Metabolically Active Prokaryotic Complex in Grassland and Forests’ Sod-Podzol under Polycyclic Aromatic Hydrocarbon Influence

Molecular genetic techniques (FISH, RT-PCR, and metagenomic analysis) were used to investigate the comparative functional biodiversity in the prokaryotic complex in grassland and forests’ sod-podzol under polycyclic aromatic hydrocarbon influence. The polluted samples showed a decrease in the biomass of the prokaryotic community representatives and a change in the metabolically active dominants–representatives of the Bacteria and Archaea domains compared to the control samples. The suppression of the metabolic activity of prokaryote cells under the influence of PAHs in sod-podzolic soil under meadow vegetation was more pronounced compared to soils under forest vegetation. The representatives of prokaryotes that are sensitive and resistant to the studied PAHs were identified. The representatives of the phylogenetic groups from the bacterial complex resistant to PAH pollution were Proteobacteria (Alphaproteobacteria), Bacteroidetes, Firmicutes, Chloroflexi, and Thaumarhaeota in the archaeal complex. Representatives of the phylum Acidobacteria and Actinobacteria (Streptosporangiales) are noted among those sensitive to PAH contamination. The presence and expression of the functional alkane monooxygenase (alkB) gene were established in all the experimental variants studied. In the plant variants, the number of copies of alkB genes increased by an order of magnitude and the biomass of metabolically active prokaryotic representatives with the functional alkB gene doubled compared to the unpolluted territories. The copy number index of the alkB gene can be used as one of the parameters when characterizing an ecosystem for the presence of PAH pollutants.

Isolation of Hydrocarbonoclastic Bacteria and Plasmid Analysis for alk B Gene Primers

Hydrocarbonoclastic microorganisms elaborate a number of hydrocarbons utilising genes that enable them to use crude oil hydrocarbons as carbon sources. These genes could either be located on the plasmid or chromosome. The primary aim of this study was, therefore, to isolate hydrocarbon utilising microbes and profile their plasmid for alkB gene. The physicochemical, microbiological and plasmid analyses were done using standard methods described previously. Plasmid profiling for the alkB gene was carried with four selected bacteria isolates using the universal degenerate primers Rh alkB1-F: ATCTGGGCGCGTTGGGATTTGAGCG, Rh alkB1-R: CGCATGGTGATCGCTGTGCCGCTGC and Pp alkBP-F: TGGCCGGCT ACTCCGATGATCGGAATCTGG, Pp alkBP-R: GCGTGGTGATCCGAGTGCCGCTGAAGGTG. Physicochemical analysis revealed anthropogenic influence on the environment as iron and copper levels were higher than permissible international levels. Aerobic counts for bacteria were higher than those of fungi with values that ranged from 70 to 92 (x106) CFU/g for bacteria and 14 to 19 (x103) CFU/g for fungi. Microbiological and biochemical characterisation revealed that the hydrocarbonoclastic bacterial isolates were Enterobacter sp, Bacillus sp, Micrococcus sp, Pseudomonas sp, Corynebacterium sp and Klebsiella sp while the fungal isolates were Penicillium sp, Aspergillus flavus, Fusarium sp, Rhizopus sp and Aspergillus sp. Molecular characterisation revealed that the selected isolates for plasmid profiling were Bacillus thuringiensis, Pseudomonas stutzeri, Bacillus cereus and Klebsiella pneumoniae. Plasmid profiling revealed that none of the isolates were positive for the monoxygenase (alk B) genes. The findings in this study support earlier findings that indicated that the chromosome could indeed a preferred location for domiciliation of functional genes.

Plant <i>n</i>-alkane production from litterfall altered the diversity and community structure of alkane degrading bacteria in litter layer in lowland subtropical rainforest in Taiwan

n-Alkane and alkane-degrading bacteria have long been used as crucial biological indicators of paleoecology, petroleum pollution, and oil and gas prospecting. However, the relationship between n-alkane and alkane-degrading bacteria in natural forests is still poorly understood. In this study, long-chain n-alkane (C14–C35) concentrations in litterfall, litter layer, and topsoil as well as the diversity and abundance of n-alkane-degrading bacterial communities in litter layers were investigated in three habitats across a lowland subtropical rainforest in southern Taiwan: ravine, windward, and leeward habitats in Nanjenshan. Our results demonstrate that the litterfall yield and productivity of long-chain n-alkane were highest in the ravine habitats. However, long-chain n-alkane concentrations in all habitats were decreased drastically to a similar low level from the litterfall to the bulk soil, suggesting a higher rate of long-chain n-alkane degradation in the ravine habitat. Operational taxonomic unit (OTU) analysis using next-generation sequencing data revealed that the relative abundances of microbial communities in the windward and leeward habitats were similar and different from that in the ravine habitat. Data mining of community amplicon sequencing using the NCBI database revealed that alkB-gene-associated bacteria (95 % DNA sequence similarity to alkB-containing bacteria) were most abundant in the ravine habitat. Empirical testing of litter layer samples using semi-quantitative polymerase chain reaction for determining alkB gene levels confirmed that the ravine habitat had higher alkB gene levels than the windward and leeward habitats. Heat map analysis revealed parallels in pattern color between the plant and microbial species compositions of the habitats, suggesting a causal relationship between the plant n-alkane production and microbial community diversity. This finding indicates that the diversity and relative abundance of microbial communities in the litter layer are affected by n-alkane plant composition in the litterfall.

Plant n-alkane production from litterfall altered the diversity and community structure of alkane degrading bacteria in litter layer in lowland subtropical rainforest in Taiwan

n-Alkane and alkane-degrading bacteria have long been used as important biological indicators in paleoecology, petroleum pollution and oil and gas prospecting. However, their relationships in natural forests are still poorly understood. In this study, long chain n-alkane (C14-C35) levels of plants in litterfall, litter layer and topsoil and the diversity and abundance of n-alkane-degrading bacterial community in litter layer were investigated in 3 habitats across a lowland subtropical rainforest in southern Taiwan, i.e. the ravine habitat, the windward habitat and leeward habitat in Nanjenshan. Our results demonstrated that the litterfall production and flux of long chain n-alkane in ravine area were highest among all habitats. However, long chain n-alkane concentration formed a steep gradient to a similar level from the litterfall to the bulk soil in all habitats, suggesting a higher degrading rate of long chain n-alkane in ravine habitat. The operational taxonomic unit (OTU) analysis from next generation sequencing data revealed that the relative abundance of microbial communities in windward and leeward habitats were similar to each other and different from ravine habitat. Metagenomic data mining by NCBI database revealed that alkB gene associated bacterial (95 % similarity to alkB contained bacteria in DNA sequence) were highest in ravine area compared to other habitats. Empirical testing of litter-layer samples by semi-quantitative PCR in alkB gene levels confirmed that ravine habitat had higher alkB gene levels than windward and leeward habitats. Heat map analysis revealed a parallel in the color pattern between plant vegetation and microbial species-composition of habitats, suggesting a causal relationship between the plant n-alkane production and the diversity of microbial communities. This finding indicated that the diversity and relative abundance of microbial communities in litter layer were affected by the n-alkane composition in litterfall derived by plant vegetation.