Mortality of Different Life Stages of Rhagoletis indifferens (Diptera: Tephritidae) Exposed to the Entomopathogenic Fungus Metarhizium anisopliae

2005 ◽  
Vol 40 (2) ◽  
pp. 167-177 ◽  
Author(s):  
Wee L. Yee ◽  
Lawrence A. Lacey
Keyword(s):  
Emerging Adults ◽  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Laboratory Tests ◽  
Fungal Spores ◽  
Adult Emergence ◽  
Fruit Fly ◽  
Life Stages ◽  
Post Exposure ◽  
Rhagoletis Indifferens

Effects of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin on the mortality of different life stages of the western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), were determined in laboratory tests. When teneral adults were exposed to fungal spores mixed in soil (7.63 × 105 and 1.61 × 106 spores/g) or applied to the surface of soil (1.14 × 106 and 2.28 × 106 spores/cm2) with 13 to 30% moisture, adult emergence was not reduced, but 14.9 to 68.0% of emerging adults were infected at death. When adult flies were exposed to various concentrations of dry spores inside vials, 15 mg (4.59 × 108 spores/10 flies) was the lowest needed for 100% mortality at 7 d post exposure, and resulted in 5.96 × 106 spores adhering to each fly. Females exposed to 1.80 mg (5.51 × 107 spores/10 flies) laid as many eggs as control females between 0 and 3 d post exposure, but due to mortality infected flies laid fewer eggs between 3 and 7 d. Third-instar larvae exposed to treated soil (9.63 × 104 to 4.81 × 106 spores/cm2) with 20% moisture were not infected.

scholarly journals Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

2011 ◽  
Vol 71 (1) ◽  
pp. 91-98 ◽  
Author(s):  
IJ. Bechara ◽  
RHR. Destéfano ◽  
C. Bresil ◽  
CL. Messias
Keyword(s):  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Large Scale ◽  
Microbial Control ◽  
Fruit Fly ◽  
Control Agent ◽  
Immature Stages ◽  
Disease Cycle ◽  
Anastrepha Fraterculus ◽  
Hyphal Bodies

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

scholarly journals Effects of Hypoxia on Acoustic Activity of Two Stored-Product Pests, Adult Emergence, and Grain Quality

2019 ◽  
Vol 112 (4) ◽  
pp. 1989-1996 ◽  
Author(s):  
Anastasia W Njoroge ◽  
Richard W Mankin ◽  
Bradley Smith ◽  
Dieudonne Baributsa
Keyword(s):  
Emerging Adults ◽  
Grain Quality ◽  
Callosobruchus Maculatus ◽  
Sitophilus Oryzae ◽  
Adult Emergence ◽  
Stored Grain ◽  
Acoustic Activity ◽  
Oxygen Levels ◽  
Post Exposure ◽  
Grain Damage

Abstract Modified atmospheres such as hermetic storage are widely used for the control of stored grain insect pests. To improve their effectiveness, there is need to better understand insect responses to low-oxygen environments. Adult Callosobruchus maculatus F. (Coleoptera: Chrysomelidae: Bruchinae) on cowpea and Sitophilus oryzae L. (Coleoptera: Curculionidae) on wheat were exposed to hypoxia treatments consisting of 1, 3, and 5% oxygen levels for 14 d. Acoustic activity was monitored during the experiment, and insect mortality and grain quality were examined immediately after the hypoxia treatments. Adult emergence was assessed 45 d post-treatment. All three hypoxia treatments eliminated acoustic activity of both species within 4 d. There was neither insect survival for both species nor significant grain damage immediately after 14-d exposure to hypoxia treatments. No adult insects emerged 45 d post-exposure on grains maintained at 1% oxygen level for 14 d. However, at 3 and 5% oxygen levels, there were eggs on cowpea, holes in wheat, and emerging adults for both insect species 45 d post-exposure. Although insect activity ceased within 4 d when hypoxia was maintained below 5%, there is need to explore exposure beyond 14 d for 3 and 5% oxygen levels, to ensure to avoid potential adult emergence from eggs and other insect life stages post-treatments. Maintaining 3–5% hypoxia conditions for a longer duration would ensure insufficient oxygen is available for progeny development.

