scholarly journals Complete Genome Sequences of Tomato Leaf Curl Guam Virus, a Novel Tomato-Infecting Begomovirus from Guam, USA

2021 ◽  
Vol 10 (49) ◽  
Author(s):  
Robert L. Schlub ◽  
Rugang Li ◽  
Jesse P. Bamba ◽  
Mari Marutani ◽  
Kai-Shu Ling
Keyword(s):  
Nucleotide Sequence ◽  
Complete Genome ◽  
Nucleotide Sequence Identity ◽  
Tomato Leaf ◽  
Genome Sequences ◽  
Sequence Identity ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Genome sequences of a novel begomovirus infecting tomato on Guam were obtained using primer-walking and sequencing. The complete genome sequences are 2,750 nucleotides long with a typical monopartite organization and display less than 91% nucleotide sequence identity to other begomoviruses. A provisional name, tomato leaf curl Guam virus (ToLCGuV), is proposed.

scholarly journals Complete Genome Sequences of Two Phage-Like Plasmids Carrying the CTX-M-15 Extended-Spectrum β-Lactamase Gene

2017 ◽  
Vol 5 (19) ◽  
Author(s):  
Anna Colavecchio ◽  
Julie Jeukens ◽  
Luca Freschi ◽  
Jean-Guillaume Edmond Rheault ◽  
Irena Kukavica-Ibrulj ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Nucleotide Sequence ◽  
Complete Genome ◽  
Nucleotide Sequence Identity ◽  
Genome Sequences ◽  
Content Type ◽  
Sequence Identity ◽  
Extended Spectrum ◽  
Lactamase Gene

ABSTRACT Two similar phage-like plasmids carrying CTX-M-15 resistance cassettes were identified from two environmental Escherichia coli isolates. They demonstrate strong nucleotide sequence identity to the phage-like plasmid pECOH89 and Salmonella bacteriophage SSU5.

Complete Nucleotide Sequence of Tomato Leaf Curl Karnataka Virus and β Satellite Molecule Associated with Leaf Curl Disease on Sunflower in India

2013 ◽  
Vol 12 (1) ◽  
pp. 19-25 ◽  
Author(s):  
L.S. Vanitha ◽  
K.S. Shankarapp ◽  
K.T. Rangaswamy ◽  
W.A.R.T. Wickramaar ◽  
M.R. Govindappa
Keyword(s):  
Nucleotide Sequence ◽  
Complete Nucleotide Sequence ◽  
Tomato Leaf ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

scholarly journals Nucleotide sequence and genome organization of tomato leaf curl geminivirus

1993 ◽  
Vol 74 (1) ◽  
pp. 147-151 ◽  
Author(s):  
I. B. Dry ◽  
J. E. Rigden ◽  
L. R. Krake ◽  
P. M. Mullineaux ◽  
M. A. Rezaian
Keyword(s):  
Nucleotide Sequence ◽  
Genome Organization ◽  
Tomato Leaf ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Tomato yellow leaf curl disease in Guangdong is caused by Tomato leaf curl Taiwan virus

2007 ◽  
Vol 4 (2) ◽  
pp. 127-131 ◽  
Author(s):  
He Zi-Fu ◽  
Yu Hao ◽  
Mao Ming-Jie ◽  
Luo Fang-Fang ◽  
Lin Yi-Han ◽  
...  
Keyword(s):  
Intergenic Region ◽  
Virus Isolate ◽  
Tomato Yellow Leaf ◽  
Tomato Leaf ◽  
Yellow Leaf ◽  
Sequence Identity ◽  
Begomovirus Genome ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

AbstractA yellow leaf curl disease with chlorotic and yellowish leaves, upward leaf curling and stunting symptoms was observed on tomato in Shantou city of Guangdong province. A virus isolate BS was obtained from a diseased tomato plant. The complete DNA-A sequence of the virus isolate BS was determined to be 2740 nucleotides long, with all the characteristic features of begomovirus genome organization. BS DNA-A encoded six potential open reading frames (ORFs), with two (AV1 and AV2) in virus sense and four (AC1, AC2, AC3 and AC4) in complementary sense, and contained an intergenic region of 269 nucleotides. The results of BLAST searches showed that BS DNA-A had higher sequence identity with reported begomoviruses in Asia than with those in America and Africa. Further sequence comparisons indicated that BS was most closely related to the isolate of Tomato leaf curl Taiwan virus (ToLCTWV-[Taiwan]) with a sequence identity of 97.7%. Nucleotide sequence identities of AV1, AV2, AC1, AC2, AC3, AC4 and intergenic region (IR) between BS and ToLCTWV-[Taiwan] were 98.6, 98.0, 98.0, 97.5, 96.3, 98.6 and 96.6%, respectively, while that of the six ORF-encoded proteins between BS and ToLCTWV-[Taiwan] were 97.7, 99.1, 97.5, 95.6, 91.8 and 99.0%, respectively. Phylogenetic analysis based on the DNA-A sequences has also indicated that BS is most closely related to ToLCTWV-[Taiwan], forming a branch with ToLCTWV-[Taiwan], Tomato leaf curl Guangdong virus and Tomato yellow leaf curl Guangdong virus. The above results demonstrate that BS is an isolate of ToLCTWV.

