Characterization of a Novel Emaravirus Affecting Ash Species (Fraxinus spp.) in Europe

We identified a novel virus in diseased European ash (Fraxinus excelsior) and manna ash (F. ornus) trees exhibiting chlorotic ringspots, mottle and leaf deformation such as curling and shoestring symptoms. High-throughput sequencing (HTS, Illumina RNASeq) of total RNA isolated from diseased leaf material in combination with RT-PCR-based amplification techniques and Sanger sequencing determined five complete genome segments, each encoding a single open reading frame. Sequence analyses of RNA1–RNA5 revealed a genome organization typical for emaraviruses, i.e., (i) conserved and complementary terminal 5′and 3′termini of each genome segment (ii) proteins showing significant homologies to the RNA-dependent RNA polymerase (RdRP) encoded by RNA1, the glycoprotein precursor (GPP) encoded by RNA2, the viral nucleocapsid protein (N, RNA3), the movement protein (MP, RNA4), and a protein of 26 kDA (P26, RNA5) highly similar to proteins of unknown function encoded by other emaraviruses. Furthermore, we identified spherical particles (double-membrane bodies, DMB) of different sizes (70–80 nm in diameter) which are typical for emaraviruses exclusively in virus-infected leaf tissue exhibiting mottle and leaf deformation. Sequence comparison and phylogenetic analyses confirmed the identified novel virus as a new member of the genus Emaravirus. We established a species-specific RT-PCR detection protocol and could associate the observed disease symptoms with the infection of the novel emaravirus in F. excelsior and F. ornus. Therefore, we propose the name ash shoestring-associated emaravirus (ASaV). Investigation of ASaV-infected sample trees originating from different locations in Switzerland, Germany, Italy and Sweden provided a wide geographical distribution of the virus in affected ash species. To our knowledge, this is the first confirmation of an emaravirus affecting ash tree species with shoestring symptoms of leaves in Europe.

Download Full-text

A Virus Infecting Hibiscus rosa-sinensis Represents an Evolutionary Link Between Cileviruses and Higreviruses

Frontiers in Microbiology ◽

10.3389/fmicb.2021.660237 ◽

2021 ◽

Vol 12 ◽

Author(s):

Alejandro Olmedo-Velarde ◽

John Hu ◽

Michael J. Melzer

Keyword(s):

Phylogenetic Analyses ◽

Leaf Tissue ◽

Spherical Particles ◽

Infected Leaf ◽

Spot Virus ◽

Reading Frame ◽

Reverse Transcription Pcr ◽

Foliar Symptoms ◽

Landscape Plants ◽

Infected Leaf Tissue

Hibiscus (Hibiscus spp.) are popular ornamental and landscape plants in Hawaii which are susceptible to foliar diseases caused by viruses belonging to the genera Cilevirus and Higrevirus (family Kitaviridae). In this study, a virus infecting H. rosa-sinensis plants displaying foliar symptoms consistent with infection by a kitavirus, including yellow chlorotic blotches with a green perimeter, was characterized. The genome consisted of two RNAs 8.4 and 4.4 kb in length, and was organized most similarly to cileviruses, but with important distinctions. These included the location of the p29 homolog as the 3′-terminal open reading frame (ORF) of RNA2 instead of its typical locus at the 3′-end of RNA1; the absence of a p15 homolog on RNA2 and the adjacent intergenic region which also harbors small putative ORFs of unknown function; and the presence of an ORF encoding a 10 kDa protein at the 3′-terminal end of RNA1 that was also found to be present in the hibiscus green spot virus 2 genome. Spherical particles approximately 55–65 nm in diameter were observed in infected leaf tissue, and viral RNA was detected by reverse-transcription PCR in individual mites collected from symptomatic plants tentatively identified as Brevipalpus yothersi. Although phylogenetic analyses placed this virus between the higrevirus and cilevirus clades, we propose the tentative taxonomic placement of this virus, designated hibiscus yellow blotch virus (HYBV), within the genus Cilevirus.

