scholarly journals First Report of a Leaf Blight of Onion Caused by Xanthomonas spp. in Georgia

Plant Disease ◽  
2003 ◽  
Vol 87 (6) ◽  
pp. 749-749 ◽  
Author(s):  
F. H. Sanders ◽  
D. B. Langston ◽  
J. H. Brock ◽  
R. D. Gitaitis ◽  
D. E. Curry ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Methyl Esters ◽  
Economic Loss ◽  
Leaf Blight ◽  
Identification System ◽  
Sterile Water ◽  
Disease Symptoms ◽  
First Report ◽  
Microbial Identification ◽  
Dry Conditions

In October of 2001 and 2002, a leaf blight was reported affecting Vidalia onion (Allium cepa) cvs. Pegasus and Sweet Vidalia, respectively, in one field each. Lesions on onion seedlings began as a water-soaked, tip dieback that gradually blighted the entire leaf. Symptoms on onion transplants appeared as elongated, water-soaked lesions that typically collapsed at the point of initial infection. In both cases, disease was very severe on seedlings, and disease incidence was 50% or more in both fields. Warm temperatures combined with overhead irrigation and above average rainfall likely enhanced the severity and spread of disease. Disease was not detected on more mature onions once cool, dry conditions occurred later in the season, and no significant economic loss occurred. Seed was tested from seed lots of the aforementioned cultivars and Xanthomonas spp. were not found. Diseased tissue was macerated in sterile, phosphate-buffered saline, and 10 μl of the resulting suspension was streaked on nutrient agar plates. Yellow-pigmented, gram-negative, rod-shaped bacteria were isolated routinely from diseased tissue. Bacteria were catalase-positive, cellulolytic, oxidase-negative, amylolytic, proteolytic, and utilized glucose in an oxidative manner. Analysis of whole cell, fatty acid methyl esters (FAME) using the Microbial Identification System (MIS, Sherlock version 3.1; MIDI, Inc., Newark, DE) identified four representative strains of the bacterium as a pathovar of Xanthomonas axonopodis (similarity indices 0.75 to 0.83). Known Xanthomonas spp. from onion from Colorado and Texas (1,2) had similar FAME profiles when analyzed by the MIDI system. Onion plants were grown under greenhouse conditions for 2 months and inoculated by injecting the base of a quill with 1.0 ml of bacterial suspensions (1 × 107 CFU ml-1) of the Xanthomonas sp. isolated from Georgia, and negative controls were inoculated with 1 ml of sterile water. Disease symptoms developed on plants inoculated with bacterial suspensions in 4 to 7 days and Xanthomonas sp. was isolated from the lesions produced. Disease symptoms occurred when the same suspension was sprayed on onion foliage. No symptoms occurred on plants inoculated with 1 ml of sterile water. To our knowledge, this is the first report of Xanthomonas spp. affecting Vidalia onions. References: (1) T. Isakeit et al. Plant Dis. 84:201, 2000. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:922, 2000.

scholarly journals First Report of Leaf Blight of Onion Caused by Xanthomonas campestris in the Continental United States

Plant Disease ◽  
2000 ◽  
Vol 84 (2) ◽  
pp. 201-201 ◽  
Author(s):  
T. Isakeit ◽  
M. E. Miller ◽  
L. W. Barnes ◽  
E. R. Dickstein ◽  
J. B. Jones
Keyword(s):  
United States ◽  
Xanthomonas Campestris ◽  
Acid Methyl Ester ◽  
Leaf Blight ◽  
Nutrient Agar ◽  
Identification System ◽  
Sterile Water ◽  
First Report ◽  
Microbial Identification ◽  
Similarity Indices

