Hydrangea macrophylla Flower Spot Caused by Botrytis cinerea in Buenos Aires

During the spring of 2003, flower spots were observed on French hydrangea (Hydrangea macrophylla (Thunb.) DC) in CETEFFHO-INTA-JICA experimental greenhouses in Castelar, Argentina. Brown, irregular spots randomly distributed on petals were detected on an old, whiteflowering variety of unknown origin, cultivated by growers. Small pieces of diseased tissue were surface disinfested with 2% NaOCl, plated on 2% potato dextrose agar (PDA) with pH 7, and incubated at 22 to 24°C. Dense, whitish mycelium developed within 48 h and turned gray after 72 h. Conidia were ellipsoid, hyaline, nonseptate, and formed in botryose heads. Spores from 10-day-old colonies that were developed on PDA in test tubes were removed with 4 ml of sterile water per tube. Prior to inoculation, inflorescences were detached and placed in water-filled glass vases. To test pathogenicity, eight healthy inflorescences were sprayed with a 5-ml suspension (2 × 104 conidia per ml of sterile distilled water). Another eight healthy inflorescences were sprayed with sterile distilled water. The inflorescences were maintained at 21°C and covered with polyethylene bags that were removed after 3 days. Brown, circular-to-irregular spots appeared on petals 5 days after inoculation, became coalescent, and covered 50 to 60% of each inflorescence in 8 days. Gray mold consisting of black conidiophores and gray-in-mass conidia was observed 3 days after the development of the symptoms. Controls remained symptomless. The same pathogen was recovered from inoculated flowers and was identified as Botrytis cinerea Pers.:Fr. (1). To our knowledge, this is the first report of this fungus on Hydrangea macrophylla in Argentina. Reference: (1) M. V. Ellis and J. M. Waller. Sclerotinia fuckeliana (condial state: Botrytis cinerea).No. 431 in: Descriptions of Pathogenic Fungi and Bacteria, CMI, Kew, Surrey, UK, 1974.

Download Full-text

First Report of Botrytis Gray Mold on Common Calla Lily in Buenos Aires, Argentina

Plant Disease ◽

10.1094/pd-90-0970b ◽

2006 ◽

Vol 90 (7) ◽

pp. 970-970 ◽

Cited By ~ 2

Author(s):

M. C. Rivera ◽

S. E. Lopez

Keyword(s):

South African ◽

Buenos Aires ◽

Pathogenic Fungi ◽

Gray Mold ◽

Distilled Water ◽

First Report ◽

Zantedeschia Aethiopica ◽

Calla Lily ◽

Japanese Quince ◽

Dark Green

Common calla lily (Zantedeschia aethiopica (L.) Spreng., family Araceae) is an evergreen herbaceous South African ornamental plant that forms a tuft of fleshy-stalked, glossy, dark green leaves. At bloom during the summertime, large, funnel-shaped, waxy-white spaths that surround a bright yellow spadix form at the end of high stalks. In August 2003, large, irregular brown spots with a 3- to 4-mm yellow halo were observed on leaves of 10 plants growing near Japanese quince shrubs (Chaenomeles lagenaria (Loisel.) Koidz.) in Escobar, Buenos Aires. Debris of Japanese quince petals were attached to the center of the lesions with profuse sporulation of Botrytis cinerea Pers. (1). Pathogen spores were disposed on potato dextrose agar (PDA) and incubated at 22°C. Mycelium was initially whitish and turned gray with age. Black conidiophores bore botryose heads of hyaline, ellipsoid, unicellular conidia, gray in mass, 7.5 to 10.5 μm × 6.8 to 7.5 (average 9.2 to 7 μm). Black, irregular sclerotia formed at random in culture. Inoculum was prepared from 7-day-old cultures on PDA. Six flowering common calla lilies planted in 5-liter plastic pots were inoculated by spraying a suspension of 2.5 × 106 conidia per ml of sterile distilled water. Six healthy plants were sprayed with sterile distilled water. Each plant was covered with a transparent polyethylene bag for 3 days and kept at 21°C under a 12-h photoperiod. After a 12-day incubation period, leaves showed elliptic to irregular brown spots surrounded by yellow halos. Tiny round to irregular brown spots developed on flower spaths that finally blighted. Water-treated plants remained symptomless. Koch's postulates were fulfilled by pathogen reisolation from diseased organs. To our knowledge, this is the first report of B. cinerea on Z. aethiopica in Argentina. Infection efficiency of B. cinerea increases when inoculated petals are positioned on leaves (2), which has epidemiological importance in landscapes with association of plant species that are potential hosts of this pathogen. Reference: (1) M. V. Ellis and J. M. Waller. No. 431 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1974. (2) C. Sirjusingh et al. Plant Dis. 80:154, 1996.

