scholarly journals First Report of Botrytis cinerea on Pansy Flowers in Buenos Aires

Plant Disease ◽  
2004 ◽  
Vol 88 (10) ◽  
pp. 1164-1164
Author(s):  
M. C. Rivera ◽  
S. E. Lopez
Keyword(s):  
Botrytis Cinerea ◽  
Buenos Aires ◽  
Rapid Development ◽  
Pathogenic Fungi ◽  
Gray Mold ◽  
Conidial Suspension ◽  
New Host ◽  
Disease Symptoms ◽  
Plastic Bags ◽  
Pathogenicity Tests

Pansy (Viola × wittrockiana) is an ornamental annual plant produced as a potted plant in greenhouses around Buenos Aires, Argentina. Flower rot with signs of gray mold was observed on pansy cv. Crown during the autumn of 2003. Diseased tissues were surface sterilized by immersion in 2% NaOCl for 1 min, placed on 2% potato dextrose agar (PDA), and incubated at 22°C. Fungal mycelia were initially white and became gray after 72 h. After 4 days, colonies were 4 cm in diameter and sporulated profusely. Black sclerotia developed after 7 days. Mycelia were septate with dark branched conidiophores bearing unicellular, ellipsoid, hyaline conidia that measured 8 to 12 × 6 to 8 μm in botryose heads. These characteristics agree with Botrytis cinerea Pers.:Fr. (1). Pathogenicity tests were performed by spraying 10 healthy pansy plants during bloom with 3 ml of a conidial suspension (106 conidia per ml) per plant. Controls were treated with sterilized distilled water only. Plants were covered with plastic bags for 2 days and incubated at 18 to 22°C. The flowers developed water-soaked lesions between 4 and 6 days after inoculation. Fifty percent of the flowers were pendulous because flower blight reached the peduncle. The pathogen was reisolated from diseased flowers after superficial sterilization with 2% NaOCl and isolated on PDA. Gray mold has a rapid development during bloom, and the pathogen was able to enter undamaged flower tissues. No disease symptoms were observed on leaves. This report adds pansy as a new host of B. cinerea to a previous list of ornamentals grown in Argentina where gray mold was observed. Reference: (1) M. V. Ellis and J. M. Waller. Sclerotinia fuckeliana (condial state: Botrytis cinerea). No. 431 in: Descriptions of Pathogenic Fungi and Bacteria, CMI, Kew, Surrey, UK, 1974.

scholarly journals Gray Mold of Green Shiso (Perilla frutescens), Caused by Botrytis cinerea, in California

Plant Disease ◽  
2012 ◽  
Vol 96 (6) ◽  
pp. 908-908 ◽  
Author(s):  
S. T. Koike ◽  
O. Daugovish
Keyword(s):  
Botrytis Cinerea ◽  
Pathogenic Fungi ◽  
The United States ◽  
Gray Mold ◽  
Early Spring ◽  
Perilla Frutescens ◽  
Foliar Blight ◽  
Plastic Bags ◽  
Initial Symptoms ◽  
Blight Disease

