scholarly journals Enhanced Age-Related Resistance to Tomato Yellow Leaf Curl Virus in Tomato Is Associated With Higher Basal Resistance

2021 ◽  
Vol 12 ◽  
Author(s):  
Jing-Ru Zhang ◽  
Shu-Sheng Liu ◽  
Li-Long Pan
Keyword(s):  
Plant Pathogens ◽  
Plant Biomass ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Basal Resistance ◽  
Age Related ◽  
Tomato Cultivars ◽  
Developmental Resistance ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is one of the most notorious plant pathogens affecting the production of tomato worldwide. While the occurrence of age-related resistance (ARR) against TYLCV has been reported, the factors impacting its development remain unknown. We conducted a series of experiments with three tomato cultivars that vary in basal resistance to TYLCV to explore factors involved in the development of ARR. Our data indicate that ARR is more pronounced in tomato cultivars with higher basal resistance. Additionally, increased plant biomass in older plants does not contribute to ARR. Virus source plants with a younger age at initial inoculation facilitates virus acquisition by whiteflies. Finally, an analysis on plant hormones suggests that salicylic acid (SA) may play a major role in the development of ARR in tomato against TYLCV. These findings provide new insights into the developmental resistance in tomato against TYLCV as well as clues for the deployment of ARR in the management of diseases caused by TYLCV.

Variation of the chemical composition of tomato cultivars (Lycopersicon esculentumMill.) according to resistance against the tomato yellow leaf curl virus (TYLCV)

2008 ◽  
Vol 88 (11) ◽  
pp. 1882-1891 ◽  
Author(s):  
Marcos Hernández Suárez ◽  
Jordi Rull Pallarés ◽  
Domingo Ríos Mesa ◽  
Elena Rodríguez Rodríguez ◽  
Carlos Díaz Romero
Keyword(s):  
Chemical Composition ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Cultivars ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Resistance Evaluation of Commmercial Tomato Cultivars against Tomato yellow leaf curl virus

2016 ◽  
Vol 22 (4) ◽  
pp. 297-302
Author(s):  
Sug-Ju Ko ◽  
Hyo-Jeong Kim ◽  
Jin-Hee Lee ◽  
Kyung-Cheol Ma ◽  
Duck-Soo Choi ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Resistance Evaluation ◽  
Tomato Cultivars ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Comparison of Resistance Level to Tomato Yellow Leaf Curl Virus Among Commercial Cultivars and Breeding Lines

Plant Disease ◽  
1997 ◽  
Vol 81 (12) ◽  
pp. 1425-1428 ◽  
Author(s):  
Moshe Lapidot ◽  
Michael Friedmann ◽  
Oded Lachman ◽  
Avidan Yehezkel ◽  
Saadia Nahon ◽  
...  
Keyword(s):  
Yield Loss ◽  
Recovery Period ◽  
Total Yield ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Viral Dna ◽  
Breeding Lines ◽  
Tomato Cultivars ◽  
Leaf Curl Virus ◽  
Leaf Curl

The effect of tomato yellow leaf curl virus (TYLCV) on total yield and yield components of various resistant F1 tomato cultivars and new breeding lines was evaluated in the field. Seeds of the F1 hybrids 8484, 3761, Fiona, and Tyking and the new breeding lines TY172 and TY197 were sown in an insect-proof greenhouse. When the seedlings reached the first-leaf stage, they were inoculated with TYLCV by means of the whitefly vector Bemisia tabaci. Noninoculated plants of the same cultivar or line which were exposed to nonviruliferous whiteflies served as controls. After a short recovery period, the plants were transplanted to the field. The inoculated plants of each cultivar or line were compared with their respective control, noninoculated plants, in terms of total yield, average fruit weight and number, and plant fresh weight. Disease symptom development and virus accumulation in the inoculated plants were monitored. There were substantial differences among the different entries tested in the extent of yield loss relative to the corresponding noninoculated control plants as well as viral DNA accumulation levels. Plants of TY172 and TY197 suffered the least relative yield loss and contained the lowest level of viral DNA. Therefore, these two lines exhibited the highest level of resistance. These results clearly demonstrate the ability of the various resistant tomato cultivars and lines to inhibit the effects of the virus, even following inoculation at a very early stage of plant development.

