scholarly journals Isolation of Hydrocarbonoclastic Bacteria and Plasmid Analysis for alk B Gene Primers

2018 ◽  
pp. 1-9
Author(s):  
U. O. Edet ◽  
S. P. Antai ◽  
A. D. Asitok ◽  
A. A. Brooks
Keyword(s):  
Carbon Sources ◽  
Pseudomonas Stutzeri ◽  
Physicochemical Analysis ◽  
Degenerate Primers ◽  
Hydrocarbonoclastic Bacteria ◽  
Alkb Gene ◽  
Biochemical Characterisation ◽  
Aspergillus Sp ◽  
Plasmid Profiling ◽  
Rhizopus Sp

Hydrocarbonoclastic microorganisms elaborate a number of hydrocarbons utilising genes that enable them to use crude oil hydrocarbons as carbon sources. These genes could either be located on the plasmid or chromosome. The primary aim of this study was, therefore, to isolate hydrocarbon utilising microbes and profile their plasmid for alkB gene. The physicochemical, microbiological and plasmid analyses were done using standard methods described previously. Plasmid profiling for the alkB gene was carried with four selected bacteria isolates using the universal degenerate primers Rh alkB1-F: ATCTGGGCGCGTTGGGATTTGAGCG,  Rh alkB1-R: CGCATGGTGATCGCTGTGCCGCTGC and Pp alkBP-F: TGGCCGGCT ACTCCGATGATCGGAATCTGG, Pp alkBP-R:  GCGTGGTGATCCGAGTGCCGCTGAAGGTG. Physicochemical analysis revealed anthropogenic influence on the environment as iron and copper levels were higher than permissible international levels. Aerobic counts for bacteria were higher than those of fungi with values that ranged from 70 to 92 (x106) CFU/g for bacteria and 14 to 19 (x103) CFU/g for fungi. Microbiological and biochemical characterisation revealed that the hydrocarbonoclastic bacterial isolates were Enterobacter sp, Bacillus sp, Micrococcus sp, Pseudomonas sp, Corynebacterium sp and Klebsiella sp while the fungal isolates were Penicillium sp, Aspergillus flavus, Fusarium sp, Rhizopus sp and Aspergillus sp. Molecular characterisation revealed that the selected isolates for plasmid profiling were Bacillus thuringiensis, Pseudomonas stutzeri, Bacillus cereus and Klebsiella pneumoniae. Plasmid profiling revealed that none of the isolates were positive for the monoxygenase (alk B) genes. The findings in this study support earlier findings that indicated that the chromosome could indeed a preferred location for domiciliation of functional genes.

scholarly journals Improvement of the Culture Medium for the Dichlorvos-Ammonia (DV-AM) Method to Selectively Detect Aflatoxigenic Fungi in Soil

Toxins ◽  
2018 ◽  
Vol 10 (12) ◽  
pp. 519 ◽  
Author(s):  
Kimiko Yabe ◽  
Haruna Ozaki ◽  
Takuya Maruyama ◽  
Keisuke Hayashi ◽  
Yuki Matto ◽  
...  
Keyword(s):  
Culture Medium ◽  
Agar Medium ◽  
Carbon Sources ◽  
Tween 80 ◽  
Selective Medium ◽  
Selective Detection ◽  
Aflatoxigenic Fungi ◽  
Aspergillus Nomius ◽  
Rhizopus Sp ◽  
Triton X

The dichlorvos-ammonia (DV-AM) method is a simple but sensitive visual method for detecting aflatoxigenic fungi. Here we sought to develop a selective medium that is appropriate for the growth of aflatoxigenic fungi among soil mycoflora. We examined the effects of different concentrations of carbon sources (sucrose and glucose) and detergents (deoxycholate (DOC), Triton X-100, and Tween 80) on microorganisms in soils, using agar medium supplemented with chloramphenicol. The results demonstrated that 5–10% sucrose concentrations and 0.1–0.15% DOC concentrations were appropriate for the selective detection of aflatoxigenic fungi in soil. We also identified the optimal constituents of the medium on which the normal rapid growth of Rhizopus sp. was completely inhibited. By using the new medium along with the DV-AM method, we succeeded in the isolation of aflatoxigenic fungi from non-agricultural fields in Fukui city, Japan. The fungi were identified as Aspergillus nomius based on their calmodulin gene sequences. These results indicate that the new medium will be useful in practice for the detection of aflatoxigenic fungi in soil samples including those from non-agricultural environments.