Download Full-text

First Report of Blueberry Botrytis Blight in Buenos Aires, Entre Ríos, and Córdoba, Argentina

Plant Disease ◽

10.1094/pdis-91-5-0639c ◽

2007 ◽

Vol 91 (5) ◽

pp. 639-639 ◽

Cited By ~ 8

Author(s):

P. Vasquez ◽

J. A. Baldomá ◽

E. R. Wright ◽

A. Pérez ◽

M. Divo de Sesar ◽

...

Keyword(s):

Botrytis Cinerea ◽

Buenos Aires ◽

Morphological Characteristics ◽

Leaf Tissue ◽

Pathogenic Fungi ◽

Vaccinium Corymbosum ◽

Distilled Water ◽

First Report ◽

Conidial State ◽

Entre Rios

Since 2003, a new field disease has been observed on several cultivars of highbush blueberry (Vaccinium corymbosum L.) in Buenos Aires (Baradero, Colonia Urquiza, Lima, Mercedes, and San Pedro), Entre Ríos (Concordia, Gualeguaychú, and Larroque), and Córdoba (Capilla del Monte and La Cumbre). Infected flowers turned brown to tan with a water-soaked appearance and shriveled up. Blighted flowers typically did not produce fruits; even an entire cluster of berries could be aborted. A chlorotic area, that later became necrotic and turned light brown, developed when leaves were in contact with blighted flowers. A watery rot developed on fruit occasionally before harvest but more generally after harvest. Infected tender green twigs also became blighted, with leaf tissue becoming brown to black. Older twigs and stems were also blighted. Abundant, gray mycelium with conidial masses developed on all affected tissues under moist conditions. Sections of infected leaves, twigs, stems, flowers, and fruits were surfaced sterilized with 0.2% NaOCl, plated on 2% potato dextrose agar (pH 7), and incubated at 22°C. Pure cultures formed a whitish dense mycelial mat and turned gray after 72 h. Conidia were ellipsoid, hyaline, nonseptate, and formed on botryose heads. They ranged from 5.8 to 9 × 8.1 to 13.7 μm (average 8.6 × 10.2 μm). Black, round, and irregular microsclerotia developed on 7-day-old cultures with an average size of 1.1 × 1.7 mm. Morphological characteristics agree with those described for Botrytis cinerea Pers.:Fr (1). Pathogenicity was tested on 10 12-month-old potted blueberry plants cv. O'Neal by spraying a suspension of 1 × 106 conidia per ml of sterile distilled water. Ten plants used as controls were sprayed with sterile distilled water. Each plant was covered with a transparent polyethylene bag for 48 h and incubated at 20 ± 2°C in humid chambers for 15 days. Lesions similar to those observed in the fields developed after 4 days and asexual fructifications developed after 5 days. The same pathogen was reisolated from the lesions, thus completing Koch's postulates. Water-treated plants remained symptomless. To our knowledge, this is the first report of a disease caused by B. cinerea on blueberry in Buenos Aires, Córdoba, and Entre Ríos provinces of Argentina. References: (1) M. V. Ellis and J. M. Waller. Sclerotinia fuckeliana (conidial state: Botrytis cinerea) No. 431 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1974.

Download Full-text

First Report of Septoria Blight of Parsley Caused by Septoria petroselini in the Mediterranean Region of Turkey

Plant Disease ◽

10.1094/pdis.2003.87.1.99a ◽

2003 ◽

Vol 87 (1) ◽

pp. 99-99 ◽

Cited By ~ 3

Author(s):

S. Kurt

Keyword(s):