In March 1998, a leaf blight of onion (Allium cepa L. ‘1015’) was found on many plants in a plot on the Texas A&M Agricultural Experiment Station in Weslaco. The symptoms were longitudinal chlorotic areas on one side of the leaf, containing sunken, elliptical necrotic lesions. Affected leaves ultimately died. Chlorotic lesions were swabbed with 70% ethanol, and tissue from beneath the epidermis was placed in a drop sterile water for 20 min. Drops were streaked on nutrient agar and incubated at 30°C. Isolations yielded gram-negative, rod-shaped bacteria that formed dark yellow, gummy colonies on yeast dextrose carbonate agar medium, hydrolyzed starch, and had a single, polar flagellum. Analysis of fatty acid methyl ester (FAME) profiles, using the Microbial Identification System (MIS, version 4.15; Microbial Identification, Newark, DE), done at the Texas Plant Disease Diagnostic Laboratory, College Station, identified nine isolates as Xanthomonas campestris (similarity indices of 0.31 to 0.54). Tests at the University of Florida supported this identification: FAME profiles using MIS version 3.9 gave similarity indices of 0.89 to 0.95, and profiles using Biolog GN Microplates, MicroLog database release 3.50 (Biolog, Hayward, CA), gave similarity indices of 0.03 to 0.76. Leaves (15 to 20 cm long) of potted onions (cv. 1015 at the five- to six-leaf stage) were infiltrated with a suspension of bacteria (107 CFU per ml), using a needle and syringe. Plants were maintained in mist chamber in a greenhouse at 24°C. Water-soaking and development of pale green color of the inoculated leaf occurred after 2 days, followed by death after 4 days. There were no symptoms on leaves inoculated with sterile water. Pathogenicity tests on four isolates were repeated once. Bacteria were reisolated on nutrient agar from symptomatic tissue but not from controls. In the field plot, disease severity did not increase as season progressed nor were there any symptoms on bulbs. Symptoms were not observed on onion during the 1999 season. X. campestris was first reported on onion from Hawaii (1). This is the first report of this pathogen on onion in the continental United States. Reference: (1) A. M. Alvarez et al. Phytopathology 68:1132, 1978.

scholarly journals First Report of Leaf Blight of Adenophora triphylla var. japonica caused by Pseudomonas viridiflava in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Seunghwan Kim ◽  
Hyeok Tae Kwon ◽  
Youn Mi Lee ◽  
Chung Ryul Jung ◽  
Balaraju Kotnala ◽  
...  
Keyword(s):  
16S Rdna ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Leaf Blight ◽  
Identification System ◽  
Post Inoculation ◽  
First Report ◽  
Microbial Identification ◽  
Pseudomonas Viridiflava ◽  
Pathogenicity Tests

Severe disease with leaf spots and necrotic symptoms were observed in Adenophora triphylla var. japonica (Regel) Hara (A. triphylla) during the survey in July 2020 on a field in Andong, Gyeongbuk province, Korea. It is a highly valued medicinal plant used to treat various diseases, including cough, cancer, and obesity. The infected plants initially showed spots with halo lesions, at later stages, enlarged and spread to the leaves, which the lesions becoming yellowing and chlorotic (Fig. 1). In some areas, disease incidence was up to 15% of the plants. The symptomatic samples were collected from A. triphylla and cut into 4 to 5 mm squares, surface-sterilized in 1% sodium hypochlorite for 1 min, rinsed three times, and macerated in sterile distilled water (SDW). They were spread onto nutrient agar (NA) plates and incubated at 28°C for 3 days. The representative bacterial strains selected for identification showed fluorescent colonies on King’s medium B (KB). Fifteen isolates from independent samples were subjected to biochemical and pathogenicity tests. The isolates induced a hypersensitive reaction in tobacco leaves, gave a reaction in the anaerobe respiratory test, and were negative for levan, oxidase, arginine dihydrolase, gelatin hydrolysis, aesculin hydrolysis, and starch hydrolysis. The isolated strains presented the following LOPAT profile: – – + – +. The Biolog GN2 microplate and the Release 4.20 system putatively found the isolate to exhibit 93% similarity with the bacterium, Pseudomonas viridiflava. Likewise, analysis of FAME profiles using the Microbial identification system (Sherlock version 3.1) also characterized the representative bacterial strain as P. viridiflava with 87% similarity. The genomic DNA of the isolate was extracted, and the 16S rDNA sequence was amplified with a universal bacterial primer set (27F and 1492R). The sequence was submitted to GenBank under the accession number MT975233. BLASTn analysis yielded 99.79% identity with P. viridiflava strain RT228.1b (accession no. AY604846.1) and 99.72% similarity with P. viridiflava KNOX249.1b strain (accession no. AY604848.1). Phylogenetic dendrogram constructed from the comparative analysis of 16S rDNA gene sequences showing the relationship between P. viridiflava GYUN274 and related Pseudomonas species (Fig. 2). Pathogenicity tests were conducted three times on seedling of A. triphylla by spraying 50 ml of bacterial suspensions of a 24-h culture in KB medium (108 CFU/ml). The leaves inoculated with SDW alone did not develop symptoms; however, the plants treated with isolated bacterial suspensions developed halo and blight symptoms similar to those observed in the field 7 days post-inoculation. Finally, Koch’s postulates were verified by re-isolating P. viridiflava from all symptomatic tissues and determined to be morphologically identical to the original isolates. To our knowledge, this is the first report of leaf blight disease of A. triphylla caused by P. viridiflava in Korea. Based on the observed symptoms, and identification by morphological characteristics, molecular data, and pathogenicity against the host plant, the proper control measures can be identified in future studies.