scholarly journals Phytosanitary Quality of Genotypes of Wheat Seeds Used Northern Paraná State

2020 ◽  
Vol 12 (6) ◽  
pp. 57
Author(s):  
Jacqueline Dalbelo Puia ◽  
Leandro Camargo Borsato ◽  
Marilize Cristina Gonçalves de Oliveira ◽  
Adriano Thibes Hoshino ◽  
Marcelo Giovanetti Canteri ◽  
...  
Keyword(s):  
Quality Evaluation ◽  
Morphological Characteristics ◽  
Storage Fungi ◽  
Health Quality ◽  
Alternaria Sp ◽  
Low Incidence ◽  
Aspergillus Sp ◽  
Rhizopus Sp ◽  
Wheat Seeds

Wheat seeds can be infested and/or infected by microorganisms that might cause deterioration of this propagation structure. The aim of this study was to evaluate the health quality of sixteen wheat genotypes grown in northern Paraná. Therefore, seeds of each genotype were submitted to the blotter test with 16 repetitions, 400 seeds per sample, for phytosanitary quality evaluation. The identification of the fungi was performed based on their morphological characteristics and quantified data. The results revealed variations in incidence, with 20 fungi genera in the analyzed samples. The fungi Rhizopus sp., Aspergillus sp., Penicillium sp. and Bipolaris sp. were found in 100% of the analyzed samples, while Mucor sp. and Alternaria sp. were in 89% and 78% of the samples, respectively. The main pathogens that cause diseases in the aerial part of wheat were not found, or were low incidence in all materials analyzed. The pathogens with the highest incidence associated with wheat seeds were groups of storage fungi and known to produce mycotoxins.

scholarly journals The emulsifying effect of biosurfactants produced by food spoilage organisms in Nigeria

2016 ◽  
Vol 5 (1) ◽  
Author(s):  
Christianah O. Ogunmola ◽  
Olusimbo O. Aboaba
Keyword(s):  
Carbon Sources ◽  
Pseudomonas Stutzeri ◽  
Diesel Oil ◽  
Alcaligenes Faecalis ◽  
Aviation Fuel ◽  
Gas Chromatography Mass Spectrometry ◽  
Food Spoilage ◽  
Animal Products ◽  
Emulsification Index ◽  
Bacillus Laterosporus

Food spoilage organisms were isolated using standard procedures on Nutrient Agar, Cetrimide Agar and Pseudomonas Agar Base (supplemented with CFC). The samples were categorized as animal products (raw fish, egg, raw chicken, corned beef, pasteurized milk) and plant products (vegetable salad, water leaf (Talinium triangulare), boiled rice, tomatoes and pumpkin leaf (Teifairia occidentalis).They were characterised as Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas stutzeri, Burkholderia pseudomallei, Serratia rubidaea, Corynebacterium pilosum, Bacillus subtilis, Bacillus mycoides, Bacillus laterosporus, Bacillus laterosporus, Serratia marcescens, Bacillus cereus, Bacillus macerans, Alcaligenes faecalis and Alcaligenes eutrophus. Preliminary screening for biosurfactant production was done using red blood haemolysis test and confirmed by slide test, drop collapse and oil spreading assay. The biosurfactant produced was purified using acetone and the composition determined initially using Molisch’s test, thin layer chromatography and gas chromatography mass spectrometry. The components were found to be ethanol, amino acids, butoxyacetic acid, hexadecanoic acid, oleic acid, lauryl peroxide, octadecanoic acid and phthalic acid. The producing organisms grew readily on several hydrocarbons such as crude oil, diesel oil and aviation fuel when used as sole carbon sources.  The purified biosurfactants produced were able to cause emulsification of kerosene (19.71-27.14%) as well as vegetable oil (16.91-28.12%) based on the emulsification index. This result suggests that the isolates can be an asset and further work can exploit their optimal potential in industries.