Mediterranean Region ◽

Morphological Characteristics ◽

Potato Dextrose Agar ◽

Distilled Water ◽

Conidial Suspension ◽

Sterile Water ◽

First Report ◽

Foliar Symptoms ◽

Polyethylene Bags ◽

The Mediterranean

During December 2001 to March 2002, Septoria blight of parsley was observed in approximately 500 ha of commercial parsley crops in Arsuz County, Hatay, in the Mediterranean Region of Turkey. Incidence of disease ranged from 42 to 80%. Symptoms included irregularly shaped, grayish brown spots (average 3 to 8 mm diameter) with a slightly darker brown margin of necrotic tissue that developed into tan-to-brown lesions surrounded by chlorotic halo on the leaves. Oval-shaped lesions were observed occasionally on petioles. Lesions contained erumpent, dark brown, flask-shaped pycnidia with the ostiole on the upper surface of the foliage. Thirty samples, consisting of diseased leaves and petioles of parsley, were collected from each field. Infected tissues were surface-sterilized in 1% NaOCl for 2 min, rinsed in sterile distilled water, placed on petri dishes containing potato dextrose agar (PDA), and incubated for 10 to 14 days at 25°C. The fungus formed long, multiseptate (0 to 4), hyaline, filiform conidia (14 to 29 μm × 0.5 to 1.9 μm), and short conidiophores within the pycnidia. Based on the morphological characteristics of the fungus, the pathogen was identified as Septoria petroselini Desm. (1). Monoconidial cultures of 18 isolates were prepared. Pathogenicity was confirmed by brush-inoculating slightly wounded foliage of 5- to 7- week-old parsley plants (cv. Kereviz yapragi) with a conidial suspension (106 conidia per ml of sterile water) of each isolate of S. petroselini. Control plants that were brush-inoculated with distilled water and inoculated plants were placed in clear polyethylene bags that were closed and incubated at 20°C for 48 h. The bags were removed, and plants were maintained in a dew chamber for 21 days at 65 to 70% relative humidity. Foliar symptoms developed 15 days after inoculation and appeared similar to lesions observed in the field. Yellowing and necrosis of leaves was also observed on >60% of inoculated plants. No lesions developed on the control plants. The pathogen was readily reisolated on PDA from inoculated plants. To our knowledge, this is the first report of Septoria blight of parsley in the Mediterranean Region of Turkey. Reference: (1) R. F. Cerkauskas and J. Uyenaka. Plant Dis. 74:1037, 1990.

Download Full-text

Dasylirion serratifolium as a New Host of Botrytis cinerea, the Causal Agent of Leaf Spots and Blight in Italy

Plant Disease ◽

10.1094/pd-90-0114b ◽

2006 ◽

Vol 90 (1) ◽

pp. 114-114 ◽

Cited By ~ 1

Author(s):

G. Polizzi ◽

A. Vitale

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

Potato Dextrose Agar ◽

Limiting Factor ◽

Sterile Water ◽

New Host ◽

Leaf Spots ◽

Brown Stripe ◽

Young Leaves ◽

International Mycological Institute

Sandpaper sotol (Dasylirion serratifolium Zucc.), native to Mexico, has green leaves with margins highlighted by whitish yellow prickles like a fine sandpaper. During the spring of 2004 and 2005, necrotic lesions were observed in the middle of leaf blades and near prickles on 2- to 5-year-old, container-grown sandpaper sotol plants from two nurseries in eastern Sicily (Italy). Symptoms were detected on 20 to 30% of plants and consisted of reddish lesions that developed a reddish brown stripe surrounded by a yellow halo. As lesions enlarged, the center turned yellow and expanded rapidly causing blight of young leaves. Occasionally, symptomatic tissues had masses of gray fungal conidia and/or sclerotia. Botrytis cinerea was isolated consistently from infected tissues disinfected for 1 min in 1% NaOCl and rinsed in sterile distilled water and grown on potato dextrose agar (PDA). Hyaline, ovoid conidia (average 6.4 × 9.7 μm) and conidiophores were similar to those described of B. cinerea, and 5- to 8-day-old cultures developed black sclerotia that were round or irregular in shape (average 1.55 × 1.02 mm) that is typical of gray mold (1). Koch's postulates were performed by spraying 6-week-old sandpaper sotol plants grown in 12-cm pots with a spore suspension (1 × 106 CFU per ml) obtained from 12-day-old cultures grown on PDA. Eight plants were naturally wounded by scratching leaf blades among themselves and were subsequently inoculated, while eight plants were inoculated without wounding. An equal number of noninoculated plants sprayed with sterile water served as controls. All plants were maintained in high humidity conditions (90 to 95% relative humidity) at 20 ± 2°C. Leaf spots similar to the ones observed in nurseries were evident on all naturally wounded and nonwounded plants within 2 to 3 weeks after inoculation. Noninoculated control plants were symptomless. B. cinerea was reisolated from affected tissues. The pathogen has reduced commercial value of sandpaper sotol plants and may represent a limiting factor for the cultivation of this plant in eastern Sicily. To our knowledge, this is the first report in the world of leaf spot and blight caused by B. cinerea on D. serratifolium. Reference: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CAB International Mycological Institute, Kew, Surrey, England, 1971.