THE WESTERN CHERRY FRUIT FLY, RHAGOLETIS INDIFFERENS (DIPTERA: TEPHRITIDAE): 1. DISTRIBUTION OF THE DIAPAUSING PUPAE IN THE SOIL

1974 ◽  
Vol 106 (9) ◽  
pp. 909-912 ◽  
Author(s):  
M. T. AliNiazee
Keyword(s):  
Adult Emergence ◽  
Fruit Fly ◽  
Field Studies ◽  
Soil Samples ◽  
Willamette Valley ◽  
Rhagoletis Indifferens

AbstractField studies conducted in cherry orchards of the Willamette Valley, Oregon, indicate that diapausing pupae of the western cherry fruit fly, Rhagoletis indifferens Curran, overwinter in the soil at a depth of 1–4 in. Relatively very small numbers of pupae were collected from surface debris and soil samples taken at a depth of 6 in. and below. The number of flies emerging from different soil depths indicated that removal of the top 6 in. of soil caused a 99% reduction in adult emergence, while the removal of the top 1 in. of soil had no effect.

Effect of Metarhizium anisopliae (Hypocreales: Clavicipitaceae) on food consumption and mortality in the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae)

2018 ◽  
Vol 38 (03) ◽  
pp. 254-260 ◽  
Author(s):  
Ricardo Alberto Toledo-Hernández ◽  
Jorge Toledo ◽  
Daniel Sánchez
Keyword(s):  
Pest Management ◽  
Food Consumption ◽  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Sublethal Effects ◽  
Fruit Fly ◽  
Anastrepha Ludens ◽  
Mexican Fruit Fly ◽  
Important Pest ◽  
Highly Virulent

AbstractAnastrepha ludens (Loew) (Diptera: Tephritidae) is an important pest of mango and citrus in Mexico. Here, we report the effect of the entomopathogenic fungus Metarhizium anisopliae (Metsch.) Sorokin strain MAAP1 on mortality and food consumption in A. ludens adults. Experiments were carried out under laboratory conditions at 26 ± 2 °C, 60 ± 5% RH and 12:12 photoperiod. To assess pathogenicity and sublethal effects, we sprayed flies with 1 × 109 conidia/ml and 1 × 106 conidia/ml solutions, respectively. Food consumption was measured by providing known amounts of food through capillary tubes to caged flies. We found that M. anisopliae was highly virulent to A. ludens, causing 92.3 ± 0.62% mortality at day 13 post-exposure. Interestingly, food consumption reduced by 17% in flies exposed to the fungus. These results support the implementation of M. anisopliae within current strategies used for the integrated pest management of A. ludens.

THE EFFECT OF A NEEM (AZIDIRACHTA INDICA) BASED INSECTICIDE ON SURVIVAL AND DEVELOPMENT OF JUVENILE WESTERN CHERRY FRUIT FLY (RHAGOLETIS INDIFFERENS) (DIPTERA: TEPHRITIDAE)

1998 ◽  
Vol 130 (6) ◽  
pp. 869-876 ◽  
Author(s):  
E.J. vanRanden ◽  
B.D. Roitberg
Keyword(s):  
Pest Management ◽  
Adult Emergence ◽  
Fruit Fly ◽  
Management Tool ◽  
Larval Diet ◽  
Survival And Development ◽  
Potential Pest ◽  
Rhagoletis Indifferens ◽  
Third Instar Larvae

AbstractIn the laboratory a proprietary, neem-based insecticide formulation (NBI) was evaluated as a potential pest management tool for the western cherry fruit fly, Rhagoletis indifferens Curran (WCFF). NBI was tested for its potential effects on survival and development of juvenile WCFF. Incorporation of NBI into an artificial larval diet resulted in a decrease in the formation of pupae and subsequent adult emergence. Late third instar larvae exposed to NBI in sand were able to form puparia; however, the numbers of adults and pupae developing inside the puparia were decreased at concentrations as low as 0.05% NBI. Well-timed root drenches with NBI could control R. indifferens by disrupting pupation. Applied in this manner, NBI may provide cherry orchardists with an effective, new control tactic.

scholarly journals Laboratory and microcosm experiments reveal contrasted adaptive responses to ammonia and water mineralisation in aquatic stages of the sibling species Anopheles gambiae (sensu stricto) and Anopheles coluzzii

