scholarly journals Revisiting the Complex Pathosystem of Huanglongbing: Deciphering the Role of Citrus Metabolites in Symptom Development

Metabolites ◽  
2020 ◽  
Vol 10 (10) ◽  
pp. 409
Author(s):  
Yasser Nehela ◽  
Nabil Killiny
Keyword(s):  
Metabolic Pathways ◽  
Defense Responses ◽  
Symptom Development ◽  
Bacterial Diseases ◽  
Citrus Greening Disease ◽  
History Of ◽  
Candidatus Liberibacter ◽  
Nutritional Needs ◽  
Liberibacter Asiaticus ◽  
Host Metabolism

Huanglongbing (HLB), formerly known as citrus greening disease, is one of the most devastating bacterial diseases in citrus worldwide. HLB is caused by ‘Candidatus Liberibacter asiaticus’ bacterium and transmitted by Diaphorina citri. Both ‘Ca. L. asiaticus’ and its vector manipulate the host metabolism to fulfill their nutritional needs and/or to neutralize the host defense responses. Herein, we discuss the history of HLB and the complexity of its pathosystem as well as the geographical distribution of its pathogens and vectors. Recently, our recognition of physiological events associated with ‘Ca. L. asiaticus’ infection and/or D. citri-infestation has greatly improved. However, the roles of citrus metabolites in the development of HLB symptoms are still unclear. We believe that symptom development of HLB disease is a complicated process and relies on a multilayered metabolic network which is mainly regulated by phytohormones. Citrus metabolites play vital roles in the development of HLB symptoms through the modulation of carbohydrate metabolism, phytohormone homeostasis, antioxidant pathways, or via the interaction with other metabolic pathways, particularly involving amino acids, leaf pigments, and polyamines. Understanding how ‘Ca. L. asiaticus’ and its vector, D. citri, affect the metabolic pathways of their host is critical for developing novel, sustainable strategies for HLB management.

scholarly journals Identification and Characterization of the Huanglongbing Bacterium in Pummelo from Multiple Locations in Guangdong, P. R. China

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 513-518 ◽  
Author(s):  
X. Deng ◽  
J. Chen ◽  
Z. Feng ◽  
Z. Shan ◽  
H. Guo ◽  
...  
Keyword(s):  
Sweet Orange ◽  
Nucleotide Polymorphisms ◽  
Sequence Comparisons ◽  
Research Attention ◽  
Republic Of China ◽  
Citrus Greening Disease ◽  
Citrus Production ◽  
History Of ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

Huanglongbing (HLB, yellow shoot disease, ex. citrus greening disease), caused by Candidatus Liberibacter spp., is highly destructive to citrus production in Asia, Africa, and South America. Although primarily affecting sweet orange and mandarin, HLB has long been observed in pummelo in Guangdong Province, People's Republic of China; however, the disease in pummelo has received little research attention. Accordingly, it remains unclear how closely related the strains of Ca. Liberibacter in pummelo are to those in other citrus species. In this study, the loci of 16S rDNA, rplAJ (β-operon of ribosomal protein), and an outer membrane protein (omp) gene were analyzed and characterized among strains of Ca. Liberibacter in pummelo samples from six different locations in Guangdong. Sequence comparisons indicated that ‘Candidatus Liberibacter asiaticus’, but not ‘Ca. Liberibacter africanus’ or ‘Ca. Liberibacter americanus’, was exclusively associated with HLB symptoms in pummelo. The pummelo strains of ‘Ca. Liberibacter asiaticus’ from Guangdong were highly homogeneous. Analyses of single-nucleotide polymorphisms in the omp locus showed that the Guangdong pummelo strains grouped with ‘Ca. Liberibacter asiaticus’ strains from Thailand, Nepal, and an unspecified location in China but differed from the Philippine and China-Behai strains. Based on the sequence homogeneity at the omp locus, the history of pummelo culture and the means by which HLB is known to be spread, we believe that, likely, the pummelo strain of ‘Ca. Liberibacter asiaticus’ recently was spread to pummelo in the study areas from infected sweet orange or mandarin trees by insect vectors or by propagation of pummelo infected elsewhere.

scholarly journals Viability of ‘Candidatus Liberibacter asiaticus’ Prolonged by Addition of Citrus Juice to Culture Medium

2014 ◽  
Vol 104 (1) ◽  
pp. 15-26 ◽  
Author(s):  
Jennifer K. Parker ◽  
Sarah R. Wisotsky ◽  
Evan G. Johnson ◽  
Faraj M. Hijaz ◽  
Nabil Killiny ◽  
...  
Keyword(s):  
Grapefruit Juice ◽  
Culture Medium ◽  
Quantitative Polymerase Chain Reaction ◽  
Chemical Characterization ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
Candidatus Liberibacter ◽  
The Media ◽  
Liberibacter Asiaticus