Download Full-text

Identification of an Emaravirus in a Common Oak (Quercus robur L.) Conservation Seed Orchard in Germany: Implications for Oak Health

Forests ◽

10.3390/f11111174 ◽

2020 ◽

Vol 11 (11) ◽

pp. 1174 ◽

Cited By ~ 1

Author(s):

Martina Bandte ◽

Marius Rehanek ◽

Bertram Leder ◽

Susanne von Bargen ◽

Carmen Büttner

Keyword(s):

High Throughput Sequencing ◽

Leaf Tissue ◽

Seed Orchard ◽

Clear Correlation ◽

The Novel ◽

Rt Pcr ◽

Oak Trees ◽

Symptomatic Leaf ◽

Novel Virus ◽

Pcr Targeting

We observed the health status of oak trees in a conservation seed orchard for over twenty years, focusing on characteristic virus-suspected symptoms. The orchard was established in 1992 in Kreuztal, North Rhine-Westphalia (Germany) with 1302 seedlings in 186 clusters. The number of seedlings showing chlorotic ringspots and mottle on leaves has fluctuated annually, but has increased from 3.3% to 12.1% in the last 20 years; the number of affected clusters has risen from 8% to 25.9%. A scientific breakthrough was the identification of a novel virus related to members of the genus Emaravirus in diseased oak by high-throughput sequencing (HTS). Screening of the oak seedlings in three consecutive years, using a newly established virus-specific diagnostic reverse transcription polymerase chain reaction (RT-PCR), confirmed the virus infection and revealed a close to 100% association between the observed leaf symptoms and the novel virus. As no other plant virus could be identified in the HTS-datasets, we assume the novel virus is primarily causing the symptoms. To reliably detect the novel virus in oaks, RT-PCR targeting the viral RNA3 or RNA4 should be applied in routine testing of symptomatic leaf tissue. It was obvious that most groups with virus-infected plants cluster, with only five out of the 42 affected groups being offside, not bordering on other affected groups of plants. There was no clear correlation between the detection of the virus and the overall vitality of the seedlings. There was no relation between seedling performance and presence or absence of viral infection. Forecasts on the future growth behavior of these virus-infected oak trees are therefore not possible.

Download Full-text

Identification and Characterization of a Pear Chlorotic Leaf Spot-Associated Virus, a Novel Emaravirus Associated with a Severe Disease of Pear Trees in China

Plant Disease ◽

10.1094/pdis-01-20-0040-re ◽

2020 ◽

Vol 104 (11) ◽

pp. 2786-2798 ◽

Cited By ~ 3

Author(s):

Huazhen Liu ◽

Guoping Wang ◽

Zuokun Yang ◽

Yanxiang Wang ◽

Zhe Zhang ◽

...

Keyword(s):

Leaf Spot ◽

High Throughput Sequencing ◽

Southern China ◽

Pyrus Pyrifolia ◽

Rt Pcr ◽

Molecular Features ◽

A Genome ◽

Close Phylogenetic Relationship ◽

Chlorotic Leaf ◽

Pear Trees

Pear chlorotic leaf spot (PCLS) is a recently emerged disease of commercially cultivated sandy pear (Pyrus pyrifolia) trees in central and southern China. By integrating high-throughput sequencing and conventional Sanger sequencing of reverse-transcription (RT)-PCR products, a novel emaravirus infecting pear trees was identified and molecularly characterized. The virus was provisionally named pear chlorotic leaf spot-associated virus (PCLSaV). PCLSaV shows the typical molecular features of members of the genus Emaravirus in the family Fimoviridae. It has a genome composed of at least five negative-sense RNA segments, with each containing a single open reading frame and two complementary 13-nucleotide stretches at the 5′ and 3′ termini. PCLSaV shows a close phylogenetic relationship with recognized emaraviruses but forms a separate clade. Moreover, double-membrane-bound bodies were observed in PCLSaV-infected tissues and in extracts of PCLSaV-infected leaves. For the first time, our study revealed the profile distribution of viral RNA reads from the RNA-seq libraries of three samples along the RNA1 to RNA5 of an emaravirus. Field surveys combined with specific RT-PCR assays revealed the presence of PCLSaV in almost all PCLS-diseased pear samples, strongly supporting the association of the virus with the PCLS disease. This study revealed the first emaravirus infecting pear trees and its association with a severe pear chlorotic leaf disease.

Download Full-text

First Report of Iris yellow spot virus in Onion in Hawaii

Plant Disease ◽

10.1094/pdis-07-10-0531 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1508-1508 ◽

Cited By ~ 4

Author(s):

D. M. Sether ◽

W. B. Borth ◽

R. S. Shimabuku ◽

H. R. Pappu ◽

M. J. Melzer ◽

...

