Strain improvement of native Saccharomyces cerevisiae LN ITCC 8246 strain through protoplast fusion to enhance its xylose uptake

2021 ◽  
Author(s):  
Shalley Sharma ◽  
Chandrika Ghoshal ◽  
Anju Arora ◽  
Wara Samar ◽  
Lata Nain ◽  
...  
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Protoplast Fusion ◽  
Strain Improvement ◽  
Pichia Stipitis ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
Xylose Metabolism ◽  
Xylose Consumption ◽  
Xylose Uptake ◽  
Electric Impulse

Abstract Co-utilization of xylose and glucose and subsequent fermentation using Saccharomyces cerevisiae could enhance ethanol productivity. Directed engineering approaches have met with limited success due to interconnectivity of xylose metabolism with other intrinsic, hidden pathways. Therefore, random approaches like protoplast fusion were used to reprogram unidentified mechanisms. Saccharomyces cerevisiae LN, the best hexose fermenter, was fused with xylose fermenting Pichia stipitis NCIM 3498. Protoplasts prepared using glucanex were fused under electric impulse and fusants were selected using 10% ethanol and cycloheximide (50 ppm) markers. Two fusants, 1a.23 and 1a.30 showing fast growth on xylose and tolerance to 10% ethanol, were selected. Higher extracellular protein expression observed in fusants as compared to parents was corroborated by higher number of bands resolved by twodimensional analysis. Overexpression of XYL1, XYL2, XKS and XUT4 in fusants as compared to S. cerevisiae LN as observed by RT-PCR analysis was substantiated by higher specific activities of XR, XDH and XKS enzymes in fusants. During lignocellulosic hydrolysate fermentation, fusants could utilize glucose faster than the parent P. stipitis NCIM 3498 and xylose consumption in fusants was higher than S. cerevisiae LN.

scholarly journals Efficient, D-glucose insensitive, growth on D-xylose by an evolutionary engineered Saccharomyces cerevisiae strain

2019 ◽  
Vol 19 (8) ◽  
Author(s):  
Jeroen G Nijland ◽  
Xiang Li ◽  
Hyun Yong Shin ◽  
Paul P de Waal ◽  
Arnold J M Driessen
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Morphological Analysis ◽  
Membrane Transporters ◽  
Evolutionary Engineering ◽  
Xylose Consumption ◽  
Xylose Transport ◽  
Xylose Uptake ◽  
Cost Efficient ◽  
Engineered Saccharomyces Cerevisiae ◽  
Selection Of

ABSTRACT Optimizing D-xylose consumption in Saccharomyces cerevisiae is essential for cost-efficient cellulosic bioethanol production. An evolutionary engineering approach was used to elevate D-xylose consumption in a xylose-fermenting S. cerevisiae strain carrying the D-xylose-specific N367I mutation in the endogenous chimeric Hxt36 hexose transporter. This strain carries a quadruple hexokinase deletion that prevents glucose utilization, and allows for selection of improved growth rates on D-xylose in the presence of high D-glucose concentrations. Evolutionary engineering resulted in D-glucose-insensitive growth and consumption of D-xylose, which could be attributed to glucose insensitive D-xylose uptake via a novel chimeric Hxt37 N367I transporter that emerged from a fusion of the HXT36 and HXT7 genes, and a down regulation of a set of Hxt transporters that mediate glucose sensitive xylose transport. RNA sequencing revealed the downregulation of HXT1 and HXT2 which, together with the deletion of HXT7, resulted in a 21% reduction of the expression of all plasma membrane transporters genes. Morphological analysis showed an increased cell size and corresponding increased cell surface area of the evolved strain, which could be attributed to genome duplication. Mixed strain fermentation of the D-xylose-consuming strain DS71054-evo6 with the D-glucose consuming CEN.PK113–7D strain resulted in decreased residual sugar concentrations and improved ethanol production yields compared to a strain which sequentially consumes D-glucose and D-xylose.

scholarly journals Protein acetylation regulates xylose metabolism during adaptation of Saccharomyces cerevisiae

2021 ◽  
Author(s):  
Yong-Shui Tan ◽  
Li Wang ◽  
Ying-Ying Wang ◽  
Qi-En He ◽  
Zhen Zhu ◽  
...  
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Fold Increase ◽  
The State ◽  
Confirmatory Test ◽  
Xylose Utilization ◽  
Protein Acetylation ◽  
Xylose Metabolism ◽  
Promising Alternative ◽  
Xylose Consumption ◽  
Synthetic Complete

Abstract Background Lignocellulosic biomass upgrading has become a promising alternative route to produce transportation fuels in response to energy security and environmental concerns. As the second most abundant polysaccharide in nature, hemicellulose mainly containing xylose is an important carbon source that can be used for the bioconversion to fuels and chemicals. However, the adaptation phenomena could appear and influence the bioconversion performance of xylose when Saccharomyces cerevisiae strain was transferred from the glucose to the xylose environment. Therefore, it is crucial to elucidate the mechanism of this adaptation phenomena, which can guide the strategy exploration to improve the efficiency of xylose utilization. Results In this study, xylose-utilizing strains had been constructed to effectively consume xylose. It is found that the second incubation of yYST218 strain in synthetic complete-xylose medium resulted in a 1.24-fold increase in xylose consumption ability as compared with the first incubation in synthetic complete-xylose medium. The results clearly showed that growing S. cerevisiae again in synthetic complete-xylose medium can significantly reduce the stagnation time and thus achieved a faster growth rate, by comparing the growth status of the strain in synthetic complete-xylose medium for the first and second time at the single-cell level through Microfluidic technology. Although these xylose-utilizing strains possessed different xylose metabolism pathways, they exhibited the “transient memory” phenomenon of xylose metabolism after changing the culture environment to synthetic complete-xylose medium, which named ‘xylose consumption memory (XCM)’ of S. cerevisiae in this study. According to the identification of protein acetylation, partial least squares analysis and the confirmatory test had verified that H4K5Ac affected the state of “XCM” in S. cerevisiae. Knockout of the acetylase-encoding genes GCN5 and HPA2 enhanced the “XCM” of the strain. Protein acetylation analysis suggested that xylose induced perturbation in S. cerevisiae stimulated the rapid adaptation of strains to xylose environment by regulating the level of acetylation. Conclusions All these results indicated protein acetylation modification is an important aspect that protein acetylation regulated the state of “XCM” in S. cerevisiae and thus determine the environmental adaptation of S. cerevisiae. Systematically exploiting the regulation approach of protein acetylation in S. cerevisiae could provide valuable insights into the adaptation phenomena of microorganisms in complex industrial environments.

