TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Download Full-text

Outcomes of early repeat sweat testing in infants with cystic fibrosis transmembrane conductance regulator-related metabolic syndrome (CRMS)/CF screen-positive, inconclusive diagnosis (CFSPID)

10.22541/au.162150441.16941595/v1 ◽

2021 ◽

Author(s):

vito terlizzi ◽

Laura Claut ◽

Carla Colombo ◽

Antonella Tosco ◽

Alice Castaldo ◽

...

Keyword(s):

Metabolic Syndrome ◽

Definitive Diagnosis ◽

First Year ◽

Transmembrane Conductance Regulator ◽

Transmembrane Conductance ◽

Sweat Chloride ◽

Sweat Testing ◽

Cf Transmembrane Conductance Regulator ◽

First Year Of Life

Background: Reaching early and definitive diagnosis in infants with cystic fibrosis (CF) transmembrane conductance regulator-related metabolic syndrome (CRMS)/CF screen-positive, inconclusive diagnosis (CFSPID) is a priority of all CF newborn screening programs. Currently, sweat testing is the gold standard for CF diagnosis or exclusion. We assessed outcomes in a cohort of Italian CRMS/CFSPID infants who underwent repeat sweat testing in the first year of life. Methods: This multicentre, prospective study analysed clinical data and outcomes in CRMS/CFSPID infants born between September 1, 2018 and December 31, 2019, and followed until June 30, 2020. All subjects underwent CF transmembrane conductance regulator (CFTR) gene sequencing and the search for CFTR macrodeletions/macroduplications, and repeat sweat testing in the first year of life. Results: Fifty subjects (median age at end of follow-up, 16 months [range, 7–21 months]) were enrolled. Forty-one (82%) had the first sweat chloride in the intermediate range. During follow up, 150 sweat tests were performed (range, 1–7/infant). After a median follow-up of 8.5 months (range 1–16.2 months), 11 (22%) subjects were definitively diagnosed as follows: CF (n=2 [4%]) at 2 and 5 months, respectively; healthy carrier (n=8 [16%]), at a median age of 4 months (range 2–8 months); and healthy (n=1 [2%]) at 2 months of age. Inconclusive diagnosis remained in 39 (78%) infants. Conclusions: Early repeat sweat testing in the first year of life can shorten the time to definitive diagnosis in screening positive subjects with initial sweat chloride levels in the intermediate range.

Download Full-text

D.03 Down syndrome: clinical and EEG correlates during development

Canadian Journal of Neurological Sciences / Journal Canadien des Sciences Neurologiques ◽

10.1017/cjn.2016.76 ◽

2016 ◽

Vol 43 (S2) ◽

pp. S13-S13

Author(s):

S Nauth ◽

AK Bamaga ◽

MA Cortez

Keyword(s):

Down Syndrome ◽

Cognitive Abilities ◽

Cognitive Outcomes ◽

First Year ◽

Pharmacological Treatments ◽

Chi Square ◽

Significant Difference ◽

Chi Square Analysis ◽

First Year Of Life ◽

Electroencephalogram Eeg

Background: Down syndrome (DS) is the primary genetic cause of mental retardation and seizures are present in an estimated 5-13% of cases. One-third of seizures in DS are infantile spasms (IS). Hypsarrythmia (HS) is the cardinal electroencephalogram (EEG) feature of IS and has been found to affect cognition; however, its effect on DS patients is inconclusively reported. This study assesses the correlation of HS with cognitive outcomes in DS using the largest sample size to date. Methods: Retrospective study of medical records of children with DS [0-18yrs] at SickKids Hospital in Toronto, from 1990-2013. Seizure history, EEG findings, comorbities, and pharmacological treatments were identified. Developmental outcomes were also assessed from physician comments on motor, verbal and cognitive abilities. The cognitive outcomes of DS patients with and without HS were compared. Results: 70 [male=40] patients with DS and seizures were included. Among 31 (44.2%) patients with DS and IS, 27 had HS. Chi-square analysis showed a significant difference [P=0.007] in prevalence of severe developmental delay in patients with IS and HS versus all other seizure types. Conclusions: The developmental outcome of patients with Down syndrome appears to worsen when IS and HS had occurred in the first year of life.