Shiso (Perilla frutescens) is a leafy herb in the Lamiaceae family and is widely used in Japanese and other Asian cuisine for cooking, pickling, oil (from the seeds), and garnish. A number of shiso types are used, though the most common are green shiso (ao-shiso) and red shiso (aka-shiso). In the winter months of 2010 and early spring 2011, a foliar blight disease developed on greenhouse-grown green shiso produced in Ventura County, CA. Initial symptoms were angular, dull green leaf lesions on older foliage. Such lesions often were initiated along leaf edges. As the disease progressed, lesions turned gray green, expanded, and could affect most of the leaf surface. Lesion tissue became dry and papery in texture; signs of a pathogen were not present. Tests for bacterial agents were negative. However, a fungus was consistently isolated from symptomatic leaves. Isolates of this fungus were grown on potato dextrose agar (PDA) in petri plates incubated under fluorescent lights and were identified as Botrytis cinerea (1). On PDA, mycelial growth was gray brown and conidiophores measured 2 mm or longer and were branched at the terminals. Conidia were aseptate, hyaline, ellipsoidal, and measured (6.5–) 8.4 to 9.2 (–12.0) × (6.1–) 6.8 to 8.0 (–9.5) μm. Sclerotia were not present. Pathogenicity of four isolates was tested by spraying conidial suspensions (1 × 105 conidia/ml) until runoff onto sets of potted green and red shiso plants. Each set consisted of six wounded (leaf tips cut) and six unwounded plants. Plants were enclosed in plastic bags for 48 h and then maintained at 22 to 24°C in a greenhouse. After 4 days, leaf lesions developed on both wounded and unwounded leaves of green and red shiso. The resulting symptoms were similar to those observed in commercial production and B. cinerea was recovered from symptomatic tissue. Non-inoculated, wounded, and unwounded red and green shiso plants were sprayed with distilled water and did not develop symptoms. This experiment was conducted two times and results were the same. To our knowledge, this is the first report of gray mold of shiso in the United States caused by B. cinerea. The disease caused significant damage to the shiso crop because symptomatic leaves are unacceptable for market. In 2010, the greenhouse facility that contained the diseased shiso had numerous leaks in the roof; winter rains that occurred during this time therefore resulted in higher free moisture and humidity in the growing area, which likely provided optimum environmental conditions for the pathogen to infect and cause disease on shiso. Reference: (1) M. B. Ellis and J. M. Waller. CMI Descriptions of Pathogenic Fungi and Bacteria. No. 431, 1974.

scholarly journals Leaf Spot and Stem Blight Caused by Botrytis cinerea on Poinsettia in Argentina

Plant Disease ◽  
2005 ◽  
Vol 89 (12) ◽  
pp. 1359-1359
Author(s):  
H. E. Palmucci ◽  
P. E. Grijalba
Keyword(s):  
Botrytis Cinerea ◽  
Leaf Spot ◽  
Buenos Aires ◽  
Pathogenic Fungi ◽  
Pathogenicity Test ◽  
Euphorbia Pulcherrima ◽  
Conidial Suspension ◽  
Stem Blight ◽  
Potted Plants ◽  
Leaf Spots

Poinsettia (Euphorbia pulcherrima Will. ex. Klotzsch) is a worldwide potted or landscape ornamental plant that belongs to the Euphorbiaceae family. During 2003 and 2004, several symptoms were observed on poinsettia potted plants in nurseries and crops near Buenos Aires. Symptoms included irregular, brown, water-soaked spots on adult plants and leaf spots that extended causing stem blight in seedlings. Small pieces of diseased tissues were surface disinfected for 2 min in 2% sodium hypochlorite, plated on 2% potato dextrose agar (PDA), and incubated at 22°C for 48 h. Dense, whitish mycelia developed on PDA and then turned gray when asexual structures were formed. The fungus conidia were ellipsoid, hyaline, nonseptate, and were formed on botryose heads. The pathogenicity test was carried out on 10 plants using a conidial suspension (2 × 106 spores per ml) that was sprayed on leaves with and without injuries. All plants were incubated in a moist chamber at 22 ± 2°C for 48 h and then maintained in a greenhouse. After 3 days, symptoms similar to the original were observed on the inoculated plants. Control plants sprayed with distilled water remained symptomless. Koch's postulates were confirmed by reisolating the same fungus from diseased plants. In accordance with conidial and cultural characteristics, the pathogen was identified as Botrytis cinerea Pers: Fr. (1). To our knowledge, this is the first report of B. cinerea causing leaf spot and stem rot on poinsettia in Buenos Aires, Argentina. Reference: (1) M. V. Ellis and J. M. Waller. No. 431 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1974.

scholarly journals Hydrangea macrophylla Flower Spot Caused by Botrytis cinerea in Buenos Aires

