scholarly journals First Record of Clavibacter michiganensis subsp. michiganensis Causing Canker of Tomato Plants in Syria

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 649-649 ◽  
Author(s):  
R. Ftayeh ◽  
A. von Tiedemann ◽  
B. Koopmann ◽  
K. Rudolph ◽  
M. Abu-Ghorrah
Keyword(s):  
First Record ◽  
Bacterial Suspension ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Fresh Market ◽  
Gram Positive ◽  
Tomato Plants ◽  
Clavibacter Michiganensis Subsp ◽  
Whole Plants ◽  
Bacterial Canker Of Tomato

Between March and mid April of 2007, several extensive surveys for Clavibacter michiganensis subsp. michiganensis were carried out among greenhouses in the coastal strip provinces of the Mediterranean Sea in north-west Syria (Latakia and Tartous), where a large proportion of Syrian fresh-market tomatoes are produced. This bacterium causes bacterial canker of tomato and is considered an A2 quarantine pathogen by the European Plant Protection Organization (EPPO). It is currently present in all major tomato-production areas in the EPPO region (4), but has not been previously reported in Syria. The survey revealed typical canker symptoms in 7% of 150 inspected greenhouses that contained cvs. Dima, Huda, and Astona. These symptoms included stunting, dark brown-to-black lesions on the leaf margins, wilting and defoliation of whole plants, and vascular discoloration. The disease incidence in such greenhouses was estimated at 15% at the time of the survey. Diseased plants were surface sterilized and homogenized in sterile water. Serial dilutions were plated on nutrient glucose agar. Suspected colonies were further purified by repeated restreaking on new agar plates. All 10 of the suspected strains obtained from different locations were identified as C. michiganensis subsp. michiganensis on the basis of the following observations: bacterial cells of all strains had a coryneform shape, were nonmotile, gram positive according to Gram's reaction test with 3% KOH (2), oxidase-negative, and caused hypersensitive reactions on leaves of Mirabilis jalaba (1) within 24 h. PCR assays were conducted with the C. michiganensis subsp. michiganensis-specific primer set PSA-4/R (3) and template DNA prepared from in-vitro-grown bacteria with the MasterPure Gram Positive DNA Purification Kit (Epicentre Biotechnologies, Madison, WI). The expected 270-bp amplicon was observed for both reference strains as well as the Syrian strains. Pathogenicity of the strains was confirmed by artificial inoculation of 6-week-old tomato plants (Lycopersicon esculentum Mill. cv. Lyconorma). Inoculation was performed by stabbing the stem with a sterile needle through a drop (~35 μl) of bacterial suspension (~108 CFU/ml in 0.01 M MgSO4) placed in the axil of the second or third true leaf. Three tomato seedlings were inoculated with each strain. Control plants were inoculated with sterile 0.01 M MgSO4. Symptoms including lateral wilt of leaflets, stem lesions, and wilting of whole plants were observed within 10 to 15 days after inoculation, except for the negative control. To fulfill Koch's postulates, reisolation and reidentification of the pathogen was conducted as previously described. To our knowledge, this is the first record of the occurrence of bacterial canker of tomato in Syria. References: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990. (2) T. J. Gregersen. Appl. Microbiol. Biotechnol. 5:123, 1978. (3) K. H. Pastrik and F. A. Rainey. J. Phytopathol. 147:687, 1999. (4) I. M. Smith and L. M. F. Charles, eds. Map 253 in: Distribution Maps of Quarantine Pests for Europe. EPPO/CABI, 1998.