Download Full-text

Correlation between the neonatal EEG and the neurological examination in the first year of life in infants with bacterial meningitis

Arquivos de Neuro-Psiquiatria ◽

10.1590/s0004-282x2007000400005 ◽

2007 ◽

Vol 65 (3a) ◽

pp. 576-580 ◽

Cited By ~ 1

Author(s):

Adrián Poblano ◽

Roberto Gutiérrez

Keyword(s):

Bacterial Meningitis ◽

Neurological Examination ◽

Neonatal Period ◽

Acute Bacterial Meningitis ◽

Neonatal Meningitis ◽

First Year ◽

Discharge From Hospital ◽

First Year Of Life ◽

Electroencephalogram Eeg

OBJECTIVE: To assess the contribution of neonatal electroencephalogram (EEG) and its correlation with the neurological examination at age of 9 months in newborns with bacterial neonatal meningitis. METHOD: Twenty seven infants were studied with positive cerebrospinal fluid (CSF) culture for bacteria. We used the worse EEG result during acute phase of meningitis, and performed neurologic follow-up after discharge from hospital. Background cerebral activity was classified as normal or mildly, moderately, or markedly abnormal. Neurologic examination outcomes was classified normal, mild abnormalities, moderate abnormalities and severe abnormalities. RESULTS: EEG performed in the neonatal period during acute bacterial meningitis predicts adverse outcome early at age of 9 months, and had a significant correlation with cephalic perimeter and active tone alterations. CONCLUSION: Neonatal EEG is useful for predicting abnormal outcomes, especially cephalic perimeter and active tone abnormalities at 9 months of age in infants with bacterial neonatal meningitis.

Download Full-text

Congenital Zika Syndrome and Infantile Spasms: Case Series Study

Journal of Child Neurology ◽

10.1177/0883073818780105 ◽

2018 ◽

Vol 33 (10) ◽

pp. 664-666 ◽

Cited By ~ 11

Author(s):

Lucas V. Alves ◽

Maria J. G. Mello ◽

Patrícia G. Bezerra ◽

João Guilherme Bezerra Alves

Keyword(s):

Case Series ◽

Infantile Spasms ◽

First Year ◽

Case Series Study ◽

Severe Impairment ◽

Congenital Zika Syndrome ◽

First Year Of Life ◽

Electroencephalogram Eeg ◽

Series Study ◽

Eeg Pattern

Recently described, the congenital Zika syndrome caused by the Zika virus has many features of other congenital infections. This case series study reports 22 infants with congenital Zika syndrome in Brazil who developed infantile spasms during their first year of life. The median age of infantile spasms onset was 4.3 (±1.4) months and ranged from 1 to 7 months. Neurologic evaluation showed that all 22 children presented severe impairment of neuropsychomotor development. A total of 18 infants had an interictal hypsarrhythmia electroencephalogram (EEG) pattern. Vigabatrin was prescribed as first-line treatment; however, only 5 patients were controlled. Steroid regimes were started for children who did not respond to vigabatrin and they are being followed. In conclusion, congenital Zika syndrome may be considered as an etiological agent of infantile spasms.

Download Full-text

The Development of Swallowing Respiratory Coordination

Perspectives on Swallowing and Swallowing Disorders (Dysphagia) ◽

10.1044/sasd18.1.19 ◽

2009 ◽

Vol 18 (1) ◽

pp. 19-24

Author(s):

Maggie-Lee Huckabee

Keyword(s):

Cortical Activation ◽

First Year ◽

Healthy Children ◽

Nasal Airflow ◽

Single Session ◽

Primary Finding ◽

Patterns Of Behavior ◽

Cortical Modulation ◽

First Year Of Life ◽

Swallowing Apnea

Abstract Research exists that evaluates the mechanics of swallowing respiratory coordination in healthy children and adults as well and individuals with swallowing impairment. The research program summarized in this article represents a systematic examination of swallowing respiratory coordination across the lifespan as a means of behaviorally investigating mechanisms of cortical modulation. Using time-locked recordings of submental surface electromyography, nasal airflow, and thyroid acoustics, three conditions of swallowing were evaluated in 20 adults in a single session and 10 infants in 10 sessions across the first year of life. The three swallowing conditions were selected to represent a continuum of volitional through nonvolitional swallowing control on the basis of a decreasing level of cortical activation. Our primary finding is that, across the lifespan, brainstem control strongly dictates the duration of swallowing apnea and is heavily involved in organizing the integration of swallowing and respiration, even in very early infancy. However, there is evidence that cortical modulation increases across the first 12 months of life to approximate more adult-like patterns of behavior. This modulation influences primarily conditions of volitional swallowing; sleep and naïve swallows appear to not be easily adapted by cortical regulation. Thus, it is attention, not arousal that engages cortical mechanisms.

Download Full-text