Download Full-text

First Report of Botrytis cinerea on Pansy Flowers in Buenos Aires

Plant Disease ◽

10.1094/pdis.2004.88.10.1164b ◽

2004 ◽

Vol 88 (10) ◽

pp. 1164-1164

Author(s):

M. C. Rivera ◽

S. E. Lopez

Keyword(s):

Botrytis Cinerea ◽

Buenos Aires ◽

Rapid Development ◽

Pathogenic Fungi ◽

Gray Mold ◽

Conidial Suspension ◽

New Host ◽

Disease Symptoms ◽

Plastic Bags ◽

Pathogenicity Tests

Pansy (Viola × wittrockiana) is an ornamental annual plant produced as a potted plant in greenhouses around Buenos Aires, Argentina. Flower rot with signs of gray mold was observed on pansy cv. Crown during the autumn of 2003. Diseased tissues were surface sterilized by immersion in 2% NaOCl for 1 min, placed on 2% potato dextrose agar (PDA), and incubated at 22°C. Fungal mycelia were initially white and became gray after 72 h. After 4 days, colonies were 4 cm in diameter and sporulated profusely. Black sclerotia developed after 7 days. Mycelia were septate with dark branched conidiophores bearing unicellular, ellipsoid, hyaline conidia that measured 8 to 12 × 6 to 8 μm in botryose heads. These characteristics agree with Botrytis cinerea Pers.:Fr. (1). Pathogenicity tests were performed by spraying 10 healthy pansy plants during bloom with 3 ml of a conidial suspension (106 conidia per ml) per plant. Controls were treated with sterilized distilled water only. Plants were covered with plastic bags for 2 days and incubated at 18 to 22°C. The flowers developed water-soaked lesions between 4 and 6 days after inoculation. Fifty percent of the flowers were pendulous because flower blight reached the peduncle. The pathogen was reisolated from diseased flowers after superficial sterilization with 2% NaOCl and isolated on PDA. Gray mold has a rapid development during bloom, and the pathogen was able to enter undamaged flower tissues. No disease symptoms were observed on leaves. This report adds pansy as a new host of B. cinerea to a previous list of ornamentals grown in Argentina where gray mold was observed. Reference: (1) M. V. Ellis and J. M. Waller. Sclerotinia fuckeliana (condial state: Botrytis cinerea). No. 431 in: Descriptions of Pathogenic Fungi and Bacteria, CMI, Kew, Surrey, UK, 1974.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

The BMP1 Gene Is Essential for Pathogenicity in the Gray Mold Fungus Botrytis cinerea

Molecular Plant-Microbe Interactions ◽

10.1094/mpmi.2000.13.7.724 ◽

2000 ◽

Vol 13 (7) ◽

pp. 724-732 ◽

Cited By ~ 157

Author(s):

Li Zheng ◽

Mathew Campbell ◽

Jennifer Murphy ◽

Stephen Lam ◽

Jin-Rong Xu

Keyword(s):

Growth Rate ◽

Map Kinase ◽

Botrytis Cinerea ◽

Magnaporthe Grisea ◽

Pathogenic Fungi ◽

Gray Mold ◽

Necrotrophic Pathogen ◽

Kinase Gene ◽

Plant Infection ◽

Mold Fungus

In Magnaporthe grisea, a well-conserved mitogen-activated protein (MAP) kinase gene, PMK1, is essential for fungal pathogenesis. In this study, we tested whether the same MAP kinase is essential for plant infection in the gray mold fungus Botrytis cinerea, a necrotrophic pathogen that employs infection mechanisms different from those of M. grisea. We used a polymerase chain reaction-based approach to isolate MAP kinase homologues from B. cinerea. The Botrytis MAP kinase required for pathogenesis (BMP) MAP kinase gene is highly homologous to the M. grisea PMK1. BMP1 is a single-copy gene. bmp1 gene replacement mutants produced normal conidia and mycelia but were reduced in growth rate on nutrient-rich medium. bmp1 mutants were nonpathogenic on carnation flowers and tomato leaves. Re-introduction of the wild-type BMP1 allele into the bmp1 mutant restored both normal growth rate and pathogenicity. Further studies indicated that conidia from bmp1 mutants germinated on plant surfaces but failed to penetrate and macerate plant tissues. bmp1 mutants also appeared to be defective in infecting through wounds. These results indicated that BMP1 is essential for plant infection in B. cinerea, and this MAP kinase pathway may be widely conserved in pathogenic fungi for regulating infection processes.