Attempts at Biological Control of Clavibacter michiganensis subsp. michiganensis On Rockwool-Grown Greenhouse Tomatoes

2008 ◽  
Vol 69 (1) ◽  
pp. 125-134 ◽  
Author(s):  
Czesław Ślusarski
Keyword(s):  
Biological Control ◽  
Biocontrol Agent ◽  
Root Zone ◽  
First Year ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Tomato Plants ◽  
Clavibacter Michiganensis Subsp ◽  
Greenhouse Tomatoes ◽  
Bacterial Canker Of Tomato

Attempts at Biological Control ofClavibacter michiganensissubsp.michiganensisOn Rockwool-Grown Greenhouse TomatoesTwo greenhouse experiments were conducted in which tomato plants artificially inoculated withClavibacter michiganensissubsp.michiganensis(Cmm) were grown in an open rockwool system as spring and autumn crops. Two isolates of the rhizosphere bacteria,Pseudomonas fluorescensstrain PSR21,Pseudomonas reactansstrain GGS14, a commercial biocontrol agent Aqua Bac Plus (Bacillusspp.) and a proprietary disinfectant containing QAC+Chx, applied at weekly intervals, were evaluated for their efficiency in the suppression of the bacterial canker of tomato. All treatments tested revealed to be ineffective in controlling the disease. The introduction ofCmmbacteria into the fresh rockwool in the first year of its usage resulted in a 100% death of tomato plants, whereas following an artificial inoculation of two- and three-year-old rockwool slabs withCmmbacteria dead plants amounted to 70 and 58%, respectively. This indicates that in the re-used rockwool a natural microbial suppressiveness to bacterial canker of tomato might be developed in the root zone.

scholarly journals A New Selective Medium for Isolation of Clavibacter michiganensis subsp. michiganensis from Tomato Plants and Seed

2011 ◽  
Vol 101 (11) ◽  
pp. 1355-1364 ◽  
Author(s):  
Radwan M. Ftayeh ◽  
Andreas von Tiedemann ◽  
Klaus W. E. Rudolph
Keyword(s):  
Bacterial Species ◽  
False Negative ◽  
Selective Medium ◽  
Detection Sensitivity ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Tomato Seed ◽  
Tomato Plants ◽  
Clavibacter Michiganensis Subsp ◽  
Bacterial Canker Of Tomato

A new selective and highly sensitive medium was developed for isolation of Clavibacter michiganensis subsp. michiganensis (Cmm), the causal agent of bacterial canker of tomato, from seed and latently infected plants. The new medium (BCT) proved to be superior to all published semiselective media for Cmm and is denoted as selective medium because of (i) its mean plating efficiency, amounting to ≤89% within 7 days for all 30 Cmm strains from different sources tested; (ii) the high selectivity, because accompanying bacterial species occurring on tomato plants and seed or bacteria obtained from culture collections were inhibited to an extent of 98 to 100%; and (iii) the remarkable detection sensitivity. Thus, 8 CFU of Cmm in field plant homogenates containing 12,750 CFU of accompanying saprophytes were detected on BCT. Under these extreme conditions, all of the published semiselective media (D2, KBT, D2ANX, SCM, mSCM, CMM1, mCNS, and EPPO) gave false-negative results. Either some media were rather toxic and Cmm growth was also inhibited or the other, less toxic media allowed growth of high numbers of saprophytes, so that Cmm growth was suppressed. Exclusively, BCT also supported growth of the closely related C. michiganensis subsp. insidiosus, nebraskensis, and tessellarius. The new medium is recommended for Cmm detection in tomato seed, and in symptomless tomato plantlets, to improve disease control of bacterial canker of tomato.

Detection and identification of bacterial canker of tomato Clavibacter michiganensis subsp. michiganensis

2021 ◽  
Author(s):  
I.N. Pisareva ◽  
◽  
O.Yu. Slovareva ◽  
Keyword(s):  
Sample Preparation ◽  
Plant Material ◽  
Plant Sample ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Diagnostic Protocol ◽  
Clavibacter Michiganensis Subsp ◽  
Detection And Identification ◽  
Bacterial Canker Of Tomato

The study is devoted to the diagnosis of bacterial canker of tomato (Cmm). The method of sampling and plant sample preparation has been adapted. PCR recommended by the international diagnostic protocol and other sources have been tested. The use of methods made it possible to identify Cmm in plant material

scholarly journals Bacterial Canker (Clavibacter michiganensis subsp. michiganensis) of Tomato in Commercial Seed Produced in Indonesia

