The Dynamic Network of RNP RNase P Subunits

Ribonuclease P (RNase P) is an important ribonucleoprotein (RNP), responsible for the maturation of the 5′ end of precursor tRNAs (pre-tRNAs). In all organisms, the cleavage activity of a single phosphodiester bond adjacent to the first nucleotide of the acceptor stem is indispensable for cell viability and lies within an essential catalytic RNA subunit. Although RNase P is a ribozyme, its kinetic efficiency in vivo, as well as its structural variability and complexity throughout evolution, requires the presence of one protein subunit in bacteria to several protein partners in archaea and eukaryotes. Moreover, the existence of protein-only RNase P (PRORP) enzymes in several organisms and organelles suggests a more complex evolutionary timeline than previously thought. Recent detailed structures of bacterial, archaeal, human and mitochondrial RNase P complexes suggest that, although apparently dissimilar enzymes, they all recognize pre-tRNAs through conserved interactions. Interestingly, individual protein subunits of the human nuclear and mitochondrial holoenzymes have additional functions and contribute to a dynamic network of elaborate interactions and cellular processes. Herein, we summarize the role of each RNase P subunit with a focus on the human nuclear RNP and its putative role in flawless gene expression in light of recent structural studies.

Loss of Individual Mitochondrial Ribonuclease P Complex Proteins Differentially Affects Mitochondrial tRNA Processing In Vivo

Over a thousand nucleus-encoded mitochondrial proteins are imported from the cytoplasm; however, mitochondrial (mt) DNA encodes for a small number of critical proteins and the entire suite of mt:tRNAs responsible for translating these proteins. Mitochondrial RNase P (mtRNase P) is a three-protein complex responsible for cleaving and processing the 5′-end of mt:tRNAs. Mutations in any of the three proteins can cause mitochondrial disease, as well as mutations in mitochondrial DNA. Great strides have been made in understanding the enzymology of mtRNase P; however, how the loss of each protein causes mitochondrial dysfunction and abnormal mt:tRNA processing in vivo has not been examined in detail. Here, we used Drosophila genetics to selectively remove each member of the complex in order to assess their specific contributions to mt:tRNA cleavage. Using this powerful model, we find differential effects on cleavage depending on which complex member is lost and which mt:tRNA is being processed. These data revealed in vivo subtleties of mtRNase P function that could improve understanding of human diseases.

In-House Development, Standardization, and Validation of a RT-qPCR Assay for the Detection of SARS-CoV-2 Virus in Ecuador.

The World Health Organization (WHO) reported about 30 million cases of Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, and around 1 million deaths worldwide. Ecuador is the country with the highest mortality rate of confirmed cases in South America where both the poor ability to identify SARS-CoV-2 carriers and shortages in reagent supply have contributed the high infection rate observed. Hence, there is an urgent need to develop, standardize and validate an in-house protocol that cannot only reduces testing costs, but also increase the ability to screen widely the population. Primer-probe sets for the SARS-CoV-2 envelope protein E and the human ribonuclease P (RP) were validated for a duplex quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR) for the Coronavirus Disease-19 (COVID-19) detection. Optimal E primers concentration was 400 nM and TaqMan probe 200 nM. The primer efficiency was set at 94.9% and R2 value at 0.99, which was comparable to commercial kits. The lower detection limit was found at 15 copies/ μL (50 copies/rx). In comparison to a Loop-mediated Isothermal Amplification (LAMP) commercial kit, there was a higher detection rate (30%) and results were highly reproducible (95%). We were able to develop a highly sensitive and low-cost duplex in-house RT-qPCR test for COVID-19 detection comparable to other commercially available kits.

Suitability and Sufficiency of Telehealth Clinician-Observed, Participant-Collected Samples for SARS-CoV-2 Testing: The iCollect Cohort Pilot Study