scholarly journals Air Quality Assessment of Port Harcourt Urban Slums and Health Implications

2021 ◽  
pp. 50-57
Author(s):  
H. O. Stanley ◽  
M. E. Amesi
Keyword(s):  
Air Quality ◽  
Fungal Species ◽  
Urban Slums ◽  
Candida Sp ◽  
Suspended Particulate ◽  
Port Harcourt ◽  
Microbiological Parameters ◽  
Fusarium Sp ◽  
Aspergillus Sp ◽  
Rhizopus Sp

This study was conducted to assess the outdoor air quality of some urban slums in Port Harcourt. Six sampling sites were selected, from the Port Harcourt urban slums; two sites from each slum represented with a suffix 1 or 2.  The slums are designated Marine base (#1 and #2), RSU BG, Obudu 2, Bundu (#1 and #2). The air quality was analyzed using portable handheld air quality analyzer and the microbiological parameters were determined by standard cultural method. The study revealed that the sampled sites were laden with bacterial and fungal species. namely; Klebsiella sp., Micrococcus sp., Escherichia sp., Pseudomonas sp., Baccilus sp., Aeromonas sp., Streptococus sp., Serratia sp., Aerococcus sp., Proteus sp. Penicillium sp., Fusarium sp., Candida sp., Aspergillus sp., Mucor sp., Rhizopus sp. and Tricorderma sp. Highest obtained noise level was at Marine base 1 which was  66 db, highest relative humidity of 54.8% at RSU BG, CO2  (ppm) values of 4.8, 80, 796, 850, 638, 698 for Marine base 2, Marine base 1, Obudu 2, RSU BG, Bundu 1 and Bundu 2 respectively. The values for NO2 (ppm) was (0.05, 0.053, 0.071, 0.022, 0.035, 0.023), suspended particulate matter (ppm) was (7.1, 8.7, 9.5, 9.5, 6.2, 6.2), SO2 (ppm) was (0.42, 0.15, 0.50, 0.34, 1.26, 0.41) CO (ppm) was (4.8, 1.7, 2.2, 3.0, 3.9, 3.6) and volatile organic compound (ppm) was (1.0, 1.1, 0.9, 75 and 1.2). This study has shown that Port Harcourt urban slums are experiencing some degree of contamination not acceptable for healthy living that requires attention to curb. These areas require all-round improvement in sanitation.   M Give one sentence on methodology.

scholarly journals Evaluation of Microbiological Quality of Vermicompost Prepared from Different Types of Organic Wastes using Eisenia fetida

2021 ◽  
Author(s):  
Rachna Kapila ◽  
Geeta Verma ◽  
Aparajita Sen ◽  
Arti Nigam
Keyword(s):  
Hydrolytic Enzymes ◽  
Microbiological Quality ◽  
Organic Wastes ◽  
Waste Products ◽  
Fertilizer Value ◽  
Different Types ◽  
Aspergillus Sp ◽  
Phosphate Solubilizing ◽  
Bacteria And Fungi ◽  
Rhizopus Sp

Background: Vermicomposting is the agricultural technique of conversion of organic wastes to a fertile product, which can result in better crop growth and production. However, even though earthworms are the main organisms participating in the process, the microbes associated with it also have an important role to play. These microbes degrade the waste products biochemically and are responsible of the conversion processes. Few studies are carried out on microbial diversity and related enzymes activities in the vermicompost prepared from different organic waste materials. Methods: In this paper, we isolated both bacteria and fungi from seven different types of vermicompost, using different selective media. We also studied the activity of hydrolytic enzymes that are associated with the isolated microbes.Result: It was observed that bacteria like Bacillus sp., Pseudomonas sp., Klebsiella sp., Staphylococcus aureus, Streptococcus, Micrococcus, Actinomycetes, Pigment producing Actinomycetes, Streptomyces, Azotobactor and fungi like Penicillium purpurogenum, Aspergillus sp., Alternaria alternata, Fusarium solani, Rhizopus sp., Mucor hiemalis, Myrothecium verrucaria etc. were present in our vermicompost preparations. The presence of nitrogen fixing bacteria, phosphate solubilizing microorganisms and PGPR indicated the good fertilizer value of the vermicompost samples. It was also observed that the diversity of microbes present supported significant levels of CMCase Exoglucanase, Xylanase, β-Glucosidase, Phosphatase and Urease activities.