Keyword(s):

United States ◽

New Zealand ◽

Phylogenetic Analyses ◽

Leaf Tissue ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Sequence Variants ◽

Rt Pcr ◽

Spot Virus

Onion (Allium spp.) production in Hawaii is mostly comprised of green onion and the locally prized sweet bulb onions (Allium cepa L.) that include short- and medium-day cultivars. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to bulb and seed onion production in many onion-growing regions of the continental United States and the world (3). In June 2010, straw-colored, diamond-shaped lesions with occasional green islands were observed on leaves of sweet onion ‘Linda Vista’ in an insecticide trial on Maui for onion thrips (Thrips tabaci) control. Collapse and lodging occurred when lesions on leaves were severe. Seven bulbs with green leaves exhibiting lesions were collected from this onion field in the Pulehu Region of the lower Kula District on Maui. Leaf samples that included a lesion or were within 1 cm of a lesion were found to be positive in indirect ELISA with IYSV-specific polyclonal antisera (2). A405nm readings after 1 h ranged from 0.263 to 2.067 for positive samples and 0.055 to 0.073 for healthy onion controls. Four samples that were prepared from leaf tissue several centimeters away from a lesion tested negative in ELISA. Such uneven virus distribution in the plants has been previously reported (4). In July 2010, symptomatic sweet onion from a commercial farm in upper Kula, Maui at the 1,060 to 1,220 m (3,500 to 4,000 foot) elevation tested positive for IYSV by ELISA. Green onion samples collected from a commercial farm in Omaopio, Maui, located approximately 0.8 km (0.5 mile) north of Pulehu, have tested negative, suggesting distribution may be limited at this time. RNA was isolated from leaf tissue from the seven ‘Linda Vista’ sweet onions collected from the Maui insecticide trial. Reverse transcription (RT)-PCR with forward and complementary primers 5′-CTCTTAAACACATTTAACAAGCAC-3′ and 5′-TAAAACAAACATTCAAACAA-3′ flanking the nucleocapsid (N) gene encoded by the small RNA of IYSV was conducted as previously described (1). Amplicons approximately 1.1 kb long were obtained from all seven symptomatic onion samples but not from healthy samples or water controls. Sequencing of selected amplicons confirmed IYSV infection. Three sequence variants (GenBank Accession Nos. HM776014–HM776016) were identified from two RT-PCR reactions. Phylogenetic analyses of the three sequence variants with the neighbor-joining procedure available through NCBI-BLASTn Tree View showed that the highest nucleotide identities of 97 to 98% were shared with IYSV isolates from New Zealand (EU477515), Nevada (FJ713699), and northern California (FJ713700). Phylogenetic analyses with the N-gene showed the sequences from Hawaii are most closely related to isolates from the western United States, Texas, and New Zealand. To date, to our knowledge, IYSV has not been detected on the islands of Kauai, Oahu, Molokai, or Hawaii. The distribution and economic consequences of this disease to Hawaii's onion production are under investigation. References: (1) H. R. Pappu et al. Arch Virol. 151:1015, 2006. (2) H. R. Pappu et al. Plant Dis. 92:588, 2008. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

Download Full-text

Identification of a Novel Hepacivirus in Domestic Cattle from Germany

Journal of Virology ◽

10.1128/jvi.00534-15 ◽

2015 ◽

Vol 89 (14) ◽

pp. 7007-7015 ◽

Cited By ~ 63

Author(s):

Christine Baechlein ◽

Nicole Fischer ◽

Adam Grundhoff ◽

Malik Alawi ◽

Daniela Indenbirken ◽

...

Keyword(s):

High Throughput Sequencing ◽

De Novo ◽

Dairy Herd ◽

Herd Size ◽

Rt Pcr ◽

Emerging Pathogens ◽

Content Type ◽

Zoonotic Infections ◽

Novel Virus ◽

Cattle Herds

ABSTRACTHepatitis C virus (HCV) continues to represent one of the most significant threats to human health. In recent years, HCV-related sequences have been found in bats, rodents, horses, and dogs, indicating a widespread distribution of hepaciviruses among animals. By applying unbiased high-throughput sequencing, a novel virus of the genusHepaciviruswas discovered in a bovine serum sample.De novoassembly yielded a nearly full-length genome coding for a polyprotein of 2,779 amino acids. Phylogenetic analysis confirmed that the virus represents a novel species within the genusHepacivirus. Viral RNA screening determined that 1.6% (n =5) of 320 individual animals and 3.2% (n =5) of 158 investigated cattle herds in Germany were positive for bovine hepacivirus. Repeated reverse transcription-PCR (RT-PCR) analyses of animals from one dairy herd proved that a substantial percentage of cows were infected, with some of them being viremic for over 6 months. Clinical and postmortem examination revealed no signs of disease, including liver damage. Interestingly, quantitative RT-PCR from different organs and tissues, together with the presence of an miR-122 binding site in the viral genome, strongly suggests a liver tropism for bovine hepacivirus, making this novel virus a promising animal model for HCV infections in humans.IMPORTANCELivestock animals act as important sources for emerging pathogens. In particular, their large herd size and the existence of multiple ways of direct and food-borne infection routes emphasize their role as virus reservoirs. Apart from the search for novel viruses, detailed characterization of these pathogens is indispensable in the context of risk analysis. Here, we describe the identification of a novel HCV-like virus in cattle. In addition, determination of the prevalence and of the course of infection in cattle herds provides valuable insights into the biology of this novel virus. The results presented here form a basis for future studies targeting viral pathogenesis of bovine hepaciviruses and their potential to establish zoonotic infections.