Background The severe acute respiratory coronavirus 2 (SARS-CoV-2) pandemic calls for expanded opportunities for testing, including novel testing strategies such as home-collected specimens. Objective We aimed to understand whether oropharyngeal swab (OPS), saliva, and dried blood spot (DBS) specimens collected by participants at home and mailed to a laboratory were sufficient for use in diagnostic and serology tests of SARS-CoV-2. Methods Eligible participants consented online and were mailed a participant-collection kit to support collection of three specimens for SARS-CoV-2 testing: saliva, OPS, and DBS. Participants performed the specimen collection procedures during a telehealth video appointment while clinical observers watched and documented the suitability of the collection. The biological sufficiency of the specimens for detection of SARS-CoV-2 by reverse transcriptase–polymerase chain reaction and serology testing was assessed by laboratorians using visual inspection and quantification of the nucleic acid contents of the samples by ribonuclease P (RNase P) measurements. Results Of the enrolled participants,153/159 (96.2%) returned their kits, which were included in this analysis. All these participants attended their video appointments. Clinical observers assessed that of the samples collected, 147/153 (96.1%) of the saliva samples, 146/151 (96.7%) of the oropharyngeal samples, and 135/145 (93.1%) of the DBS samples were of sufficient quality for submission for laboratory testing; 100% of the OPS samples and 98% of the saliva samples had cycle threshold values for RNase P <30, indicating that the samples contained sufficient nucleic acid for RNA-PCR testing for SARS-CoV-2. Conclusions These pilot data indicate that most participant-collected OPS, saliva, and DBS specimens are suitable and sufficient for testing for SARS-CoV-2 RNA and serology. Clinical observers rated the collection of specimens as suitable for testing, and visual and quantitative laboratory assessment indicated that the specimens were biologically sufficient. These data support the utility of participant-collected and mailed-in specimens for SARS-CoV-2 testing. International Registered Report Identifier (IRRID) RR2-10.2196/19054

Suitability and Sufficiency of Telehealth Clinician-Observed, Participant-Collected Samples for SARS-CoV-2 Testing: The iCollect Cohort Pilot Study (Preprint)

BACKGROUND The severe acute respiratory coronavirus 2 (SARS-CoV-2) pandemic calls for expanded opportunities for testing, including novel testing strategies such as home-collected specimens. OBJECTIVE We aimed to understand whether oropharyngeal swab (OPS), saliva, and dried blood spot (DBS) specimens collected by participants at home and mailed to a laboratory were sufficient for use in diagnostic and serology tests of SARS-CoV-2. METHODS Eligible participants consented online and were mailed a participant-collection kit to support collection of three specimens for SARS-CoV-2 testing: saliva, OPS, and DBS. Participants performed the specimen collection procedures during a telehealth video appointment while clinical observers watched and documented the suitability of the collection. The biological sufficiency of the specimens for detection of SARS-CoV-2 by reverse transcriptase–polymerase chain reaction and serology testing was assessed by laboratorians using visual inspection and quantification of the nucleic acid contents of the samples by ribonuclease P (RNase P) measurements. RESULTS Of the enrolled participants,153/159 (96.2%) returned their kits, which were included in this analysis. All these participants attended their video appointments. Clinical observers assessed that of the samples collected, 147/153 (96.1%) of the saliva samples, 146/151 (96.7%) of the oropharyngeal samples, and 135/145 (93.1%) of the DBS samples were of sufficient quality for submission for laboratory testing; 100% of the OPS samples and 98% of the saliva samples had cycle threshold values for RNase P &lt;30, indicating that the samples contained sufficient nucleic acid for RNA-PCR testing for SARS-CoV-2. CONCLUSIONS These pilot data indicate that most participant-collected OPS, saliva, and DBS specimens are suitable and sufficient for testing for SARS-CoV-2 RNA and serology. Clinical observers rated the collection of specimens as suitable for testing, and visual and quantitative laboratory assessment indicated that the specimens were biologically sufficient. These data support the utility of participant-collected and mailed-in specimens for SARS-CoV-2 testing. INTERNATIONAL REGISTERED REPORT RR2-10.2196/19054

Generation of pre-tRNAs from polycistronic operons is the essential function of RNase P in Escherichia coli

Ribonuclease P (RNase P) is essential for the 5′-end maturation of tRNAs in all kingdoms of life. In Escherichia coli, temperature sensitive mutations in either its protein (rnpA49) and or RNA (rnpB709) subunits lead to inviability at nonpermissive temperatures. Using the rnpA49 temperature sensitive allele, which encodes a partially defective RNase P at the permissive temperature, we show here for the first time that the processing of RNase P-dependent polycistronic tRNA operons to release pre-tRNAs is the essential function of the enzyme, since the majority of 5′-immature tRNAs can be aminoacylated unless their 5′-extensions ≥8 nt. Surprisingly, the failure of 5′-end maturation elicits increased polyadenylation of some pre-tRNAs by poly(A) polymerase I (PAP I), which exacerbates inviability. The absence of PAP I led to improved aminoacylation of 5′-immature tRNAs. Our data suggest a more dynamic role for PAP I in maintaining functional tRNA levels in the cell.

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.