Huanglongbing, or citrus greening disease, is associated with infection by the phloem-limited bacterium ‘Candidatus Liberibacter asiaticus’. Infection with ‘Ca. L. asiaticus’ is incurable; therefore, knowledge regarding ‘Ca. L. asiaticus’ biology and pathogenesis is essential to develop a treatment. However, ‘Ca. L. asiaticus’ cannot currently be successfully cultured, limiting its study. To gain insight into the conditions conducive for growth of ‘Ca. L. asiaticus’ in vitro, ‘Ca. L. asiaticus’ inoculum obtained from seed of fruit from infected pomelo trees (Citrus maxima ‘Mato Buntan’) was added to different media, and cell viability was monitored for up to 2 months using quantitative polymerase chain reaction in conjunction with ethidium monoazide. Media tested included one-third King's B (K), K with 50% juice from the infected fruit, K with 50% commercially available grapefruit juice, and 100% commercially available grapefruit juice. Results show that juice-containing media dramatically prolong viability compared with K in experiments reproduced during 2 years using different juice sources. Furthermore, biofilm formed at the air–liquid interface of juice cultures contained ‘Ca. L. asiaticus’ cells, though next-generation sequencing indicated that other bacterial genera were predominant. Chemical characterization of the media was conducted to discuss possible factors sustaining ‘Ca. L. asiaticus’ viability in vitro, which will contribute to future development of a culture medium for ‘Ca. L. asiaticus’.

scholarly journals Annotation of glycolysis, gluconeogenesis, and trehaloneogenesis pathways provide insight into carbohydrate metabolism in the Asian citrus psyllid

2021 ◽  
Author(s):  
Blessy Tamayo ◽  
Kyle Kercher ◽  
Chad Vosburg ◽  
Crissy Massimino ◽  
Margaryta R Jernigan ◽  
...  
Keyword(s):  
Metabolic Pathways ◽  
Economic Losses ◽  
Asian Citrus Psyllid ◽  
Citrus Greening Disease ◽  
Copy Numbers ◽  
Glycolysis Pathway ◽  
Citrus Production ◽  
Rnai Therapeutics ◽  
Candidatus Liberibacter ◽  
Gene Models

Citrus greening disease is caused by the pathogen Candidatus Liberibacter asiaticus, which is transmitted by the Asian citrus psyllid, Diaphorina citri. There is no curative treatment or significant prevention mechanism for this detrimental disease that causes continued economic losses from reduced citrus production. A high quality genome of D. citri is being manually annotated to provide accurate gene models required to identify novel control targets and increase understanding of this pest. Here, we annotated genes involved in glycolysis, gluconeogenesis, and trehaloneogenesis in the D. citri genome, as these are core metabolic pathways and suppression could reduce this pest. Specifically, twenty-five genes were identified and annotated in the glycolysis and gluconeogenesis pathways and seven genes for the trehaloneogenesis pathway. Comparative analysis showed that the glycolysis genes in D. citri are highly conserved compared to orthologs in other insect systems, but copy numbers vary in D. citri. Expression levels of the annotated gene models were analyzed and several enzymes in the glycolysis pathway showed high expression in the thorax. This is consistent with the primary use of glucose by flight muscles located in the thorax. A few of the genes annotated in D. citri have been targeted for gene knockdown as a proof of concept, for RNAi therapeutics. Thus, manual annotation of these core metabolic pathways provides accurate genomic foundations for developing gene-targeting therapeutics to reduce D. citri.

scholarly journals Genetic Diversity of the Indian Populations of ‘Candidatus Liberibacter asiaticus’ Based on the Tandem Repeat Variability in a Genomic Locus

2015 ◽  
Vol 105 (8) ◽  
pp. 1043-1049 ◽  
Author(s):  
Dilip Kumar Ghosh ◽  
Sumit Bhose ◽  
Manali Motghare ◽  
Ashish Warghane ◽  
Krishanu Mukherjee ◽  
...  
Keyword(s):  
Tandem Repeat ◽  
Tandem Repeats ◽  
Economic Loss ◽  
Class Iii ◽  
Candidatus Liberibacter Asiaticus ◽  
Genomic Locus ◽  
Citrus Greening Disease ◽  
Geographical Regions ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

Citrus huanglongbing (HLB, citrus greening disease) is an extremely destructive disease affecting citrus and causes severe economic loss to the crop yield worldwide. The disease is caused by a phloem-limited, noncultured, gram-negative bacteria Candidatus Liberibacter spp., the widely present and most destructive species being ‘Candidatus Liberibacter asiaticus’. Although the disease has been reported from almost all citrus growing regions of India, knowledge on the molecular variability of the pathogen ‘Ca. L. asiaticus’ populations from different geographical regions and cultivars is limited. In the present study, variability of the Indian ‘Ca. L. asiaticus’ based on the tandem repeats at the genomic locus CLIBASIA_01645 was characterized and categorized into four classes based on the tandem repeat number (TRN); Class I (TRN ≤ 5), Class II (TRN > 5 ≤ 10), Class III (TRN > 10 ≤ 15), and Class IV (TRN > 15). The study revealed that the Indian population of ‘Ca. L. asiaticus’ is more diverse than reported for Florida and Guangdong populations, which showed less diversity. While Florida and Guangdong populations were dominated by a TRN5 and TRN7 genotype, respectively, the Indian ‘Ca. L. asiaticus’ populations with TRN copy numbers 9, 10, 11, 12, and 13 were widely distributed throughout the country. Additionally, TRN2 and TRN17 genotypes were also observed among the Indian ‘Ca. L. asiaticus’ populations. The predominant ‘Ca. L. asiaticus’ genotypes from the northeastern region of India were TRN6 and TRN7 (53.12%) and surprisingly similar to neighboring South China populations. Preliminary results showed absence of preference of citrus cultivars to any specific ‘Ca. L. asiaticus’ genotype.