Download Full-text

A novel emaravirus comprising five RNA segments is associated with ringspot disease in oak

Archives of Virology ◽

10.1007/s00705-021-04955-w ◽

2021 ◽

Vol 166 (3) ◽

pp. 987-990

Author(s):

Marius Rehanek ◽

Susanne von Bargen ◽

Martina Bandte ◽

David G. Karlin ◽

Carmen Büttner

Keyword(s):

High Throughput Sequencing ◽

Bioinformatic Analysis ◽

High Plains ◽

Rt Pcr ◽

Viral Origin ◽

Complete Sequences ◽

Novel Virus ◽

Rapid Amplification ◽

Full Length Genome ◽

Common Oak

AbstractWe report the complete nucleotide sequence of the genome of a novel virus in ringspot-diseased common oak (Quercus robur L.). The newly identified pathogen is associated with leaf symptoms such as mottle, chlorotic spots and ringspots on diseased trees. High-throughput sequencing (HTS, Illumina RNASeq) was used to explore the virome of a ringspot-diseased oak that had chlorotic ringspots of suspected viral origin on leaves for several years. Bioinformatic analysis of the HTS dataset followed by RT-PCR enabled us to determine complete sequences of four RNA genome segments of a novel virus. These sequences showed high similarity to members of the genus Emaravirus, which includes segmented negative-stranded RNA viruses of economic importance. To verify the ends of each RNA, we conducted rapid amplification of cDNA ends (RACE). We identified an additional genome segment (RNA 5) by RT-PCR using a genus-specific primer (PDAP213) to the conserved 3´ and 5´termini in order to amplify full-length genome segments. RNA 5 encodes a 21-kDa protein that is homologous to the silencing suppressor P8 of High Plains wheat mosaic virus. The five viral RNAs were consistently detected by RT-PCR in ringspot-diseased oaks in Germany, Sweden, and Norway. We conclude that the virus represents a new member of the genus Emaravirus affecting oaks in Germany and in Scandinavia, and we propose the name “common oak ringspot-associated emaravirus” (CORaV).

Download Full-text

A Novel Virus of the Genus Cilevirus Causing Symptoms Similar to Citrus Leprosis

Phytopathology ◽

10.1094/phyto-07-12-0177-r ◽

2013 ◽

Vol 103 (5) ◽

pp. 488-500 ◽

Cited By ~ 49

Author(s):

Avijit Roy ◽

Nandlal Choudhary ◽

Leon M. Guillermo ◽

Jonathan Shao ◽

Ananthakrishnan Govindarajulu ◽

...

Keyword(s):

Rna Virus ◽

Phylogenetic Analyses ◽

Pcr Primers ◽

Diagnostic Methods ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Causal Organism ◽

Putative Coat Protein ◽

Citrus Leprosis ◽

Novel Virus

Citrus leprosis in Colombia was previously shown to be caused by cytoplasmic Citrus leprosis virus (CiLV-C). In 2011, enzyme-linked immunosorbent assay and reverse-transcription polymerase chain reaction (RT-PCR)-based diagnostic methods failed to identify CiLV-C from citrus samples with symptoms similar to citrus leprosis; however, virions similar to CiLV-C were observed in the cytoplasm of the symptomatic leaves by transmission electron microscopy. Furthermore, the causal organism was transmitted by the false spider mite, Brevipalpus phoenicis, to healthy citrus seedlings. A library of small RNAs was constructed from symptomatic leaves and used as the template for Illumina high-throughput parallel sequencing. The complete genome sequence and structure of a new bipartite RNA virus was determined. RNA1 (8,717 nucleotides [nt]) contained two open reading frames (ORFs). ORF1 encoded the replication module, consisting of five domains: namely, methyltransferase (MTR), cysteine protease-like, FtsJ-MTR, helicase (Hel), and RNA-dependent RNA polymerase (RdRp); whereas ORF2 encoded the putative coat protein. RNA2 (4,989 nt) contained five ORFs that encode the movement protein (MP) and four hypothetical proteins (p7, p15, p24, and p61). The structure of this virus genome resembled that of CiLV-C except that it contained a long 3′ untranslated terminal region and an extra ORF (p7) in RNA2. Both the RNA1 and RNA2 of the new virus had only 58 and 50% nucleotide identities, respectively, with known CiLV-C sequences and, thus, it appears to be a novel virus infecting citrus. Phylogenetic analyses of the MTR, Hel, RdRp, and MP domains also indicated that the new virus was closely related to CiLV-C. We suggest that the virus be called Citrus leprosis virus cytoplasmic type 2 (CiLV-C2) and it should be unambiguously classified as a definitive member of the genus Cilevirus. A pair of CiLV-C2 genome-specific RT-PCR primers was designed and validated to detect its presence in citrus leprosis samples collected from the Casanare and Meta states in Colombia.