scholarly journals Simulating Extracellular Glucose Signals Enhances Xylose Metabolism in Recombinant Saccharomyces cerevisiae

2020 ◽  
Vol 8 (1) ◽  
pp. 100 ◽  
Author(s):  
Meiling Wu ◽  
Hongxing Li ◽  
Shan Wei ◽  
Hongyu Wu ◽  
Xianwei Wu ◽  
...  
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Metabolic Networks ◽  
Glucose Sensing ◽  
Biofuel Production ◽  
Xylose Utilization ◽  
High Concentration ◽  
Xylose Metabolism ◽  
Camp Phosphodiesterase ◽  
Xylose Consumption ◽  
Recombinant Saccharomyces Cerevisiae

Efficient utilization of both glucose and xylose from lignocellulosic biomass would be economically beneficial for biofuel production. Recombinant Saccharomyces cerevisiae strains with essential genes and metabolic networks for xylose metabolism can ferment xylose; however, the efficiency of xylose fermentation is much lower than that of glucose, the preferred carbon source of yeast. Implications from our previous work suggest that activation of the glucose sensing system may benefit xylose metabolism. Here, we show that deleting cAMP phosphodiesterase genes PDE1 and PDE2 increased PKA activity of strains, and consequently, increased xylose utilization. Compared to the wild type strain, the specific xylose consumption rate (rxylose) of the pde1Δ pde2Δ mutant strains increased by 50%; the specific ethanol-producing rate (rethanol) of the strain increased by 70%. We also show that HXT1 and HXT2 transcription levels slightly increased when xylose was present. We also show that HXT1 and HXT2 transcription levels slightly increased when xylose was present. Deletion of either RGT2 or SNF3 reduced expression of HXT1 in strains cultured in 1 g L−1 xylose, which suggests that xylose can bind both Snf3 and Rgt2 and slightly alter their conformations. Deletion of SNF3 significantly weakened the expression of HXT2 in the yeast cultured in 40 g L−1 xylose, while deletion of RGT2 did not weaken expression of HXT2, suggesting that S. cerevisiae mainly depends on Snf3 to sense a high concentration of xylose (40 g L−1). Finally, we show that deletion of Rgt1, increased rxylose by 24% from that of the control. Our findings indicate how S. cerevisiae may respond to xylose and this study provides novel targets for further engineering of xylose-fermenting strains.

Segregation of altered parental properties in fusions between Saccharomyces cerevisiae and the D-xylose fermenting yeasts Candida shehatae and Pichia stipitis

1992 ◽  
Vol 38 (12) ◽  
pp. 1233-1237 ◽  
Author(s):  
Abindra S. Gupthar
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Polyethylene Glycol ◽  
Gene Transfer ◽  
Key Words ◽  
Protoplast Fusion ◽  
Ethanol Tolerance ◽  
Pichia Stipitis ◽  
Candida Shehatae ◽  
Auxotrophic Mutants ◽  
Parental Type

A prototrophic strain of Saccharomyces cerevisiae CSIR Y190 MATa xyl−, resistant to high levels of ethanol, was hybridized with xylose-fermenting, auxotrophic mutants of Candida shehatae and Pichia stipitis through polyethylene glycol-induced protoplast fusion in an attempt to produce ethanol-tolerant, xylose-fermenting hybrids. Mononucleate fusants were obtained, but these dissociated into a mixture of parental-type segregants. Purified Candida- and Pichia-resembling segregants failed to acquire improved ethanol tolerance but expressed other novel properties of S. cerevisiae, suggesting that karyogamy was impaired after internuclear gene transfer. Key words: Pichia, Candida, Saccharomyces protoplast fusion.

scholarly journals Transcription of Cell Wall Mannoproteins-1 gene in Saccharomyces cerevisiae Mutant

2018 ◽  
Vol 4 (2) ◽  
pp. 174-181
Author(s):  
Hermansyah Hermansyah
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Protein Phosphatase ◽  
Genetic Background ◽  
Wild Type Strain ◽  
Pcr Analysis ◽  
Transcriptional Level ◽  
Amino Acid Residues ◽  
Wild Type ◽  
Rt Pcr ◽  
Phosphate Groups

Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases.  The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role.  In this research, the disruption of DPPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101).  A BamHI - BamHI fragment 3,28 kb DPPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of DPPG1::CgHIS3 in FY833 and did not show 200mg/ml Calco fluor sensitivity, while another mutant DPPG1::CgHIS3 in W303-IA show 100mg/ml congo red sensitivity. Furthermore, to confirm whether DPPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR’s data showed that transcriptional level of CWP1 in DPPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly.  

Sign in / Sign up

Export Citation Format

Share Document