scholarly journals Occurrence of Bacterial Stem Rot, Caused by Erwinia chrysanthemi, on Field-Grown Tomato in Florida

Plant Disease ◽  
1998 ◽  
Vol 82 (7) ◽  
pp. 831-831 ◽  
Author(s):  
D. O. Chellemi ◽  
H. A. Dankers ◽  
K. Hill ◽  
R. E. Cullen ◽  
G. W. Simone ◽  
...  
Keyword(s):  
Pathogenic Bacteria ◽  
Methyl Esters ◽  
Sole Source ◽  
Erwinia Chrysanthemi ◽  
Identification System ◽  
Bacterial Cells ◽  
Sterile Water ◽  
Microbial Identification ◽  
Pure Cultures ◽  
Tomato Isolate

In September 1997, wilted 4-week-old tomato (Lycopersicon esculentum Mill.) plants were observed in a commercial production field in St. Lucie County, FL. Closer inspection of affected plants revealed hollow stems and petioles with dark, water-soaked lesions. Diseased tissue was macerated and streaked onto nutrient agar (NA) and crystal violet pectate (CVP) agar. After incubation for 2 days at 30°C, isolates produced pits on the CVP agar. Isolates were transferred onto NA and the incubation and transfer procedure was performed two additional times to obtain pure cultures. Suspensions of bacterial cells were injected into tomato and tobacco leaves to test for a hypersensitive or pathogenic reaction. Isolates produced collapsed necrotic tissue on tomato while no reaction was observed on tobacco. Tests for differentiating species and subspecies in the ‘carotovora’ group of Erwinia were conducted following the protocol of Dickey and Kelman (1). With known cultures of E. carotovora subsp. carotovora and E. chrysanthemi as controls, the isolate from tomato was determined to function as a facultative anaerobe, utilize asparagine as a sole source of carbon and nitrogen, and give positive reactions for pectate degradation, phosphatase, and growth at 37°C. Known cultures of E. carotovora subsp. carotovora, E. chrysanthemi, and the tomato isolate were grown on trypticase soy broth agar for 24 h at 28°C and their cellular fatty acids derivatized to fatty acid methyl esters (FAMEs). Statistical analyses of FAME profile data (MIDI Microbial Identification System, Newark, DE, version 3.60) identified the tomato isolate as Erwinia chrysanthemi. Pathogenicity was determined by inoculating 50-day-old tomato plants (cv. SunPride) with a suspension of E. chrysanthemi obtained from nutrient broth plates incubated at 24°C for 60 h. Three plants each were inoculated with the E. chrysanthemi identified from tomato, sterile water, and known cultures of E. chrysanthemi and E. carotovora subsp. carotovora by placing a drop at the junction of the petiole and stem and passing a sterile needle through the drop into the stem. Plants were maintained in a greenhouse. Dark, water-soaked cankers were observed on the stems of plants inoculated with E. chrysanthemi, including the tomato isolate and E. carotovora subsp. carotovora, after 7 days. No symptoms were observed on plants inoculated with sterile water. Reisolation of the pathogen and identification was performed with tissue from one of the symptomatic inoculated plants. Analyses of FAMEs confirmed E. chrysanthemi as the causal agent. This is the first report of E. chrysanthemi causing a vascular disease of field-grown tomato in Florida. Reference: (1) R. S. Dickey and A. Kelman. 1988. Pages 44–59 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. American Phytopathological Society, St. Paul, MN.