scholarly journals Biosynthesis of silver nanoparticles from Aloe vera leaf extract and antifungal activity against Rhizopus sp. and Aspergillus sp.

2014 ◽  
Vol 5 (7) ◽  
pp. 875-880 ◽  
Author(s):  
Shreya Medda ◽  
Amita Hajra ◽  
Uttiya Dey ◽  
Paulomi Bose ◽  
Naba Kumar Mondal
Keyword(s):  
Silver Nanoparticles ◽  
Antifungal Activity ◽  
Leaf Extract ◽  
Aloe Vera ◽  
Aspergillus Sp ◽  
Rhizopus Sp

scholarly journals ATIVIDADE ENZIMÁTICA DE CELULASES PELO MÉTODO DNS DE FUNGOS ISOLADOS DE SEMENTES EM GERMINAÇÃO

2016 ◽  
Vol 5 (4) ◽  
Author(s):  
Fábio José Inforsato ◽  
André Luiz Meleiro Porto
Keyword(s):  
Aspergillus Sp ◽  
Rhizopus Sp

O objetivo do trabalho foi utilizar o caldo enzimático dos fungos Aspergillus sp. CBMAI 1198 e Rhizopus sp. CBMAI 1458 isolados de sementes em germinação para degradar a celulose utilizando papel de filtro. Inicialmente os fungos foram cultivados em meio de cultura sólido contendo celulose como indutor de celulases em diferentes valores de pH. A atividade enzimática máxima foi obtida no período de 48 a 72 h após serem cultivados em meio semi-sólido de farelo de trigo (Aspergillus sp. CBMAI 1198: 2,20 e 2,18 UI.mL-1,48-72h, pH 6,0; Rhizopus sp. CBMAI 1458, 5,30 UI.mL-1, pH 6,0, 48 h). Para quantificação da atividade enzimática para celulases totais foi utilizado o método DNS.  Concluiu-se que os fungos Aspergillus sp. CBMAI 1198 e Rhizopus sp. CBMAI 1458 produziram celulases que degradaram a celulose presente no papel de podem ser utilizados na produção dessas enzimas.

Microbiological Evaluation of Ready-to-Drink Tigernut Drinks Sold within Port Harcourt Metropolis, Rivers State, Nigeria

2020 ◽  
pp. 45-58
Author(s):  
Francis Sopuruchukwu Ire ◽  
Goziem Kim Benneth ◽  
Ndukwe Maduka
Keyword(s):  
Bacterial Count ◽  
Human Consumption ◽  
National Agency ◽  
Candida Sp ◽  
Penicillium Sp ◽  
Port Harcourt ◽  
Aspergillus Sp ◽  
Rhizopus Sp ◽  
And Control ◽  
Corynebacterium Sp