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
Nwamaka Oluchukwu Akpodiete ◽  
Frédéric Tripet
Keyword(s):  
West Africa ◽  
Anopheles Gambiae ◽  
Emerging Adults ◽  
Sibling Species ◽  
Adult Emergence ◽  
Ecological Speciation ◽  
Sensu Stricto ◽  
Rice Fields ◽  
Anopheles Coluzzii ◽  
Phenotypic Quality

Abstract Background The sibling species of the malaria mosquito, Anopheles gambiae (sensu stricto) and Anopheles coluzzii co-exist in many parts of West Africa and are thought to have recently diverged through a process of ecological speciation with gene flow. Divergent larval ecological adaptations, resulting in Genotype-by-Environment (G × E) interactions, have been proposed as important drivers of speciation in these species. In West Africa, An. coluzzii tends to be associated with permanent man-made larval habitats such as irrigated rice fields, which are typically more eutrophic and mineral and ammonia-rich than the temporary rain pools exploited by An. gambiae (s.s.) Methods To highlight G × E interactions at the larval stage and their possible role in ecological speciation of these species, we first investigated the effect of exposure to ammonium hydroxide and water mineralisation on larval developmental success. Mosquito larvae were exposed to two water sources and increasing ammonia concentrations in small containers until adult emergence. In a second experiment, larval developmental success was compared across two contrasted microcosms to highlight G × E interactions under conditions such as those found in the natural environment. Results The first experiment revealed significant G × E interactions in developmental success and phenotypic quality for both species in response to increasing ammonia concentrations and water mineralisation. The An. coluzzii strain outperformed the An. gambiae (s.s.) strain under limited conditions that were closer to more eutrophic habitats. The second experiment revealed divergent crisscrossing reaction norms in the developmental success of the sibling species in the two contrasted larval environments. As expected, An. coluzzii had higher emergence rates in the rice paddy environment with emerging adults of superior phenotypic quality compared to An. gambiae (s.s.), and vice versa, in the rain puddle environment. Conclusions Evidence for such G × E interactions lends support to the hypothesis that divergent larval adaptations to the environmental conditions found in man-made habitats such as rice fields in An. coluzzii may have been an important driver of its ecological speciation.

scholarly journals Survival and mutant production induced by mutagenic agents in Metarhizium anisopliae

1995 ◽  
Vol 52 (3) ◽  
pp. 548-554 ◽  
Author(s):  
V. Kava - Cordeiro ◽  
E.A. Luna - Alves - Lima ◽  
J.L. Azevedo
Keyword(s):  
Gamma Radiation ◽  
Ultraviolet Light ◽  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Nitrous Acid ◽  
Wild Strain ◽  
Wild Type ◽  
Survival Curves ◽  
Auxotrophic Mutants ◽  
Morphological Mutants

A wild strain of Metarhizium anisopliae, an entomopathogenic fungus, was submitted to three mutagenic agents: gamma radiation, ultraviolet light and nitrous acid. Survival curves were obtained and mutants were selected using different mutagenic doses which gave 1 to 5% survival. Morphological and auxotrophic mutants were isolated. Morphological mutants were grouped in a class with yellow conidia and other with pale vinaceous conidia as opposed to the green wild type conidia. Auxotrophic mutants had requirements for vitamin and aminoacid biosynthesis. More than 58% of the total auxotrophk mutants required proline/aipnine. Gamma radiation showed to be the most efficient mutagenic agent giving 0.2% of auxotrophk mutants followed by ultraviolet light (0.12%) and nitrous acid (0.06%).The conidial colour and auxotrophk mutants isolated until now from M. anisopliae were reviewed.

DEMONSTRATION OF A PARASEXUAL CYCLE IN THE ENTOMOPATHOGENIC FUNGUS METARHIZIUM ANISOPLIAE

1980 ◽  
Vol 22 (2) ◽  
pp. 309-314 ◽  
Author(s):  
K. Al-Aidroos
Keyword(s):  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Parasexual Cycle

In an attempt to demonstrate the existence of a parasexual cycle in the imperfect entomopathogenic fungus, Metarhizium anisopliae (Metschnikoff) Sorokin, doubly- and triply-marked strains were forced to form heterokaryons. All heterokaryons produced diploid spores, two of which yielded putative recombinants.

Sign in / Sign up

Export Citation Format

Share Document