scholarly journals First Report of Bacterial Head Rot of Broccoli Caused by Pseudomonas fluorescens in China

Plant Disease ◽  
2009 ◽  
Vol 93 (11) ◽  
pp. 1219-1219 ◽  
Author(s):  
B. Li ◽  
G. L. Wang ◽  
Z. Y. Wu ◽  
W. Qiu ◽  
Q. M. Tang ◽  
...  
Keyword(s):  
Fatty Acid ◽  
Pseudomonas Fluorescens ◽  
Pathogenic Bacteria ◽  
Disease Incidence ◽  
Identification System ◽  
Rrna Gene ◽  
First Report ◽  
Microbial Identification ◽  
Microbial Identification System ◽  
Head Rot

During warm and humid periods in the winters from 2005 to 2008, head rot symptoms on broccoli (cv. Sijilv) (Brassica oleracea L. var italica Planch) were observed in commercial fields in Ningbo, Zhejiang Province, China. In agreement with the report of Cui and Harling (1), water-soaked lesions developed on the buds and then progressed into a brown-black soft rot. Longitudinal sections of the symptomatic inflorescences showed brown discoloration and rotting of the internal tissues. Broccoli production is hampered by the disease, with disease incidence ranging from 65 to 81%. Bacteria were isolated by streaking on nutrient agar (3) and individual colonies formed after 2 to 3 days of incubation at 28°C. Fifteen of thirty isolates induced hypersensitive reactions (HR) on tobacco leaves (Nicotiana tabacum cv. Samsun) within 48 h. All the HR-positive strains were fluorescent on King's medium B and the colonies were smooth, convex, entire, and round. Classical bacteriological tests indicated that the fluorescent strains were gram negative, obligate aerobes, arginine dihydrolase positive, and oxidase positive. Also, the fluorescent strains were positive for the production of levan from sucrose. Five representative strains were further characterized by the Biolog Microbial Identification System, version 4.2 (Biolog Inc., Hayward, CA) and gas chromatography of fatty acid methyl esters (FAME) using the Microbial Identification System (MIDI Inc., Newark, DE) with the aerobic bacterial library (TSBA50). The five strains were identified as Pseudomonas fluorescens with Biolog and FAME similarity indexes of 0.61 to 0.68 and 0.52 to 0.58, respectively. The 16S rRNA gene sequence of broccoli strain PFB-01 (GenBank Accession No. GQ352649) was determined according to Li et al. (2). A subsequent GenBank search showed that this sequence had 98% nucleotide identity with the type strain of P. fluorescens (ATCC 17386T, GenBank Accession No. AF094726). Koch's postulates were completed by the inoculation of broccoli heads (cv. Sijilv) with cell suspensions (107 CFU/ml) of the above five strains by spraying on the surface of subcorymbs. Each treatment had five replicates. All strains induced head rot symptoms similar to those observed in natural infections. No symptoms were noted on the control plants inoculated with sterile water. Bacteria were successfully reisolated from symptomatic heads and confirmed by the cellular fatty acid composition. To our knowledge, this is the first report in China that P. fluorescens is the causal pathogen of bacterial head rot of broccoli. References: (1) X. Cui and R. Harling. Phytopathology 96:408, 2006. (2) B. Li et al. J. Phytopathol. 154:711, 2006. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society. St. Paul, MN, 2001.

scholarly journals First Report of Fire Blight Disease Caused by Erwinia amylovora on Rockspray (Cotoneaster horizontalis) in Turkey

Plant Disease ◽  
2012 ◽  
Vol 96 (11) ◽  
pp. 1690-1690
Author(s):  
K. K. Bastas ◽  
F. Sahin
Keyword(s):  
Erwinia Amylovora ◽  
Disease Incidence ◽  
Acid Methyl Ester ◽  
Late Summer ◽  
Control Measures ◽  
Bacterial Suspension ◽  
Identification System ◽  
Bacterial Strains ◽  
First Report ◽  
Microbial Identification