Integrated Management of Tomato Yellow Leaf Curl Virus and its Whitefly Vector in Tomato

2019 ◽  
Vol 112 (4) ◽  
pp. 1526-1540 ◽  
Author(s):  
David G Riley ◽  
Rajagopalbabu Srinivasan
Keyword(s):  
Symptom Severity ◽  
Virus Disease ◽  
Disease Incidence ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Virus Family ◽  
Tomato Yield ◽  
Tomato Cultivars ◽  
Leaf Curl Virus ◽  
Leaf Curl

AbstractWhitefly-transmitted Tomato yellow leaf curl virus (Family Geminiviridae; Genus Begomovirus) severely restricts tomato production in the Southeastern United States. Whitefly and tomato yellow leaf curl virus management studies typically investigate control tactics individually, but successful management of this pest complex more often relies on a combination of tactics. This study examined the individual and combined effects of tomato yellow leaf curl virus-resistant cultivars, insecticides, and metallic reflective mulch on whiteflies, tomato yellow leaf curl virus disease incidence, and marketable tomato yields using split-split plot trials over 3 yr. Reflective mulch significantly reduced whitefly adults and nymphs and tomato yellow leaf curl virus symptom severity in all 3 yr of the study. Reflective mulch treatments also provided greater marketable tomato yield in 2 out of 3 yr. Imidacloprid and cyantraniliprole treatments reduced whitefly adults and nymphs’ establishment and marginally increased yields, but there was no significant insecticide effect on tomato yellow leaf curl virus incidence/symptom severity compared with the non-treated check. Virus-resistant tomato cultivars did not influence whitefly populations, but provided consistent reduction in virus disease incidence. Interactions between host plant resistance and insecticide treatments ranged from strongly additive in the standard white plastic mulch treatment to only marginally additive in the reflective mulch treatments in terms of enhancing tomato yields. tomato yellow leaf curl virus-resistant tomato cultivars and reflective mulch provided the bulk of the protection against tomato yellow leaf curl virus disease incidence. However, it was the combination of all the best tactics (reflective mulch, cyantraniliprole, ‘Security’ hyb. tomato yellow leaf curl virus-resistant) that provided the maximum increase in marketable tomato yield (2.8-fold) over the least effective combination (white mulch, no whitefly insecticide, ‘FL47’ hyb. tomato yellow leaf curl virus-susceptible).

scholarly journals A New Tomato yellow leaf curl virus Strain in Southern Spain

Plant Disease ◽  
2003 ◽  
Vol 87 (8) ◽  
pp. 1004-1004 ◽  
Author(s):  
G. Morilla ◽  
C. Antúnez ◽  
E. R. Bejarano ◽  
D. Janssen ◽  
I. M. Cuadrado
Keyword(s):  
Restriction Pattern ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Polymorphism Analysis ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Tomato Cultivars ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl disease (TYLCD) has affected tomato crops annually in southern Spain since 1992 when Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) was first described. In 1997, the presence of a different begomovirus species (TYLCV-[ES7297]) was reported in common bean (Phaseolus vulgaris). In 1999, TYLCV-[ES7297] was found in pepper (Capsicum annuum) (2). In September 2002, we observed tomato plants of TYLCD tolerant tomato cultivars (Kampala and Tiway) showing strong TYLCD symptoms (shortened internodes, curling of leaflet margins, and leaf blade reduction). Samples from 90 of these plants were collected from greenhouses located in the Province of Murcia and analyzed by Southern blot using the intergenic region of TYLCSV-ES[2] and TYLCV-[ES7297] as specific probes. Positive signals were obtained for TYLCV-[ES7297] and TYLCSV-ES[2] in 88 and 23 of the plants, respectively. Samples from eight TYLCV single-infected plants (four ‘Kampala’ and four ‘Tiway’) were analyzed by polymerase chain reaction using a pair of primers (OTYA7: GCTCCCTGAATGTTCGGATGGA and OTYA8: ATCATGGATTT ACGCACAGGGG) designed to amplify a 1.9-kb fragment of any isolate of TYLCV/TYLCSV. Subsequent restriction fragment length polymorphism analysis of the amplification products yielded a restriction pattern different from that obtained for TYLCV-[ES7297]. Fragments from the eight samples were sequenced and showed 97.9% identity to a TYLCV strain previously reported in Israel (X15656) (1) and only 92.7% identify with TYLCV-[ES7297]. To our knowledge, this is the first report that this strain of TYLCV has been detected in Spain. References: (1) N. Navot et al. Virology 185(1), 151, 1991. (2) J. Reina et al. Plant Dis. 83:1176, 1999.