Plant Disease ◽  
2004 ◽  
Vol 88 (10) ◽  
pp. 1160-1160 ◽  
Author(s):  
M. C. Rivera ◽  
D. E. Morisigue ◽  
S. E. Lopez
Keyword(s):  
Botrytis Cinerea ◽  
Buenos Aires ◽  
Unknown Origin ◽  
Pathogenic Fungi ◽  
Gray Mold ◽  
Potato Dextrose Agar ◽  
Distilled Water ◽  
Sterile Water ◽  
Hydrangea Macrophylla ◽  
Polyethylene Bags

During the spring of 2003, flower spots were observed on French hydrangea (Hydrangea macrophylla (Thunb.) DC) in CETEFFHO-INTA-JICA experimental greenhouses in Castelar, Argentina. Brown, irregular spots randomly distributed on petals were detected on an old, whiteflowering variety of unknown origin, cultivated by growers. Small pieces of diseased tissue were surface disinfested with 2% NaOCl, plated on 2% potato dextrose agar (PDA) with pH 7, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 48 h and turned gray after 72 h. Conidia were ellipsoid, hyaline, nonseptate, and formed in botryose heads. Spores from 10-day-old colonies that were developed on PDA in test tubes were removed with 4 ml of sterile water per tube. Prior to inoculation, inflorescences were detached and placed in water-filled glass vases. To test pathogenicity, eight healthy inflorescences were sprayed with a 5-ml suspension (2 × 104 conidia per ml of sterile distilled water). Another eight healthy inflorescences were sprayed with sterile distilled water. The inflorescences were maintained at 21°C and covered with polyethylene bags that were removed after 3 days. Brown, circular-to-irregular spots appeared on petals 5 days after inoculation, became coalescent, and covered 50 to 60% of each inflorescence in 8 days. Gray mold consisting of black conidiophores and gray-in-mass conidia was observed 3 days after the development of the symptoms. Controls remained symptomless. The same pathogen was recovered from inoculated flowers and was identified as Botrytis cinerea Pers.:Fr. (1). To our knowledge, this is the first report of this fungus on Hydrangea macrophylla in Argentina. Reference: (1) M. V. Ellis and J. M. Waller. Sclerotinia fuckeliana (condial state: Botrytis cinerea).No. 431 in: Descriptions of Pathogenic Fungi and Bacteria, CMI, Kew, Surrey, UK, 1974.

scholarly journals First Report of Thiophanate-Methyl Resistance in Botrytis cinerea on Strawberry from South Carolina

Plant Disease ◽  
2012 ◽  
Vol 96 (11) ◽  
pp. 1700-1700 ◽  
Author(s):  
D. Fernández-Ortuño ◽  
G. Schnabel
Keyword(s):  
South Carolina ◽  
Botrytis Cinerea ◽  
Fungicide Resistance ◽  
Pathogenic Fungi ◽  
Gray Mold ◽  
Resistant Isolate ◽  
Conidial Suspension ◽  
Strawberry Fruit ◽  
Single Spore ◽  
Thiophanate Methyl

Botrytis cinerea Pers.:Fr. is the causal agent of gray mold disease and one of the most important plant-pathogenic fungi affecting strawberry (Fragaria× ananassa). Control of gray mold mainly depends on fungicides, including the methyl benzimidazole carbamate (MBC) thiophanate-methyl. In 2011, strawberries with gray mold symptoms were collected from commercial fields near Chesnee, Florence, Lexington, McBee, Monetta, and North Augusta, all in South Carolina. MBC fungicides were used in most of these fields for gray mold control during the last 3 years. A total of 124 single spore B. cinerea isolates were obtained, each from a different fruit. Resistance to thiophanate-methyl (Topsin M 70WP, Cerexagri-Nisso LLC, King of Prussia, PA) was determined using a conidial germination assay as described previously (1). The majority of isolates (81.4%) were resistant; the rest were sensitive. Resistant isolates were found in all locations with some populations (Chesnee, McBee, and Lexington) revealing no sensitive isolates. Genomic DNA from 35 resistant isolates (representing all locations) and 10 sensitive isolates (from Chesnee, Monetta, and North Augusta, SC) was extracted, and the molecular basis of MBC fungicide resistance was determined as described previously (2). All MBC-resistant isolates possessed the E198A mutation known to confer high levels of MBC fungicide resistance in many fungi, including B. cinerea (2,3). Disease was assessed using a detached strawberry fruit assay. Commercially grown strawberry fruit (24 in total for each isolate and fungicide treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water or 2.4 g/liter of Topsin M to runoff using a hand mister. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of a conidial suspension (106 spores/ml) of either a sensitive or resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolate developed gray mold disease in untreated but not Topsin M-treated fruit. The resistant isolate developed gray mold disease of equal severity in both, the control and fungicide-treated fruit. This experiment was repeated once. The results of the study show that resistance to MBC fungicides is common and widespread in B. cinerea from strawberry in South Carolina. Prior to this study, resistance to MBCs has only been reported in B. cinerea from ornamental crops grown in greenhouses in South Carolina (4). References: (1) J. E. Luck and M. R. Gillings. Mycol. Res. 99:1483, 1995. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011. (3) O. Yarden and T. Katan. Phytopathology 83:1478, 1993. (4) L. F. Yourman and S. Jeffers. Plant Dis. 83:569, 1999.