In the late summer and early winter of 2008 and 2009, leaf and shoot blight and cankers with reddish and brownish necrotic tissue on mature branches of Cotoneaster horizontalis were investigated in landscape areas of Konya province in Turkey. Disease incidence was estimated at 2%. Bacteria were consistently isolated from the lesions on leaves and shoots on nutrient sucrose agar medium. Twelve representative bacterial strains were isolated and characterized as gram-negative, rod-shaped, mucoid, fermentative, yellow-orange on MS medium, positive for levan formation and acetoin production, no growth at 36°C, positive for gelatin hydrolysis, and negative for indole, urease, oxidase, arginine dehydrolase, reduction of nitrate, and acid production from lactose and inositol (2). Two reference strains of Erwinia amylovora (EaP28 and NCPPB 2791) obtained from the culture collection unit of Selcuk University were used as positive controls. All strains induced a hypersensitive response in tobacco (Nicotiana tobaccum cv. White Burley). All strains were identified as E. amylovora on the basis of amplification of a 1 kb DNA fragment with a species-specific primer set, A/B (1) by PCR, and fatty acid methyl ester profiles determined by Sherlock Microbial Identification System software (TSBA 6 v. 6.00; Microbial ID, Newark, DE) with similarity indices ranging from of 83 to 96%. Pathogenicity tests were performed by injecting 20 μl of a bacterial suspension (108 CFU ml–1) into the shoot tips of 3-year-old C. horizontalis seedlings. Leaf and shoot blighting symptoms were observed within 10 to 15 days, but no symptoms were observed on control plants treated with sterile water. The bacterium was reisolated from the lesions on leaves and shoots and identified as described above. To our knowledge, this is the first report of E. amylovora on cotoneaster in Turkey. Control measures are needed to prevent any further spread of the bacterium to new landscape areas. References: (1) S. Bereswill et al. Appl. Environ. Microbiol. 58:3522, 1992. (2) A. L. Jones and K. Geider. Page 40 in: Laboratory Guide for Identification of Plant Pathological Bacteria, 2001.

scholarly journals First Report of Fire Blight Disease on Blackberry in Turkey

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1818-1818
Author(s):  
K. K. Bastas ◽  
F. Sahin
Keyword(s):  
Disease Incidence ◽  
Acid Methyl Ester ◽  
Negative Control ◽  
Culture Collection ◽  
Bacterial Suspension ◽  
Identification System ◽  
Distilled Water ◽  
Bacterial Strains ◽  
First Report ◽  
Microbial Identification

During 2008 and 2009, a new disease on blackberry (Rubus fruticosus cv. Chester) causing leaf and shoot blight and cankers with brown discoloration of necrotic tissues on mature branches was observed in Isparta and Konya provinces of Turkey. Disease incidence was estimated to be 4% for the two years. Isolations were made from lesions on leaves and shoots on nutrient sucrose agar (NSA) medium. Bacteria consistently isolated from the diseased tissues were identified on the basis of biochemical, physiological (2), and molecular tests (1). Eleven representative bacterial strains were gram-negative, rod-shaped, mucoid, fermentative, yellow-orange on Miller and Scroth (MS) medium, positive for levan formation and acetoin production, no growth at 36°C, positive for gelatin hydrolysis, and negative for esculin hydrolysis, indole, urease, catalase, oxidase, arginine dehydrolase, reduction of nitrate, acid production from lactose, and inositol. Two reference strains of Erwinia amylovora (EaP28 and NCPPB 2791) obtained from the culture collection unit of Selcuk University were used as positive controls. All strains induced a hypersensitive response in tobacco (Nicotiana tobaccum cv White Burley) 24 h after inoculation with a 108 CFU/ml bacterial suspension in water. All strains were identified as E. amylovora using the species-specific primers set A/B (1), which amplified a 1-kb DNA fragment in PCR, and fatty acid methyl ester (FAME) profiles determined by Sherlock Microbial Identification System software (TSBA 6 v. 6.00; Microbial ID, Newark, DE) with similarity indices ranging from of 79 to 99%. Pathogenicity was confirmed by injecting bacterial suspensions (108 CFU/ml–1) in sterile distilled water into the shoot tips of 2-year-old R. fruticosus cv. Chester and the first blighting symptoms were observed on leaves within 3 days and also 10 days later after inoculation on shoots. Sterile distilled water was used as a negative control. No symptoms were observed on control plants. All tests were repeated three times. The bacterium was reisolated from inoculated plants and identified as. E. amylovora. To our knowledge, this is the first report of E. amylovora on blackberry in Turkey. Phytosanitary measures are needed to prevent any further spread of the bacterium to new blackberry areas. References: (1) S. Bereswill et al. App. Environ. Microbiol. 58:3522, 1992. (2) A. L. Jones and K. Geider. Lab. Guide for Identification of Plant Pathological Bacteria, 40, 2001.