Control of the Bemisia tabaci/Tomato yellow leaf curl virus complex on protected tomato crops in Algarve (Portugal)*

EPPO Bulletin ◽  
2002 ◽  
Vol 32 (1) ◽  
pp. 31-35
Author(s):  
A. F. Arsenio ◽  
E. Neto ◽  
N. Ramos ◽  
S. Mangerico ◽  
E. Fortunato ◽  
...  
Keyword(s):  
Bemisia Tabaci ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Virus Complex ◽  
Leaf Curl Virus ◽  
Leaf Curl

Study of a collection of tomato hybrids with genetic resistance to the yellow leaf curl virus in Southern Russia

2020 ◽  
pp. 30-34
Author(s):  
С.Ф. Гавриш ◽  
Т.А. Редичкина ◽  
А.В. Буц ◽  
Г.М. Артемьева
Keyword(s):  
Resistance Genes ◽  
Molecular Genetic Analysis ◽  
Tomato Yellow Leaf ◽  
Tomato Mosaic Virus ◽  
Average Weight ◽  
Yellow Leaf ◽  
The South ◽  
Economically Valuable Traits ◽  
Leaf Curl Virus ◽  
Leaf Curl

Дана информация об изучении коллекции гибридов F1томата (Solanum lycopersicum L.) зарубежной селекции различных фирм-оригинаторов, рекомендованных производителями семян как толерантные к вирусу желтой курчавости листьев томата. Все гибриды обладали комплексом хозяйственно ценных признаков и набором генов устойчивости к основным заболеваниям томата, в том числе к новому для юга России опасному патогену с максимальным потенциальным риском – вирусу желтой курчавости листьев томата (Tomato yellow leaf curl virus — TYLCV). Исследования проведены в 2017-2018 годах в лаборатории пасленовых культур ООО «НИИСОК» и в лаборатории молекулярной диагностики растений ООО «Семеновод». Всего было протестировано 34 гибрида F1 томата. Гибриды оценивали по совокупности хозяйственно ценных признаков, также проводили молекулярно-генетический анализ на наличие и аллельное состояние основных генов устойчивости: к вирусу табачной мозаики (Tm2а), фузариозному увяданию (I2), вертициллезному увяданию (Ve), к кладоспориозу (Cf9), нематодам (Mi1.2), вирусу бронзовости томата (Sw5), вирусу желтой курчавости листьев томата (Ty3a). Установлено, что все проанализированные гибриды томата с заявленной оригинаторами семян устойчивостью к вирусу желтой курчавости листьев были гетерозиготны по гену Ty3a. На основании проведенных исследований и с учетом требований рынка разработаны модели гибридов F1 томата юга России. Перспективный гибрид томата должен обладать индетерминантным типом роста с укороченными междоузлиями (4,5-5 см) а также хорошей облиственностью. Плоды томата должны быть с красной равномерной окраской без зеленого пятна у плодоножки, с плоскоокруглой или округлой формой плода и со средней массой 220-270 г. Для повышения транспортабельности томатов необходимо, чтобы плоды отличались высокой прочностью и характеризовались хорошей лежкостью. Урожайность гибрида томата должна быть более 30 кг/м2, а товарность - не менее 85%. Гибрид томата должен обладать следующим набором генов устойчивости в гетерозиготном состоянии: Ty3a, Mi1.2, Cf-9, а также в гомозиготном состоянии: Tm2a, I2, Ve. The article provides information on the study of the collection of F1 tomato hybrids (Solanum lycopersicumL.) of foreign breeding from various firms-originators recommended for cultivation in regions with a strong spread of tomato yellow leaf curl virus. All hybrids had a complex of economically valuable traits and a set of genes for resistance to the main diseases of tomato, including a new dangerous pathogen for the South of Russia with a maximum potential risk — the tomato yellow leaf curl virus (TYLCV). The studies were carried out in 2017-2018 in the Solanaceae Laboratory of LLC NIISOK and in the Molecular Diagnostics Laboratory of Plants of LLC Semenovod. A total of 34 F1 tomato hybrids were tested. The hybrids were assessed by a set of economically valuable traits. Molecular genetic analysis was also carried out for the presence and allelic state of the main resistance genes: Tomato mosaic virus (Tm2a), Fusarium wilt (I2), Werticillium wilt (Ve), Cladosporium fulvum (Cf9), Nematodes (Mi1.2), Tomato spotted wilt virus (Sw5), Tomato yellow leaf curl virus (Ty3a). It was found that all the analyzed tomato hybrids with the declared by seed originators resistance to yellow leaf curl virus were heterozygous for the Ty3a gene. Based on the conducted research and taking into account the market requirements, models of F1 tomato hybrids for protected ground for the South of Russia have been developed. A promising tomato hybrid should have an indeterminate growth type with shortened internodes (4.5-5 cm) and good foliage. Tomato fruits should have a uniform red color without green shoulders, with a flat-round or round shape of the fruit and with an average weight of 220-270 g. To increase the transportability of tomatoes, it is necessary that the fruits are highly firm and characterized by good shelf life. The yield of tomato hybrid should be more than 30 kg/m2, and marketability should be at least 85%. The tomato hybrid should have the following set of resistance genes in a heterozygous state: Ty3a, Mi1.2, Cf-9, and also in a homozygous state: Tm2a, I2, Ve.

Sign in / Sign up

Export Citation Format

Share Document