Genetic variation and differentiation of wood mice from the genus Sylvaemus inferred from sequencing of the cytochrome oxidase subunit 1 gene fragment

2012 ◽  
Vol 48 (2) ◽  
pp. 186-198 ◽  
Author(s):  
A. S. Bogdanov ◽  
V. V. Stakheev ◽  
A. E. Zykov ◽  
V. V. Yakimenko ◽  
M. G. Mal’kova
Keyword(s):  
Genetic Variation ◽  
Cytochrome Oxidase ◽  
Gene Fragment ◽  
Cytochrome Oxidase Subunit ◽  
Wood Mice ◽  
Oxidase Subunit ◽  
Cytochrome Oxidase Subunit 1

scholarly journals Sequence Analysis of Mitochondrial DNAs of 12S rRNA, 16S rRNA, and Cytochrome Oxidase Subunit 1(COI) Regions in Slow Lorises (Genus Nycticebus) May Contribute to Improved Identification of Confiscated Specimens

ISRN Zoology ◽  
2012 ◽  
Vol 2012 ◽  
pp. 1-8 ◽  
Author(s):  
Hiroko Somura ◽  
Hiroshi Hori ◽  
Yoshinobu Manome
Keyword(s):  
16S Rrna ◽  
Cytochrome Oxidase ◽  
Dna Analysis ◽  
12S Rrna ◽  
Cytochrome Oxidase Subunit ◽  
Slow Loris ◽  
Oxidase Subunit ◽  
Mitochondrial Dnas ◽  
Cytochrome Oxidase Subunit 1 ◽  
Rrna 16S

The slow loris (Nycticebus) is a prosimian that is popular among exotic pet lovers. In Japan, many slow lorises have been imported illegally. Prosimians that have been confiscated in raids are protected in Japanese zoos, and the number of such animals has increased. In most cases, the country of origin remains unknown and even the species can be difficult to identify from the animal’s physical appearance alone. We have attempted to resolve this problem by using DNA analysis. DNA samples of five species, consisting of the Pygmy slow loris (Nycticebus pygmaeus), Bengal slow loris (Nycticebus bengalensis), Sunda slow loris (Nycticebus coucang), Javan slow loris (Nycticebus javanicus), and Bornean slow loris (Nycticebus menagensis), were extracted, amplified, and the nucleotide sequences of mitochondrial 12S rRNA, 16S rRNA, and the cytochrome oxidase subunit 1(COI) regions were compared. Differences of nucleic acid sequences of representative individuals were demonstrated.

scholarly journals Identifikasi sirip ikan hiu yang didapat dari pengumpul di Minahasa Tenggara menggunakan DNA Barcode

2017 ◽  
Vol 5 (1) ◽  
pp. 62
Author(s):  
Andre Wehantouw ◽  
Elvy Ginting ◽  
Stenly Wullur
Keyword(s):  
Cytochrome Oxidase ◽  
Dna Barcode ◽  
Cytochrome Oxidase Subunit ◽  
Oxidase Subunit ◽  
Cytochrome Oxidase Subunit 1 ◽  
Triaenodon Obesus

Populasi ikan hiu global menunjukkan penurunan yang signifikan karena; penangkapan yang masif dan tak terkontrol, karakter biologi reproduksi yang lambat serta fekunditas yang rendah.  Indonesia merupakan salah satu negara kontributor terbesar dalam perdagangan sirip ikan hiu dunia. Tingginya aktifitas perdagangan sirip tersebut berpengaruh terhadap populasi ikan hiu dan berdampak pada turunnya kualitas keseimbangan ekosistem laut. Tujuan penelitian ini untuk mengidentifikasi ikan hiu dari potongan sirip yang didapat dari pengumpul di Tumbak, Minahasa Tenggara menggunakan DNA barcode.  Ekstraksi DNA genom sirip hiu kering dilakukan dengan menggunakan prosedur DNeasy Blood & Tissue kit, amplifikasi gen Cytochrome Oxidase Subunit 1 (COI) dilakukan dengan menggunakan primer Fish BCL5 (TCAACYAATCAYAAAGATATYGGCAC) dan HCO2198 (TAAACTTCAGGGTGACCAAAAAA TCA). Pengolahan data sekuens dilakukan dengan menggunakan program ABsequence3 dan MEGA ver 6.  Pencocokan karakter nukleotida gen COI dilakukan dengan menggunakan program nBLAST yang terintegrasi pada laman GenBank. Sampel sirip yang berhasil dikoleksi berasal dari 4 individu yang berbeda.  Hasil nBLAST menunjukkan bahwa keempat sampel sirip hiu tersebut teridentifikasi sebagai spesies Triaenodon obesus.  Nilai keakuratan pensejajaran sekuens, nilai dugaan, prosentase panjang nukleotida yang selaras, dan prosentase tingkat kemiripan, masing-masing pada nilai antara 604-1245, 0.0, 70-99% dan 92-99%.