Download Full-text

First Report of Mucor Rot in Commercially Sold Cherries Caused by Mucor piriformis

Plant Disease ◽

10.1094/pdis.1997.81.5.550b ◽

1997 ◽

Vol 81 (5) ◽

pp. 550-550 ◽

Cited By ~ 2

Author(s):

P. L. Sholberg ◽

T. J. Michailides

Keyword(s):

Surface Layer ◽

Potato Dextrose Agar ◽

Distilled Water ◽

Sterile Water ◽

Visual Examination ◽

High Quality ◽

Water Suspension ◽

Pathogenicity Tests ◽

Mucor Piriformis ◽

Salt And Pepper

In August 1996, a commercial retailer of high quality cherries from the Okanagan Valley of British Columbia, Canada, reported severe losses in at least 150 boxes (11.3 kg per box) of packed cherries cv. Stella. Upon examination of a representative box of these cherries, it was found that approximately 80% of the fruit was affected by what appeared to be Mucor spp. The decayed cherries were concentrated below the surface layer and small pockets of cherries had prominent salt-and-pepper-colored whiskers emanating from individual cherries. Counting the exact number of rotten cherries was difficult because they disintegrated on handling. Several infected cherries were surface sterilized by immersing in a 0.5% NaClO solution for 1 min and rinsing with sterile, distilled water. Pieces of the surface-sterilized cherries were plated onto dishes containing potato dextrose agar and incubated at 6°C for 10 days. Ten typical isolates derived from single spores from these dishes were all identified as Mucor piriformis A. Fischer (1). Samples of 200 g of cherries cv. Sweetheart (20 ± 1 cherries) were sprayed with a water suspension containing 1 × 106 sporangiospores per ml with one of the isolates identified as M. piriformis and incubated at 1, 6, 10, 15, and 20°C for up to 25 days. This same procedure was repeated for two other isolates of M. piriformis isolated from infected cherries. As a control, cherries were misted with sterile water and incubated at 20°C for 6 days. At 6°C, a temperature at which cherries are often stored, the three isolates decayed, respectively, 100, 60, and 60% of the cherries in 18 days. In general, all three isolates caused greater than 50% decay at 20, 15, 10, and 1°C in 6, 6, 11, and 25 days, respectively. Decay did not occur in cherries misted only with sterile water. Careful visual examination of decayed cherries revealed similar whiskerlike growth of Mucor as seen in the commercial cherries. Microscopic examination of sporangiophores infecting the fruit found them to be the same as the original M. piriformis isolate, successfully completing Koch's postulates. Previous to this report, M. piriformis, M. hiemalis, and M. plumbeus were isolated from Lambert cherries stored for 4 weeks at 4.5°C in Oregon (2); however, it is unclear if all or any of these isolates were pathogenic because pathogenicity tests were not conducted. References: (1) T. J. Michailides and R. A. Spotts. Plant Dis. 74:537, 1990. (2) P. G. Sanderson and R. A. Spotts. Fungic. Nematic. Tests 47:43, 1992.

Download Full-text

Gray Mold of Green Shiso (Perilla frutescens), Caused by Botrytis cinerea, in California

Plant Disease ◽

10.1094/pdis-02-12-0116-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 908-908 ◽

Cited By ~ 1

Author(s):

S. T. Koike ◽

O. Daugovish

Keyword(s):

