scholarly journals Botrytis cinerea Decay in Apples Is Inhibited by Postharvest Heat and Calcium Treatments

1997 ◽  
Vol 122 (1) ◽  
pp. 91-94 ◽  
Author(s):  
Joshua D. Klein ◽  
William S. Conway ◽  
Bruce D. Whitaker ◽  
Carl E. Sams

`Golden Delicious' apples (Malus domestica Borkh.) were treated after harvest with heat (air at 38 °C for 4 days or 42 °C for 1 day) or 2% CaCl2 (w/v; applied as a dip or pressure-infiltrated) or a combination of the two and stored at 0 °C for ≤6 months. Decay caused by Botrytis cinerea Pers.:Fr. after inoculation to a depth of 2 mm with a conidial suspension virtually was eliminated in stored fruit heated at 38 °C, regardless of Ca treatment. Apples punctured to a depth of 0.5 mm (but not 2 mm) and inoculated with B. cinerea on removal from storage were almost completely protected from poststorage decay if they had previously been pressure-infiltrated with 2% CaCl2, regardless of the heat regime. Heating fruit at 42 °C and dipping in 2% CaCl2 were only partially effective in preventing decay from either pre- or poststorage inoculations. Fruit firmness was not related to resistance to decay.

HortScience ◽  
1995 ◽  
Vol 30 (4) ◽  
pp. 815C-815
Author(s):  
Joshua D. Klein ◽  
William S. Conway ◽  
Bruce D. Whitaker ◽  
Carl E. Sams

`Golden Delicious' apples (Malus domestica Borkh.) were treated postharvest with heat (38C/4 d or 42C/24 h) or 2% CaCl2 (applied as a dip or pressure-infiltrated) or a combination thereof and then stored. Decay caused by Botrytis cinerea was virtually eliminated in fruit heated at 38C after inoculation prior to storage, regardless of Ca treatment. Apples inoculated upon removal from storage were almost completely protected from decay if they had been previously pressure-infiltrated with Ca, regardless of heat regime. Heating at 42C or Ca dips were only partially effective in preventing decay. Pressure infiltration of Ca (regardless of heat regime) or heating at 38C (regardless of Ca treatment) resulted in firmer fruit (68 N) than Ca dips or heating at 42C (56 N), which were firmer than nontreated fruit (52 N).


2014 ◽  
Vol 63 (2) ◽  
pp. 315-328
Author(s):  
Anita Szabó ◽  
Ádám Csihon ◽  
Andrea Balla-Kovács ◽  
István Gonda ◽  
Imre Vágó

Ökológiai termesztésű almaültetvényben eltérő komposztadagok (0, 10, 25 és 50 kg N·ha−1) hatását vizsgáltuk a talaj tápelemtartalmának változására (0–30 és 30–60 cm-es mélységben). Mértük az egyes almafajták (Golden Delicious és Pinova) levelének szárazanyag- és Ca-tartalmát, továbbá vizsgáltuk e paraméterek alakulásának egymáshoz való viszonyát.A szabadföldi kísérletet a Debreceni Egyetem Kertészettudományi Intézetének Pallagi Kísérleti Telepén, a talaj- és növényminták analízisét az Agrokémiai és Talajtani Intézet laboratóriumaiban végeztük.A 2011. és 2012. évi eredményeket összevetve lényeges csökkenés mutatkozott a talaj AL-oldható P-tartalmában. Az évek múlásával jelentősen nőtt azonban a talajban a nitrát-, ammónia-, szerves-N és CaCl2-Mg tartalom a kijuttatott komposztadagok hatására. Az AL-K, -Ca, -Mg, a CaCl2-P, -K mennyisége és a pH közel azonosnak mondható.Az első kísérleti évben (2010-ben) még nem volt hatása a komposztnak. 2011-ben már észleltünk hatást, de a fagykár miatt nem volt termés a fákon. 2012-ben a nagy termésterhelés mellett is növekedést tapasztaltunk a szárazanyag-tartalom alakulásában mind a Golden Delicious, mind a Pinova fajták esetében. Adott kezeléseken belül az eltérő termésmennyiségekkel, továbbá az évjárattal összefüggő tendenciákat fedeztünk fel. A rendkívül csapadékos évben (2010) alacsony, míg az aszályos évben (2012) nagy szárazanyag-tartalom értékeket mértünk a levélben. A Golden Delicious és a Pinova esetében kapott tendencia fajtától, kezelés- és termesztés-technológiától függetlenül hasonló.A komposzt hatására 2010-ben a Golden Delicious leveleiben kismértékű, a Pinova leveleiben szignifikáns Ca-tartalombeli növekedést mértünk. Az évjárat hatásáról elmondható, hogy csapadékos évben a szakirodalmi adatoknál magasabb, míg száraz, terméshiányos évben alacsonyabb Ca-tartalommal számolhattunk. Bár a Ca-szintek alakulása tendenciájában megegyezett a két almafajta esetében, mégis megállapítható, hogy a Pinova leveleinek elemtartalma nagyobb volt, mint a Golden Delicious fáké.A levelek szárazanyag-tartalma és Ca-tartalma között fordított arányosságot bizonyítottunk.


Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.


1997 ◽  
Vol 122 (3) ◽  
pp. 386-391 ◽  
Author(s):  
Robert A. Saftner ◽  
J. George Buta ◽  
William S. Conway ◽  
Carl E. Sams

The effects of 36 organosilicone and conventional carbon-based surfactants on postharvest infiltration of radiolabeled and unlabeled Ca solutions into `Golden Delicious' apples (Malus domestica Borkh) were examined to devise a more efficient pressure infiltration technique to increase fruit Ca concentration. Radiolabeled Ca infiltration and the proportional increase in fruit Ca estimated by fruit weight gain from Ca solutions of known concentration were significantly enhanced by a range of surfactants having different chemical structures. Tween 60 and 80; Triton X-45, X-100, X-114, X-305, and X-405; and Silwet L-77 and L-7604 enhanced Ca infiltration. The two organosilicone surfactants, Silwet L-77 and Silwet L-7604, known for their greater capacity to lower the surface tension of solutions than conventional carbon-based surfactants, were the most effective at augmenting Ca infiltration. Applications of surfactants to fruit were as or more effective when used as a pretreatment rather than mixing the surfactant with the Ca solutions. The pressure necessary to increase Ca to levels considered sufficient to maintain fruit firmness and resist decay during storage could be lowered in fruit treated with organosilicone surfactants. Sequential postharvest surfactant and Ca treatments may be a practical means of increasing the Ca concentration in apples.


Plant Disease ◽  
2021 ◽  
Author(s):  
Jun Guo ◽  
Jin Chen ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.


2019 ◽  
Vol 100 (6) ◽  
pp. 1176-1192 ◽  
Author(s):  
Deepa Teotia ◽  
Mariam Gaid ◽  
Shashank S. Saini ◽  
Aparna Verma ◽  
Ragothaman M. Yennamalli ◽  
...  

2010 ◽  
Vol 50 (2) ◽  
pp. 233-237 ◽  
Author(s):  
Leszek Orlikowski ◽  
Magdalena Pļaszek ◽  
Adam Wojdyļa ◽  
Czesļaw Skrzypczak

First Notice ofPhytophthoraAerial Blight and Crown Rot on Pansies in PolandPhytophthora cactorumwas detected on &9/10; of pansies showing yellowing of leaves and crown rot symptoms and constituted about 90% of isolates obtained.Botrytis cinerea, Fusarium avenaceum, F. solaniandPythium ultimumwere also isolated from diseased tissues. Using rhododendron leaves as the bait,P. cactorumwas detected in pansy substratum as well as from soil under the mata. Isolates obtained from diseased plants, substratum and soil under mata colonized leaves, stem parts and roots of pansy. Necroses spread faster on organs inoculated with cultures from plants and substratum. Among 25 cultivars inoculated withP. cactorum, disease symptoms did not occur on 3 of them, whereas the fastest spread of necrotic spots (3.8 mm/24 hrs) was noticed on 3 cultivars. Isolates ofP. cactorumfromBegonia semperflorensandMalus domesticacolonized leaf petioles of pansy with significantly faster spread when isolates from begonia and pansy were used for inoculation.


Sign in / Sign up

Export Citation Format

Share Document