Plant Disease ◽  
2004 ◽  
Vol 88 (6) ◽  
pp. 680-680 ◽  
Author(s):  
A. Anwar ◽  
P. S. van der Zouwen ◽  
S. Ilyas ◽  
J. M. van der Wolf
Keyword(s):  
Enzyme Linked Immunosorbent Assay ◽  
Pathogenicity Test ◽  
Bacterial Canker ◽  
Vegetable Crops ◽  
Clavibacter Michiganensis ◽  
Tomato Seed ◽  
Causal Organism ◽  
Tomato Production ◽  
Clavibacter Michiganensis Subsp ◽  
Bacterial Canker Of Tomato

In 2002, Clavibacter michiganensis subsp. michiganensis (Smith) Davis, the causal organism of bacterial canker of tomato (Lycopersicon esculentum), was isolated from two of six commercial asymptomatic tomato seed lots produced on Java in Indonesia. C. michiganensis subsp. michiganensis has not been reported in Indonesia previously. Methods based on the protocol of the International Seed Health Initiative were used to extract and identify the presence of C. michiganensis subsp. michiganensis in tomato seed. C. michiganensis subsp. michiganensis was isolated with dilution plating on the semiselective media D2ANX and mSCM. The identity of the colonies was confirmed by immunofluorescence microscopy, polymerase chain reaction (2), fatty methyl ester analysis, enzyme-linked immunosorbent assay based on monoclonal antibody 103 (1), and a pathogenicity test in which three replicate tomato plants were stem inoculated with 108 cells ml-1. Within 2 weeks, stripes on stems developed that split and exposed reddish brown cavities (stem cankers). The presence of C. michiganensis subsp. michiganensis poses a direct threat on tomato production, which is one of five economically most important vegetable crops in Indonesia. References: (1) A. Alvarez et al. Phytopathology 83:1405, 1993. (2) M. S. Santos et al. Seed Sci. Technol. 25:581, 1997.

scholarly journals Severe Outbreak of Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in Central Italy

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 221-221 ◽  
Author(s):  
J. R. Lamichhane ◽  
G. M. Balestra ◽  
L. Varvaro
Keyword(s):  
16S Rdna ◽  
Central Italy ◽  
Negative Control ◽  
Economic Losses ◽  
Bacterial Suspension ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Tomato Seedlings ◽  
Clavibacter Michiganensis Subsp ◽  
Tomato Field

From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.

scholarly journals Bacterial Canker of Tomato: Current Knowledge of Detection, Management, Resistance, and Interactions

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 4-13 ◽  
Author(s):  
Yusuf Sen ◽  
Jan van der Wolf ◽  
Richard G. F. Visser ◽  
Sjaak van Heusden
Keyword(s):  
Virulence Factors ◽  
Type Iii Secretion ◽  
Current Knowledge ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Clavibacter Michiganensis Subsp ◽  
The Many ◽  
Molecular Mode ◽  
Bacterial Canker Of Tomato ◽  
Intensive Work

Clavibacter michiganensis subsp. michiganensis is the causal agent of bacterial canker of tomato. The disease was first described in 1910 in Michigan, USA. C. michiganensis subsp. michiganensis (from now on called clavibacter) was initially thought to be a phloem parasite, but was later found to be a xylem-invading bacterium. The host range comprises mainly solanaceous crops such as tomato, pepper, and eggplant. Strains show great variability in virulence and are usually described as being hypervirulent, hypovirulent, or nonvirulent. Clavibacter lacks a type III secretion system, and only a few virulence factors have been experimentally determined from the many putative virulence factors. As the molecular mode of infection by clavibacter is unknown, researchers have avoided intensive work on this organism. Genetic plant mechanisms conferring resistance to clavibacter are apparently complex, and breeders have yet to develop disease-resistant cultivars.

Sign in / Sign up

Export Citation Format

Share Document