scholarly journals Molecular identification of Ergalatax contracta from Yeongdo island, Korea

2021 ◽  
pp. 96-98
Author(s):  
Yangrae Rho ◽  
◽  
Hoyeon Lee ◽  
Hiyoung Kim ◽  
Inho Yang ◽  
...  
Keyword(s):  
Cytochrome Oxidase ◽  
Molecular Identification ◽  
Genomic Dna ◽  
Sequencing Analysis ◽  
Accession Number ◽  
Cytochrome Oxidase Subunit ◽  
Oxidase Subunit ◽  
Cytochrome Oxidase Subunit 1

The current study reports the cytochrome oxidase subunit 1 sequence of Gastropoda Ergalatax contracta from Busan, Korea. Four specimens were collected and extracted to obtain genomic DNA for the sequencing analysis. This is the first E. contracta sequence from Korea submitted to the NCBI for an accession number.

scholarly journals Genetic variation and phylogenetic analysis of Indonesian indigenous catfish based on mitochondrial cytochrome oxidase subunit III gene

2019 ◽  
Vol 12 (6) ◽  
pp. 896-900 ◽  
Author(s):  
Rini Widayanti ◽  
Aris Haryanto ◽  
Wayan Tunas Artama ◽  
Suhendra Pakpahan
Keyword(s):  
Amino Acids ◽  
Genetic Variation ◽  
Cytochrome Oxidase ◽  
Phylogenetic Reconstruction ◽  
Mitochondrial Cytochrome ◽  
Cytochrome Oxidase Subunit ◽  
Mitochondrial Cytochrome Oxidase Subunit ◽  
Oxidase Subunit ◽  
Subunit Iii ◽  
Mitochondrial Cytochrome Oxidase

Aim: This study aimed to analyze the genetic variation and phylogenetic reconstruction of Indonesian indigenous catfish using mitochondrial cytochrome oxidase subunit III sequences. Materials and Methods: A total of 19 samples of catfish were collected from seven rivers (Elo [EM], Progo [PM], Kampar [KR], Musi [MP], Mahakam [MS], Kapuas [KS], and Bengawan Solo [BSBJ]) in five different geographical locations in Indonesia. The genome was isolated from the tissue. Mitochondrial DNA cytochrome oxidase subunit III was amplified using polymerase chain reaction (PCR) with CO3F and CO3R primers. The PCR products were sequenced and continued to analyze genetic variation and phylogenetic relationship using MEGA version 7.0 software. Results: Cytochrome c oxidase (COX)-III gene sequencing obtained 784 nucleotides encoding 261 amino acids. Sequenced COX-III gene fragments were aligned along with other catfish from Genbank using ClustalW program and genetic diversity among species was analyzed using the MEGA Version 7.0 software. Among all samples, there were substitution mutations at 78 nucleotide sites, and there were 14 variations in amino acids. Catfish from PM, KR, MP, and KS had the same amino acids as Hemibagrus nemurus (KJ573466.1), while EM catfish had eight different amino acids and catfish BSBJhad 12 different amino acids. Conclusion: Indonesian catfish divided into four clades. BBSJ Catfish were grouped with Pangasianodon gigas, EM catfish were grouped with Mystus rhegma, and KS catfish were grouped with Hemibagrus spilopterus, while catfish MS, KR, PM, and MP were grouped with H. nemurus.

Sign in / Sign up

Export Citation Format

Share Document