scholarly journals Complete Genome Sequence of Tomato Leaf Curl New Delhi Virus from Luffa in Indonesia

2019 ◽  
Vol 8 (15) ◽  
Author(s):  
Fariha Wilisiani ◽  
Yutaro Neriya ◽  
Mai Tagami ◽  
Misaki Kaneko ◽  
Sedyo Hartono ◽  
...  
Keyword(s):  
Genome Sequence ◽  
Complete Genome Sequence ◽  
Complete Genome ◽  
Tomato Leaf ◽  
New Delhi ◽  
First Report ◽  
Tomato Leaf Curl ◽  
Leaf Curl

This is the first report of a begomovirus infecting luffa in Indonesia. The genome of this virus shares a close identity with that of Tomato leaf curl New Delhi virus (ToLCNDV).

scholarly journals Molecular Characterization of a Distinct Begomovirus Associated with Tomato Leaf Curl Disease in Arusha of Tanzania

Plant Disease ◽  
2006 ◽  
Vol 90 (12) ◽  
pp. 1550-1550 ◽  
Author(s):  
S. L. Shih ◽  
W. S. Tsai ◽  
S. K. Green ◽  
L. M. Lee
Keyword(s):  
International Committee ◽  
Tomato Leaf ◽  
Open Reading Frames ◽  
Specific Primers ◽  
Sequence Comparisons ◽  
Tomato Leaf Curl Disease ◽  
Sequence Identity ◽  
Two Samples ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Mild leaf curling and yellowing symptoms were observed in approximately 5% of 1-month-old tomato plants (Solanum lycopersicum) in a farmer's field in Tengeru, Arusha, Tanzania in January 2006. DNA was extracted from four symptomatic and five asymptomatic plants and tested for the presence of begomovirus by polymerase chain reaction (PCR) using primer pair PAL1v1978/PAR1c715 (4). All asymptomatic samples were negative. Two of four symptomatic samples yielded the expected 1.4-kb DNA-A fragment for begomovirus. DNA-B was not detected in these two samples by PCR using the DNA-B degenerate primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2), and PBL1v2040/PCRc1 and PBL1v2040/PCRc154 (4). DNA-beta was also not detectable using DNA-beta specific primers (1). The 1.4-kb PCR product from one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,766 nucleotides (Genbank Accession No. DQ519575) and was found to contain the geminiviral conserved nanosequence-TAATATTAC in the intergenic region and the six predicted open reading frames (V1, V2, C1, C2, C3, and C4). BLAST analysis was conducted with geminivirus sequences available in GenBank, and MegAlign software (DNASTAR, Inc, Madison, WI) was used for further comparisons. Highest sequence identity (84%) was with the partially sequenced Tomato leaf curl Tanzania virus found in Makutupora, Tanzania in 1994 (1,523 nucleotides, Genbank Accession No. U73498) in the 1,919 nt to 679 nt region. Low sequence identity (78%) was noted with Tomato yellow leaf curl Sardinia virus (Genbank Accession No. X61153) that is reportedly prevalent in Arusha, Morogoro, Dodoma, Iringa, Kilimanjaro, and Dar es Salaam of Tanzania (3). Comparison of the nucleotide sequence of this new virus with those of full-length begomoviral DNA-A available in GenBank indicated highest sequence identity (81%) with Tomato leaf curl Mayotte virus (EMBL Accession No. AJ865341). On the basis of the DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity, the tomato leaf curl virus from Arusha, Tanzania constitutes a distinct begomovirus and the name Tomato leaf curl Arusha virus is proposed. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) B. D. Kashina et al. Arch. Phytopathol. Plant Prot. 35:255, 2002 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia

Plant Disease ◽  
2009 ◽  
Vol 93 (3) ◽  
pp. 321-321 ◽  
Author(s):  
W. S. Tsai ◽  
S. L. Shih ◽  
S. K. Green ◽  
L. M. Lee ◽  
G. C. Luther ◽  
...  
Keyword(s):  
Severe Disease ◽  
Positive Sample ◽  
Tomato Leaf ◽  
Yellow Leaf ◽  
Sequence Comparisons ◽  
Sequence Identity ◽  
North Sulawesi ◽  
Species Demarcation Threshold ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5′CCCGGATCCTCTAATTCATCCCT3′; IndC: 5′GACGGATCCCACATGTTTGCCA3′) was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

scholarly journals Complete Genome Sequence of a Lineage II Peste des Petits Ruminants Virus from Sierra Leone

2018 ◽  
Vol 6 (1) ◽  
Author(s):  
William G. Dundon ◽  
Caroline M. Adombi ◽  
Saidu Kanu ◽  
Angelika Loitsch ◽  
Giovanni Cattoli ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Sierra Leone ◽  
Genome Sequence ◽  
Complete Genome Sequence ◽  
Complete Genome ◽  
Ivory Coast ◽  
Nucleotide Sequence Identity ◽  
Peste Des Petits Ruminants ◽  
Sequence Identity

ABSTRACT The complete genome sequence of a peste des petits ruminants virus (PPRV) from goat samples collected in Sierra Leone in 2011 is reported here. The genome shows a higher nucleotide sequence identity (98.9%) with a lineage II PPRV from Senegal than to PPRVs from neighboring Liberia and Ivory Coast.

Sign in / Sign up

Export Citation Format

Share Document