Download Full-text

First report of black currant-associated rhabdovirus in blackcurrants in Latvia

Plant Disease ◽

10.1094/pdis-06-21-1288-pdn ◽

2021 ◽

Author(s):

Nikita Zrelovs ◽

Gunta Resevica ◽

Ieva Kalnciema ◽

Helvijs Niedra ◽

Gunārs Lācis ◽

...

Keyword(s):

High Throughput Sequencing ◽

Leaf Tissue ◽

Pairwise Alignment ◽

Natural Occurrence ◽

Rt Pcr ◽

Cdna Synthesis ◽

Black Currant ◽

Cycle Sequencing ◽

N Protein ◽

The Impact

Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5’ AGATGTGCTTCATCGATGGCTAGTTCTGCT 3’) and BCaRV-N-R (5’ TGCATTCCCACGGGTTAGGAATACATTGGTACT 3’) resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.

Download Full-text

A Description of the Possible Etiology of the Cilantro Yellow Blotch Disease

Plant Disease ◽

10.1094/pdis-09-19-1958-sc ◽

2020 ◽

Vol 104 (3) ◽

pp. 630-633

Author(s):

Olufemi J. Alabi ◽

Brianna C. Gaytán ◽

Maher Al Rwahnih ◽

Cecilia Villegas

Keyword(s):

High Throughput Sequencing ◽

Disease Incidence ◽

Natural Infection ◽

Alfalfa Mosaic Virus ◽

Leaf Tissue ◽

Rt Pcr ◽

Specific Primers ◽

Tissue Samples ◽

Pcr Assays ◽

Hidalgo County

A virus-like disease characterized by foliar yellow blotch symptoms and resembling those described for cilantro yellow blotch disease in California was observed in a 4.05-ha cilantro (Coriandrum sativum) cv. Santo field in Hidalgo County, Texas during spring 2019. Disease incidence at harvest was estimated at ∼20%, and the affected plants were rendered unmarketable. Foliar systemic chlorosis symptoms were observed on sap-inoculated Nicotiana occidentalis plants (n = 3) using inocula from symptomatic cilantro. Total RNA aliquots from 11 randomly collected leaf tissue samples (symptomatic = 7, asymptomatic = 4) were pooled into a composite cilantro RNA sample which was analyzed by high throughput sequencing (HTS). Analyses of the obtained 15.7 million raw reads (76 nt each) yielded virus-specific contigs that mapped to the genomes of alfalfa mosaic virus (AMV), beet pseudoyellows virus (BPYV), and lettuce chlorosis virus (LCV). Virus-specific primers designed from the HTS-derived sequences were used to screen the samples in two-step RT-PCR assays, resulting in the detection of AMV+BPYV in 3 of 7 symptomatic cilantro samples, AMV+LCV in 4 of 7 symptomatic cilantro samples, and AMV alone in the 4 asymptomatic cilantro and sap-inoculated N. occidentalis samples. The results represent the first reports of the natural infection of cilantro by BPYV and LCV and implicate the mixed infection of a Crinivirus and AMV in cilantro yellow blotch disease.

Download Full-text

First Report of Soybean vein necrosis-associated virus in Ohio Soybean Fields

Plant Disease ◽

10.1094/pdis-11-12-1050-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 693-693 ◽

Cited By ~ 7

Author(s):

J. Han ◽

L. L. Domier ◽

A. E. Dorrance ◽

F. Qu

Keyword(s):

High Throughput Sequencing ◽

Molecular Evidence ◽

Rt Pcr ◽

Bean Pod Mottle Virus ◽

Genomic Rnas ◽

Field Samples ◽

Comprehensive Survey ◽

Soybean Leaf ◽

Vein Necrosis ◽

Leaf Deformation

Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5′ CCATCTTTCTTTCCAGGCATTTCA 3′) and SVNaV-S-2421R (5′ GATTCAAGTTCAGCGAGTTCTACAA 3′). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.

Download Full-text