scholarly journals First Report of Acidovorax avenae subsp. citrulli as the Causal Agent of Bacterial Leaf Blight of Betelvine in Taiwan

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1065-1065 ◽  
Author(s):  
W.-L. Deng ◽  
T.-C. Huang ◽  
Y.-C. Tsai
Keyword(s):  
Leaf Blight ◽  
Causal Agent ◽  
Bacterial Leaf Blight ◽  
Bacterial Suspension ◽  
Identification System ◽  
Distilled Water ◽  
First Report ◽  
Microbial Identification ◽  
Sequence Identity ◽  
Disease Free

In November 2008, betelvines (Piper betle L., Piperaceae) exhibiting leaf blight symptoms were observed in central Taiwan. Infections resulted in a 30 to 70% loss of leaf yield in the investigated betel leaf-producing facilities. Symptoms began with small, necrotic, water-soaked spots that progressed to circular to irregularly shaped brown lesions, 5 to 10 mm in diameter, with chlorotic halos on leaves; some lesions started from the edge of leaves and later fused to form dried, necrotic margins. Bacteria-like streaming fluid was visible from the edges of freshly cut lesions at the junctions of chlorotic and necrotic leaf tissues when observed with a light microscope at ×100. When the streaming fluid was streaked onto King's medium B (3), a slow-growing, gram-negative, nonfluorescent bacterium was identified from the whitish colonies that consistently developed on the medium. Five bacterial isolates from three lesions were characterized with fatty acid methyl ester analysis (Agilent Technologies, Santa Clara, CA) and Sherlock Microbial Identification System (Microbial IDentification Inc., Newark, DE), and for each isolate, the bacterium was confirmed as Acidovorax avenae subsp. citrulli with a similarity index >0.70. In addition, the Biolog system (Biolog, Hayward, CA) and 16S ribosomal RNA sequence identity comparison were performed to confirm that the five betelvine-isolated bacteria were A. avenae subsp. citrulli based on a similarity of 0.54 with Biolog and 99% sequence identity for 16S rRNA gene. Koch's postulates were fulfilled by infiltrating a bacterial suspension of 3 × 105 CFU/ml into 40 leaves of four greenhouse-grown, disease-free, mature betelvine plants. After inoculation, plants were kept in a humidified greenhouse at 28°C to favor symptom development and symptoms similar to those observed in the greenhouse were evident at 7 days post inoculation (dpi) on all bacterium-infiltrated leaves. Control leaves infiltrated with distilled water remained symptomless. Bacteria showing morphological and biochemical similarities (2) to the ones used for inoculation were isolated from all of the inoculated betelvine leaves. In addition, a bacterial suspension at 3 × 108 CFU/ml was sprayed at the amount of 5 ml per plant onto 6 to 10 plants each of 4-week-old disease-free seedlings of watermelon (Citrullus lanatus (Thunb.) Matsum & Nakai, cv. Empire No. 2), oriental sweet melon (Cucumis melo L. var. saccharinus Naudin, cv. Silver Beam), and waxgourd (Benincasa hispida (Thunb.) Cogn., cv. Cheerer) for bioassays, and the inoculated seedlings were enclosed in plastic bags for 36 h at 28°C. Water-soaked lesions were observed on leaves of watermelon and waxgourd at 2 dpi and on sweet melon at 4 dpi on all inoculated plants but not on distilled water-sprayed control plants, indicating that A. avenae subsp. citrulli strains from betelvine could also infect melon plants. A. avenae subsp. citrulli was previously identified as the causal agent of bacterial fruit blotch on melon and bitter gourd in Taiwan (1). To our knowledge, this is the first report that A. avenae subsp. citrulli can naturally infect betelvine, a noncucurbit crop, to elicit bacterial leaf blight disease. References: (1) A.-H. Cheng and T.-C. Huang. Plant Pathol. Bull. 7:216, 1998. (2) J. B. Jones et al. Page 121 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (3) E. O. King et al. J. Lab. Clin. Med. 44:301, 1954.