scholarly journals First Report of White Rust of Arugula Caused by Albugo candida in Argentina

Plant Disease ◽  
2005 ◽  
Vol 89 (2) ◽  
pp. 207-207 ◽  
Author(s):  
R. Zapata ◽  
A. M. Romero ◽  
P. H. Maseda
Keyword(s):  
Buenos Aires ◽  
Pathogenic Fungi ◽  
Buenos Aires Province ◽  
Eruca Sativa ◽  
Abaxial Epidermis ◽  
Albugo Candida ◽  
White Rust ◽  
Plastic Bags ◽  
Pathogenicity Tests ◽  
Zoospore Formation

Production of arugula (Eruca sativa) has increased greatly in Argentina. Since 2002, particularly during the fall, a foliar disease has affected commercial crops in Capilla del Señor (northeast of Buenos Aires Province, Argentina). The disease appeared in foci, spreading throughout the whole production field or greenhouse. Severely affected crops were plowed under. Diseased leaves were chlorotic and had white sori that emerged through the abaxial epidermis. Sori corresponded to the white rust agent, Albugo candida (Pers.) Kunze (1). Sporangiophores were hyaline and clavate, and sporangia were globose and hyaline with a mean diameter of 16.2 μm (14.2 to 19.2 μm). Pathogenicity tests were performed by spraying a suspension of 106 zoospores/ml or 5 × 104 sporangia/ml on four healthy 30-day-old arugula plants. Inoculum was prepared by scrapping sporangia from infected leaves. Sporangia were used directly or incubated in sterile distilled water (SDW) for 14 h at 5°C to induce zoospore formation (2). Four additional healthy plants were sprayed with SDW to serve as controls. Plants were kept in plastic bags for 48 h and maintained in the greenhouse thereafter. White rust symptoms, similar to those observed on the original plants from the field, were observed on inoculated plants 10 days after inoculation. To our knowledge, this is the fist report of A. candida on arugula in Argentina. References: (1) K. Mukerji. No. 458 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1975. (2) H. Scheck and S. Koike. Plant Dis. 83:877, 1999.

scholarly journals First Report of Gummosis Disease of Plum (Prunus salicina) Caused by a Botryosphaeria sp. in Taiwan

Plant Disease ◽  
2008 ◽  
Vol 92 (3) ◽  
pp. 483-483 ◽  
Author(s):  
Y. Ko ◽  
K. S. Yao ◽  
C. Y. Chen ◽  
C. W. Liu ◽  
S. Maruthasalam ◽  
...  
Keyword(s):  
Pathogenic Fungi ◽  
Fluorescent Light ◽  
Conidial Suspension ◽  
Tropical Regions ◽  
First Report ◽  
Cornell University ◽  
Ring Rot ◽  
Prunus Salicina ◽  
Plastic Bags ◽  
Pathogenicity Tests