scholarly journals First Report of Citrus Greening Disease and Associated Bacterium “Candidatus Liberibacter asiaticus” from Bhutan

Plant Disease ◽  
2003 ◽  
Vol 87 (4) ◽  
pp. 448-448 ◽  
Author(s):  
Y. S. Ahlawat ◽  
V. K. Baranwal ◽  
Thinlay ◽  
Doe Doe ◽  
S. Majumder
Keyword(s):  
Citrus Greening ◽  
Ribosomal Protein Genes ◽  
Candidatus Liberibacter Asiaticus ◽  
African Countries ◽  
First Report ◽  
Citrus Greening Disease ◽  
Pcr Product ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Greening Disease

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

scholarly journals Production of monoclonal antibody against Ompa protein of Candidatus Liberibacter asiaticus causing citrus greening disease

2020 ◽  
Vol 18 (3) ◽  
pp. 529-541
Author(s):  
Ho Thi Thuong ◽  
Nguyen Thi Thom ◽  
Nguyen Thi Tra ◽  
Trinh Thai Vy ◽  
Pham Bich Ngoc ◽  
...  
Keyword(s):  
Strong Interaction ◽  
Research Direction ◽  
Citrus Greening ◽  
Candidatus Liberibacter Asiaticus ◽  
Citrus Greening Disease ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Ompa Protein ◽  
Greening Disease ◽  
Vhh Antibodies

Citrus Greening, also known as HuangLongbing (HLB), is considered one of the most dangerous citrus diseases, and limiting the production of citrus trees all over the world. Production of antibodies against Ompa protein of Candidatus Liberibacter asiaticus (CLas) for detection of citrus greening disease is considered as promising research direction. In this study, for the purpose of producting antibodies against Ompa of CLas, we firstly used the camel VHH antibody library for screening VHH antibodies against Ompa using phage-display technique. Next, phages which had strong interaction with Ompa as shown in ELISA were selected for phagemid isolation and the DNA fragments encoding VHH antibodies were sequenced. The DNA fragment encoding the best VHH antibody was then selected and inserted into the expression vector pET-21a (+), then cloned in Ecoli DH5α strain and expressed in BL21 (DE3) strain. The expression of VHH antibodies against Ompa was optimized at different temperatures with an inductive concentration of 0.1 M IPTG. Anti-Ompa VHH antibodies were purified under denatured conditions then re-folded. The biological activity of the VHH antibody with Ompa antigen was assessed by indirect-ELISA reaction. Results indicated that the VHH antibody had a very strong interaction with the Ompa antigen. This opens up the prospect of applying VHH antibody in the detection of citrus greening disease.

scholarly journals Investigation of Citrus HLB Symptom Variations Associated with “Candidatus Liberibacter asiaticus” Strains Harboring Different Phages in Southern China

Agronomy ◽  
2021 ◽  
Vol 11 (11) ◽  
pp. 2262
Author(s):  
Minli Bao ◽  
Zheng Zheng ◽  
Jianchi Chen ◽  
Xiaoling Deng
Keyword(s):  
Southern China ◽  
Phage Type ◽  
Genomic Research ◽  
Citrus Limon ◽  
Symptom Development ◽  
Candidatus Liberibacter Asiaticus ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

Huanglongbing (HLB) is a devastating disease affecting citrus production worldwide. In China, the disease is associated with an unculturable alpha-proteobacterium, “Candidatus Liberibacter asiaticus” (CLas). Phages/prophages of CLas have recently been identified through intensive genomic research. The phage information has facilitated research on CLas biology such as population diversity and virulence gene identification. However, little is known about the roles of CLas phages in HLB symptom development. Such research is challenging due to the unculturable nature of CLas and the lack of laboratory strains that carry a single phage. In this study, CLas strains singly carrying Type 1 phage (Type 1 CLas) and Type 2 phage (Type 2 CLas) were identified and maintained in an experimental screenhouse in southern China. The strains were characterized through next-generation sequencing (NGS). Then, each CLas strain was inoculated into seedlings of three different citrus cultivars/species through graft transmission in a screenhouse in Guangdong, China. Symptom developments were recorded. All CLas-infected cultivars showed HLB symptoms in seven months. In cultivar Nianju (Citrus reticulata), Type 1 CLas caused pronounced yellowing symptoms and severe defoliation, whereas Type 2 CLas caused typical Zn-deficiency-like symptoms. In contrast, symptoms from the two CLas strains’ infections on cultivars Shatianyu (C. maxima), and Eureka lemon (Citrus limon) were more difficult to differentiate. Results from this study provide baseline information for future research to investigate the roles of CLas phages in HLB symptom development.

Sign in / Sign up

Export Citation Format

Share Document