scholarly journals Identification of Three Strains of Mycobacterium Species Isolated from Clinical Samples Using Fatty Acid Methyl Ester Profiling

2003 ◽  
Vol 31 (2) ◽  
pp. 133-140 ◽  
Author(s):  
A Ozbek ◽  
O Aktas
Keyword(s):  
Fatty Acid ◽  
Methyl Esters ◽  
Acid Methyl Ester ◽  
Cellular Fatty Acid ◽  
Clinical Samples ◽  
Identification System ◽  
Cyclopropane Fatty Acid ◽  
Mycobacterium Species ◽  
Microbial Identification ◽  
Acid Methyl

The cellular fatty acid profiles of 67 strains belonging to three different species of the genus Mycobacterium were determined by gas chromatography of the fatty acid methyl esters, using the MIDI Sherlock® Microbial Identification System (MIS). The species M. tuberculosis, M. xenopi and M. avium complex were clearly distinguishable and could be identified based on the presence and concentrations of 12 fatty acids: 14:0, 15:0, 16:1ω7c, 16:1ω6c, 16:0, 17:0, 18:2ω6,9c, 18:1ω9c, 18:0, 10Me-18:0 tuberculostearic acid, alcohol and cyclopropane. Fatty acid analysis showed that there is great homogeneity within and heterogeneity between Mycobacterium species. Thus the MIS is an accurate, efficient and relatively rapid method for the identification of mycobacteria.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of a Fruit Rot of Pumpkin Caused by Acidivorax avenae subsp. citrulli in Georgia

Plant Disease ◽  
1999 ◽  
Vol 83 (2) ◽  
pp. 199-199 ◽  
Author(s):  
D. B. Langston ◽  
R. D. Walcott ◽  
R. D. Gitaitis ◽  
F. H. Sanders
Keyword(s):  
Polyclonal Antibodies ◽  
Pcr Amplification ◽  
Tween 80 ◽  
Soft Rot ◽  
Fruit Rot ◽  
Identification System ◽  
Banding Patterns ◽  
First Report ◽  
Microbial Identification ◽  
Necrotic Spots

In September 1998, a fruit rot was reported affecting pumpkin (Cucurbita pepo) in a commercial field in Terrell Co., Georgia. Symptoms on the surface of fruit occurred as round, necrotic spots or cracks a few millimeters in diameter. With age, the tissue surrounding these lesions became soft and wrinkled. A soft rot expanded into the flesh of the pumpkin, originating from the lesions observed on the surface. In time, infected pumpkins totally collapsed. V-shaped, necrotic lesions occurred at the margin of the leaf and extended inward toward the mid-rib. Samples were collected from the field and bacteria were isolated from fruit and leaf lesions onto King's medium B (1). The bacterium isolated was rod shaped, gram negative, nonflourescent, oxidase positive, Tween 80 positive, carboxymethyl cellulose positive, β-OH butyrate positive, and malonate negative. The bacterium reacted positively with polyclonal antibodies specific for the watermelon fruit blotch pathogen Acidivorax avenae subsp. citrulli and was identified as A. avenae subsp. citrulli by MIDI (Microbial Identification System, Newark, DE) according to statistical analysis of fatty acid data. Results from polymerase chain reaction (PCR) amplification of the bacterium isolated from pumpkin yielded 360-bp fragments that, when digested with the restriction enzyme HaeIII, had DNA banding patterns identical to those of stock A. avenae subsp. citrulli DNA. Koch's postulates were completed successfully with 2-week-old watermelon seedlings. This is the first report of A. avenae subsp. citrulli causing fruit rot of pumpkin in Georgia. Reference: (1) E. O. King et al. J. Lab. Clin. Med. 44:301, 1954.

Sign in / Sign up

Export Citation Format

Share Document