Aims: Tigernut drink are made from tigernut tubers (Cyperus esculentus L.) and rich in nutrients. This drink is locally produced and widely consumed in Nigeria irrespective of social status. This study is aimed at evaluating the microbial quality and physicochemical property of tigernut drinks sold within Port Harcourt metropolis. Methodology: Thirty (30) samples of freshly prepared and packaged tigernut drinks were randomly purchased from different vendors in five locations of Port Harcourt metropolis (Agip Estate, Abuja Campus (Uniport), Choba, Mile 1 and Mile 2 Markets). The samples were analyzed using standard microbiological and physicochemical methods. SPSS (Statistical Package for the Social Sciences) was used to analyze the data. Results: Results obtained showed that the pH of the samples ranged from 4.2 to 4.6 while the total heterotrophic bacterial count ranged from 6. 54-6.74 log10 CFU/mL. Total fungal count of tigernut drinks ranged from 6.0-6.2 log10 CFU/mL. A total of nine (9) bacterial genera namely Staphylococcus sp. (37.3%), Escherichia sp. (21.3%), Salmonella sp. (12%), Pseudomonas sp. (12%), Klebsiella sp. (4%), Bacillus sp. (4%), Micrococcus sp. (4%), Enterobacter sp. (2.7%) and Corynebacterium sp. (2.7%) were isolated from the samples. Six (6) fungal genera were also encountered in the drink sampled which include Rhizopus sp. (1.4%), Saccharomyces sp. (4.4%), Aspergillus sp. (30.9%), Fusarium sp. (26.5%), Penicillium sp. (30.9%) and Candida sp. (5.9%). The result revealed that Staphylococcus sp. had the highest percentage of occurrence (37.3%) followed by E. coli (21.3%), while Enterobacter sp. (2.7%) and Corynebacterium sp. (2.7%) recorded the least. Among the fungal isolates, Aspergillus sp. and Penicillium sp. had the highest percentage of occurrence (30.9%) whereas Rhizopus sp. had the least (1.4%). The results of this study revealed that all the samples from the five (5) locations were heavily contaminated with pathogenic microorganisms and found not suitable for human consumption based on the standard recommended by National Agency for Food and Drug Administration and Control (NAFDAC). NAFDAC stipulated that mesophilic aerobic count of locally prepared beverages should be < 5.0 log10 CFU/mL. Conclusion: The huge contamination recorded in all the samples irrespective of the location could be linked to poor hygienic levels during processing. Therefore, good manufacturing practices, public health enlightenment campaign and strict regulations from relevant agencies are recommended to avoid foodborne infections, diseases and possible deaths which could result from consumption of such contaminated tigernut drinks.

scholarly journals Transporte, patogenicidade e transmissibilidade de fungos associados às sementes de pinhão manso

2011 ◽  
Vol 33 (4) ◽  
pp. 663-670 ◽  
Author(s):  
Danila Alves Corrêa de Sá ◽  
Gil Rodrigues dos Santos ◽  
Gleiber Quintão Furtado ◽  
Eduardo Andréa Lemus Erasmo ◽  
Ildon Rodrigues do Nascimento
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Minas Gerais ◽  
Sao Paulo ◽  
São Paulo ◽  
Penicillium Sp ◽  
Fusarium Sp ◽  
Aspergillus Sp ◽  
Rhizopus Sp

Objetivou-se determinar a taxa de transporte de população de fungos associados às sementes de pinhão manso, a patogenicidade desses microrganismos a plântulas e frutos e a transmissibilidade fruto-semente e semente-plântula. Avaliaram-se a taxa de transporte, por meio de blotter test, de sementes produzidas nos estados de Minas Gerais, São Paulo, Bahia e Tocantins. As sementes foram submetidas aos tratamentos: sem desinfestação com tegumento (SDCT), sem desinfestação sem tegumento (SDST), com desinfestação com tegumento (CDCT) e com desinfestação sem tegumento (CDST). A incidência (%) dos fungos foi avaliada sob microscópio estereoscópico binocular. Para o teste de patogenicidade em plântulas e frutos inocularam-se suspensões de 10(6) esporos e discos de BDA com micélio, respectivamente. Para os fungos fitopatogênicos avaliaram-se a transmissibilidade fruto-semente e semente-plântula. O tratamento SDCT permitiu a detecção de maior número de fungos. Os fungos identificados foram Colletotrichum gloeosporioides, C. capsici, Curvularia sp., Verticillium sp., Fusarium sp., Penicillium sp., Aspergillus sp., A. niger e Rhizopus sp. Apenas as espécies de Colletotrichum são patogênicas às plântulas e frutos. Para ambas espécies há transmissibilidade fruto-semente, entretanto não é observada transmissão semente-plântula.

Sign in / Sign up

Export Citation Format

Share Document