Botrytis Cinerea ◽

Pathogenic Fungi ◽

The United States ◽

Gray Mold ◽

Early Spring ◽

Perilla Frutescens ◽

Foliar Blight ◽

Plastic Bags ◽

Initial Symptoms ◽

Blight Disease

Shiso (Perilla frutescens) is a leafy herb in the Lamiaceae family and is widely used in Japanese and other Asian cuisine for cooking, pickling, oil (from the seeds), and garnish. A number of shiso types are used, though the most common are green shiso (ao-shiso) and red shiso (aka-shiso). In the winter months of 2010 and early spring 2011, a foliar blight disease developed on greenhouse-grown green shiso produced in Ventura County, CA. Initial symptoms were angular, dull green leaf lesions on older foliage. Such lesions often were initiated along leaf edges. As the disease progressed, lesions turned gray green, expanded, and could affect most of the leaf surface. Lesion tissue became dry and papery in texture; signs of a pathogen were not present. Tests for bacterial agents were negative. However, a fungus was consistently isolated from symptomatic leaves. Isolates of this fungus were grown on potato dextrose agar (PDA) in petri plates incubated under fluorescent lights and were identified as Botrytis cinerea (1). On PDA, mycelial growth was gray brown and conidiophores measured 2 mm or longer and were branched at the terminals. Conidia were aseptate, hyaline, ellipsoidal, and measured (6.5–) 8.4 to 9.2 (–12.0) × (6.1–) 6.8 to 8.0 (–9.5) μm. Sclerotia were not present. Pathogenicity of four isolates was tested by spraying conidial suspensions (1 × 105 conidia/ml) until runoff onto sets of potted green and red shiso plants. Each set consisted of six wounded (leaf tips cut) and six unwounded plants. Plants were enclosed in plastic bags for 48 h and then maintained at 22 to 24°C in a greenhouse. After 4 days, leaf lesions developed on both wounded and unwounded leaves of green and red shiso. The resulting symptoms were similar to those observed in commercial production and B. cinerea was recovered from symptomatic tissue. Non-inoculated, wounded, and unwounded red and green shiso plants were sprayed with distilled water and did not develop symptoms. This experiment was conducted two times and results were the same. To our knowledge, this is the first report of gray mold of shiso in the United States caused by B. cinerea. The disease caused significant damage to the shiso crop because symptomatic leaves are unacceptable for market. In 2010, the greenhouse facility that contained the diseased shiso had numerous leaks in the roof; winter rains that occurred during this time therefore resulted in higher free moisture and humidity in the growing area, which likely provided optimum environmental conditions for the pathogen to infect and cause disease on shiso. Reference: (1) M. B. Ellis and J. M. Waller. CMI Descriptions of Pathogenic Fungi and Bacteria. No. 431, 1974.

Download Full-text

Leaf Spot and Stem Blight Caused by Botrytis cinerea on Poinsettia in Argentina

Plant Disease ◽

10.1094/pd-89-1359c ◽

2005 ◽

Vol 89 (12) ◽

pp. 1359-1359

Author(s):

H. E. Palmucci ◽

P. E. Grijalba

Keyword(s):

Botrytis Cinerea ◽

Leaf Spot ◽

Buenos Aires ◽

Pathogenic Fungi ◽

Pathogenicity Test ◽

Euphorbia Pulcherrima ◽

Conidial Suspension ◽

Stem Blight ◽

Potted Plants ◽

Leaf Spots

Poinsettia (Euphorbia pulcherrima Will. ex. Klotzsch) is a worldwide potted or landscape ornamental plant that belongs to the Euphorbiaceae family. During 2003 and 2004, several symptoms were observed on poinsettia potted plants in nurseries and crops near Buenos Aires. Symptoms included irregular, brown, water-soaked spots on adult plants and leaf spots that extended causing stem blight in seedlings. Small pieces of diseased tissues were surface disinfected for 2 min in 2% sodium hypochlorite, plated on 2% potato dextrose agar (PDA), and incubated at 22°C for 48 h. Dense, whitish mycelia developed on PDA and then turned gray when asexual structures were formed. The fungus conidia were ellipsoid, hyaline, nonseptate, and were formed on botryose heads. The pathogenicity test was carried out on 10 plants using a conidial suspension (2 × 106 spores per ml) that was sprayed on leaves with and without injuries. All plants were incubated in a moist chamber at 22 ± 2°C for 48 h and then maintained in a greenhouse. After 3 days, symptoms similar to the original were observed on the inoculated plants. Control plants sprayed with distilled water remained symptomless. Koch's postulates were confirmed by reisolating the same fungus from diseased plants. In accordance with conidial and cultural characteristics, the pathogen was identified as Botrytis cinerea Pers: Fr. (1). To our knowledge, this is the first report of B. cinerea causing leaf spot and stem rot on poinsettia in Buenos Aires, Argentina. Reference: (1) M. V. Ellis and J. M. Waller. No. 431 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1974.

Download Full-text