causing pathogens of tomato powdery mildew are Erysiphe orontii and E. cichoracearum (Tzen et al. 2019). To our knowledge, this is the first report of tomato powdery mildew caused by L. taurica. Typical lesions appeared in the beginning of the disease progress in the field. Through inoculation, the same pathogen could infect sweet peppers (Capsicum annuum L.), which has been also reported as a host of L. taurica (Tzen et al. 2019), suggesting these two crops could be as alternate hosts of L. taurica in the field. Cross-species infection should be taken into consideration while managing the disease.

Sign in / Sign up

Export Citation Format

Share Document