scholarly journals A real-time quantitative polymerase chain reaction for the specific detection of Hammondia hammondi and its differentiation from Toxoplasma gondii

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
Gereon Schares ◽  
Majda Globokar Vrhovec ◽  
Mareen Tuschy ◽  
Maike Joeres ◽  
Andrea Bärwald ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Toxoplasma Gondii ◽  
Real Time ◽  
Real Time Pcr ◽  
Post Infection ◽  
In Silico ◽  
Repetitive Element ◽  
Analytical Sensitivity ◽  
Chain Reaction ◽  
Polymerase Chain

Abstract Introduction Hammondia hammondi and Toxoplasma gondii are closely related protozoan parasites, but only T. gondii is zoonotic. Both species use felids as definitive hosts and cannot be differentiated by oocyst morphology. In T. gondii, a 529-base pair (bp) repetitive element (TgREP-529) is of utmost diagnostic importance for polymerase chain reaction (PCR) diagnostic tests. We identified a similar repetitive region in the H. hammondi genome (HhamREP-529). Methods Based on reported sequences, primers and probes were selected in silico and optimal primer probe combinations were explored, also by including previously published primers. The analytical sensitivity was tested using serial dilutions of oocyst DNA. For testing analytical specificity, DNA isolated from several related species was used as controls. The newly established TaqMan PCR (Hham-qPCR1) was applied to tissues collected from H. hammondi-infected gamma-interferon gene knockout (GKO) mice at varying time points post-infection. Results Ten forward and six reverse primers were tested in varying combinations. Four potentially suitable dual-labelled probes were selected. One set based on the primer pair (Hham275F, Hham81R) and the probe (Hham222P) yielded optimal results. In addition to excellent analytic specificity, the assay revealed an analytical sensitivity of genome equivalents of less than one oocyst. Investigation of the tissue distribution in GKO mice revealed the presence of parasite DNA in all examined organs, but to a varying extent, suggesting 100- to 10,000-fold differences in parasitic loads between tissues in the chronic state of infection, 42 days post-infection. Discussion The use of the 529-bp repeat of H. hammondi is suitable for establishing a quantitative real-time PCR assay, because this repeat probably exists about 200 times in the genome of a single organism, like its counterpart in T. gondii. Although there were enough sequence data available, only a few of the primers predicted in silico revealed sufficient amplification; the identification of a suitable probe was also difficult. This is in accord with our previous observations on considerable variability in the 529-bp repetitive element of H. hammondi. Conclusions The H. hammondi real-time PCR represents an important novel diagnostic tool for epidemiological and cell biological studies on H. hammondi and related parasites.

scholarly journals A Real-time Quantitative Polymerase Chain Reaction for the Specific Detection of Hammondia Hammondi and Its Differentiation from Toxoplasma Gondii

2020 ◽  
Author(s):  
Gereon Schares ◽  
Majda Globokar Vrhovec ◽  
Mareen Tuschy ◽  
Maike Joeres ◽  
Andrea Bärwald ◽  
...  
Keyword(s):  
Toxoplasma Gondii ◽  
Real Time ◽  
Real Time Pcr ◽  
Post Infection ◽  
In Silico ◽  
Repetitive Element ◽  
Sequence Data ◽  
Quantitative Polymerase Chain Reaction ◽  
Analytical Sensitivity ◽  
Biological Studies

Abstract Introduction: Hammondia hammondi and Toxoplasma gondii are closely related protozoan parasites, but only T. gondii is zoonotic . Both species use felids as definitive hosts and cannot be differentiated by oocyst morphology. In T. gondii, a 529 bp repetitive element (TgREP-529) is of utmost diagnostic importance for PCR diagnostic tests. We identified a similar repetitive region in the H. hammondi genome (HhamREP-529).Material and Methods: Based on reported sequences, primers and probes were selected in silico and optimal primer probe combinations were explored, also by including previously published primers. The analytical sensitivity was tested using serial dilutions of oocyst DNA. For testing analytical specificity, DNA isolated from several related species were used as controls. The newly established TaqMan PCR (Hham-qPCR1) was applied to tissues collected from H. hammondi-infected gamma-interferon knockout (GKO) mice at varying time points post infection. Results: Ten forward and six reverse primers were tested in varying combinations. Four potentially suitable dual-labelled probes were selected. One set based on the primer pair (Hham275F, Hham81R) and the probe (Hham222P) yielded optimal results. In addition to excellent analytic specificity, the assay revealed an analytical sensitivity of genome equivalents of less than 1 oocyst. Investigation of the tissue distribution in GKO mice revealed the presence of parasite DNA in all examined organs, but to a varying extent suggesting 100- to 10.000-fold differences in parasitic loads between tissues in the chronic state of infection, 42 days post infection. Discussion: The use of the 529 bp repeat of H. hammondi is suitable for establishing a quantitative real-time PCR assay because this repeat probably exists about 200-times in the genome of a single organism, like its counterpart in T. gondii. Although there was enough sequence data available, only few of the primers predicted in silico revealed sufficient amplification; the identification of a suitable probe was also difficult. This is in accord with our previous observations on considerable variability in the 529 bp repetitive element of H. hammondi.Conclusions: The H. hammondi real-time PCR represents an important novel diagnostic tool for epidemiological and cell-biological studies on this and related parasites.

Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)

2021 ◽  
Vol 1 (2) ◽  
pp. 20-29
Author(s):  
Maria A E D Sihotang ◽  
Yola Eka Erwinda ◽  
Eniek Suwarni ◽  
Erita Lusianti
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Rattus Norvegicus ◽  
In Silico ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Polymerase Chain

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR.  Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

scholarly journals In Planta Distribution of ‘Candidatus Liberibacter asiaticus’ as Revealed by Polymerase Chain Reaction (PCR) and Real-Time PCR

2008 ◽  
Vol 98 (5) ◽  
pp. 592-599 ◽  
Author(s):  
Satyanarayana Tatineni ◽  
Uma Shankar Sagaram ◽  
Siddarame Gowda ◽  
Cecile J. Robertson ◽  
William O. Dawson ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Citrus Tree ◽  
Candidatus Liberibacter Asiaticus ◽  
In Planta ◽  
Chain Reaction ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Polymerase Chain

Huanglongbing (HLB) is one of the most devastating diseases of citrus worldwide, and is caused by a phloem-limited fastidious prokaryotic α-proteobacterium that is yet to be cultured. In this study, a combination of traditional polymerase chain reaction (PCR) and real-time PCR targeting the putative DNA polymerase and 16S rDNA sequence of ‘Candidatus Liberibacter asiaticus,’ respectively, were used to examine the distribution and movement of the HLB pathogen in the infected citrus tree. We found that ‘Ca. Liberibacter asiaticus’ was distributed in bark tissue, leaf midrib, roots, and different floral and fruit parts, but not in endosperm and embryo, of infected citrus trees. Quantification analysis of the HLB bacterium indicated that it was distributed unevenly in planta and ranged from 14 to 137,031 cells/μg of total DNA in different tissues. A relatively high concentration of ‘Ca. Liberibacter asiaticus’ was observed in fruit peduncles. Our data from greenhouse-infected plants also indicated that ‘Ca. Liberibacter asiaticus’ was transmitted systemically from infection site to different parts of the plant. Understanding the distribution and movement of the HLB bacterium inside an individual citrus tree is critical for discerning its virulence mechanism and to develop management strategies for HLB.

scholarly journals Real-Time Polymerase Chain Reaction for One-Hour On-Site Diagnosis of Pierce's Disease of Grape in Early Season Asymptomatic Vines

2002 ◽  
Vol 92 (7) ◽  
pp. 721-728 ◽  
Author(s):  
N. W. Schaad ◽  
D. Opgenorth ◽  
P. Gaush
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Xylella Fastidiosa ◽  
Molecular Techniques ◽  
Plant Diseases ◽  
Pierce's Disease ◽  
Chain Reaction ◽  
Pierce’S Disease ◽  
Polymerase Chain

Molecular-based techniques, such as polymerase chain reaction (PCR), can reduce the time needed for diagnosis of plant diseases when compared with classical isolation and pathogenicity tests. However, molecular techniques still require 2 to 3 days to complete. To the best of our knowledge, we describe for the first time a real-time PCR technique using a portable Smart Cycler for one-hour on-site diagnosis of an asymptomatic plant disease. Pierce's disease (PD) of grape, caused by the fastidious bacterium Xylella fastidiosa, causes serious losses in grapes in California and the southeastern United States. The disease has been difficult to diagnose because typical leaf scorching symptoms do not appear until late (June and after) in the season and the organism is very difficult to isolate early in the season. Sap and samples of macerated chips of secondary xylem from trunks of vines were used in a direct real-time PCR without extraction of DNA. Using two different sets of primers and probe, we diagnosed PD in 7 of 27 vines (26%) from four of six vineyards sampled 10 to 12 days after bud break in Kern, Tulare, and Napa counties of California. The diagnosis was confirmed by isolation of Xylella fastidiosa from two of the original PCR positive samples and later from symptomatic leaf petioles of four out of four vines from one vineyard that were originally PCR positive.

scholarly journals Evaluation of Amplification Targets for the Specific Detection ofBordetella pertussisUsing Real-Time Polymerase Chain Reaction

2014 ◽  
Vol 25 (4) ◽  
pp. 217-221 ◽  
Author(s):  
Mohammad Rubayet Hasan ◽  
Rusung Tan ◽  
Ghada N Al-Rawahi ◽  
Eva Thomas ◽  
Peter Tilley
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Target Genes ◽  
Reference Panel ◽  
Superior Performance ◽  
Clinical Samples ◽  
Analytical Sensitivity ◽  
Chain Reaction ◽  
Pcr Assay ◽  
Polymerase Chain

BACKGROUND:Bordetella pertussisinfections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR) assays to detectB pertussisare typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.METHODS: A novelB pertussisreal-time PCR assay based on the porin gene was tested in parallel with several previously published assays that target genes such as IS481,ptx-promoter, pertactin and a putative thialase. The assays were evaluated using a reference panel of common respiratory bacteria including differentBordetellaspecies and 107 clinical nasopharyngeal specimens. Discrepant results were confirmed by sequencing the PCR products.RESULTS: Analytical sensitivity was highest for the assay targeting the IS481element; however, the assay lacked specificity forB pertussisin the reference panel and in the clinical samples. False-positive results were also observed with assays targeting theptx-promoter and pertactin genes. A PCR assay based on the thialase gene was highly specific but failed to detect all reference strains ofB pertussis. However, a novel assay targeting the porin gene demonstrated high specificity forB pertussisboth in the reference panel and in clinical samples and, based on sequence-confirmed results, correctly predicted allB pertussis-positive cases in clinical samples. According to Probit regression analysis, the 95% detection limit of the new assay was 4 colony forming units/reaction.CONCLUSION: A novel porin assay forB pertussisdemonstrated superior performance and may be useful for improved molecular detection ofB pertussisin clinical specimens.

Sign in / Sign up

Export Citation Format

Share Document