Plum (Prunus salicina Lindell) is grown on more than 3,870 ha in Taiwan. In 2004, a gummosis disease was observed on plum in the Ming Jian Region of Nantou County (120.675°E, 23.919°N), with 15% of the trees affected. Infections started on the current year's growth, primarily through lenticels, and formed small, sunken, discolored lesions. At later stages, white gum exuded from the lesions. Circular to oval, brown, necrotic areas were seen on the inner bark. Severely infected twigs showed defoliation and dieback. During the winter months, numerous black pycnidia or perithecia formed on infected twigs. Single conidial isolates of the pathogen were obtained from diseased twigs on acidified potato dextrose agar (PDA) and incubated at 25 ± 1°C for 3 days. On the basis of morphological traits, the fungus was identified as a Botryosphaeria sp. according to the CMI descriptions of Botryosphaeria ribis (3). Conidia (14.2 to 26.8 × 4.3 to 7.2 μm) were single celled, hyaline, and spindle shaped. Asci (105 to 135 × 12.5 to 15.5 μm) were hyaline, clavate, and bitunicate. Ascospores (18 to 22 × 7.0 to 8.2 μm) were hyaline and spindle shaped or fusoid. For pathogenicity tests, inoculum was prepared by culturing the fungus on PDA under continuous fluorescent light (128 ± 25 μE·m–2·s–1) at 25°C for 3 days. Two twigs on each of six trees were inoculated. Sharp incisions (3 × 3 × 3 mm) were made on healthy twigs (12 to 15 months old) with a sterilized scalpel and inoculated with either a 5-mm mycelial disc or 0.5 ml of a conidial suspension (105 conidia/ml) of the fungus. Inoculated areas were covered with moist, sterile cotton and the entire twigs were enclosed in plastic bags. Twigs inoculated with 5-mm PDA discs or sterile water alone served as controls. The symptoms described above were observed on all inoculated twigs 14 days after inoculation, whereas control twigs did not develop any disease symptoms. Reisolation from the inoculated twigs consistently yielded the Botryosphaeria sp., thus fulfilling Koch's postulates. Botryosphaeria spp. have been reported to cause stem blight of many plants in temperate and tropical regions of the world (4). In Taiwan, B. dothidea has been reported as the causal agent of gummosis disease of peach (1) and fruit ring rot of pear (2); however, to our knowledge, this is the first report of a Botryosphaeria sp. causing gummosis of plum. References: (1). Y. Ko et al. Plant Pathol. Bull. 1:70, 1992. (2) Y. Ko et al. Plant Prot. Bull. (Taiwan) 35:211, 1993. (3) E. Punithalingam and P. Holliday. No. 395 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1973. (4) W. A. Sinclair et al. Diseases of Trees and Shrubs. Cornell University Press, Ithaca, NY, 1987.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jun Guo ◽  
Jin Chen ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Gray Mold ◽  
Hunan Province ◽  
Conidial Suspension ◽  
Heat Shock Protein 60 ◽  
Basal Cells ◽  
Single Spore ◽  
Internal Transcribed Spacer Region ◽  
First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

scholarly journals The BMP1 Gene Is Essential for Pathogenicity in the Gray Mold Fungus Botrytis cinerea

2000 ◽  
Vol 13 (7) ◽  
pp. 724-732 ◽  
Author(s):  
Li Zheng ◽  
Mathew Campbell ◽  
Jennifer Murphy ◽  
Stephen Lam ◽  
Jin-Rong Xu
Keyword(s):  
Growth Rate ◽  
Map Kinase ◽  
Botrytis Cinerea ◽  
Magnaporthe Grisea ◽  
Pathogenic Fungi ◽  
Gray Mold ◽  
Necrotrophic Pathogen ◽  
Kinase Gene ◽  
Plant Infection ◽  
Mold Fungus

In Magnaporthe grisea, a well-conserved mitogen-activated protein (MAP) kinase gene, PMK1, is essential for fungal pathogenesis. In this study, we tested whether the same MAP kinase is essential for plant infection in the gray mold fungus Botrytis cinerea, a necrotrophic pathogen that employs infection mechanisms different from those of M. grisea. We used a polymerase chain reaction-based approach to isolate MAP kinase homologues from B. cinerea. The Botrytis MAP kinase required for pathogenesis (BMP) MAP kinase gene is highly homologous to the M. grisea PMK1. BMP1 is a single-copy gene. bmp1 gene replacement mutants produced normal conidia and mycelia but were reduced in growth rate on nutrient-rich medium. bmp1 mutants were nonpathogenic on carnation flowers and tomato leaves. Re-introduction of the wild-type BMP1 allele into the bmp1 mutant restored both normal growth rate and pathogenicity. Further studies indicated that conidia from bmp1 mutants germinated on plant surfaces but failed to penetrate and macerate plant tissues. bmp1 mutants also appeared to be defective in infecting through wounds. These results indicated that BMP1 is essential for plant infection in B. cinerea, and this MAP kinase pathway may be widely conserved in pathogenic fungi for regulating infection processes.

scholarly journals First Report of Stem Blight Caused by Botrytis cinerea on Jasminum officinalis in Italy

Plant Disease ◽  
2008 ◽  
Vol 92 (12) ◽  
pp. 1708-1708
Author(s):  
D. Aiello ◽  
G. Parlavecchio ◽  
A. Vitale ◽  
G. Polizzi
Keyword(s):  
Botrytis Cinerea ◽  
Far East ◽  
Weather Conditions ◽  
Economic Loss ◽  
Transparent Plastic ◽  
Disease Symptoms ◽  
First Report ◽  
Stem Blight ◽  
Plastic Bags ◽  
Stem Lesions

Common jasmine (Jasminum officinalis L.) is an evergreen shrub that is native to the Middle and Far East. It is widely grown in Europe as an ornamental plant and in southeastern France for fragrance for the perfume industry. In March of 2008, a previously undescribed disease was observed on potted (6-month- to 3-year-old) common jasmine plants growing in open fields in a nursery of eastern Sicily, Italy. More than 20% of the plants showed disease symptoms. Diseased plants had small to large, brown or black lesions on stem. The lesions expanded rapidly, girdled the stem and caused blight of entire branches, and occasionally killed the plant. Abundant conidia and mycelia were detected on the surface of dead and dying stems under cool and humid conditions, which resulted in a moldy gray appearance. Botrytis cinerea Pers.:Fr. (1) was consistently isolated from affected tissues disinfected for 1 min in 1% NaOCl, rinsed in sterile water, and plated on potato dextrose agar (PDA). Colonies were at first white then became gray after 6 to 7 days when spores differentiated. White sclerotia developed after 8 to 9 days and turned black with age. Size of the conidia produced on 1-month-old culture ranged from 5.0 to 9.5 × 6.5 to 12.5 μm on the basis of 50 spore measurements. Sclerotia were spherical or irregular and ranged from 1.0 to 2.5 × 0.9 to 2.9 mm (average 1.7 × 1.8 mm). Stems of eight 6-month-old common jasmine plants were lightly wounded with a sterile razor and inoculated with 3-mm-diameter plugs of PDA from 10-day-old mycelial cultures, eight similar plants were inoculated with mycelium without wounding, and an equal number of noninoculated plants inoculated with only PDA plugs served as control. After inoculation, plants were enclosed in transparent plastic bags at 20 ± 2°C for 5 days. Stem lesions identical to the ones observed in the nursery were detected on all wounded and on two nonwounded fungus-inoculated plants within 5 to 7 days. Control plants remained healthy. B. cinerea was reisolated from typical lesions. The unusually cool and humid weather conditions recorded in Sicily are supposed to be highly conducive of disease outbreak. Although B. cinerea does not usually kill the plants, under these environmental conditions this disease can cause significant economic loss to ornamental nurseries. To our knowledge, this is the first report of B. cinerea causing stem blight on J. officinalis. Reference: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CAB, Kew, Surrey, England, 1971.

Sign in / Sign up

Export Citation Format

Share Document