Molecular Identification of Trichoderma reesei

Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding

Journal of Marine Research ◽

10.14710/jmr.v10i1.28334 ◽

2021 ◽

Vol 10 (1) ◽

pp. 48-54

Author(s):

Stefanie Jessica Henny Larasati ◽

Agus Sabdono ◽

Mada Triandala Sibero

Keyword(s):

Dna Barcoding ◽

Trichoderma Reesei ◽

Molecular Identification ◽

Fusarium Solani ◽

Dna Amplification ◽

The Body ◽

Universal Primers ◽

Fruiting Body Formation ◽

Marine Biotechnology ◽

Filter Feeders

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).

Download Full-text

A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei

World Journal of Microbiology and Biotechnology ◽

10.1007/s11274-015-1839-9 ◽

2015 ◽

Vol 31 (6) ◽

pp. 995-999 ◽

Cited By ~ 1

Author(s):

Dina B. Saroj ◽

Shrinivas N. Dengeti ◽

Supriya Aher ◽

Anil K. Gupta

Keyword(s):

Trichoderma Reesei ◽

Molecular Identification ◽

One Step ◽

Trichoderma Citrinoviride

Download Full-text

Electron microscopy in diagnostic virology

Proceedings, annual meeting, Electron Microscopy Society of America ◽

10.1017/s0424820100110702 ◽

1984 ◽

Vol 42 ◽

pp. 70-73

Author(s):

S. E. Miller

Keyword(s):

Electron Microscopy ◽

Tissue Culture ◽

Molecular Identification ◽

Point Of View ◽

Negative Stain ◽

Viral Diagnosis ◽

Electron Microscopist ◽

Diagnostic Virology

The techniques for detecting viruses are many and varied including FAT, ELISA, SPIRA, RPHA, SRH, TIA, ID, IEOP, GC (1); CF, CIE (2); Tzanck (3); EM, IEM (4); and molecular identification (5). This paper will deal with viral diagnosis by electron microscopy and will be organized from the point of view of the electron microscopist who is asked to look for an unknown agent--a consideration of the specimen and possible agents rather than from a virologist's view of comparing all the different viruses. The first step is to ascertain the specimen source and select the method of preparation, e. g. negative stain or embedment, and whether the sample should be precleared by centrifugation, concentrated, or inoculated into tissue culture. Also, knowing the type of specimen and patient symptoms will lend suggestions of possible agents and eliminate some viruses, e. g. Rotavirus will not be seen in brain, nor Rabies in stool, but preconceived notions should not prejudice the observer into missing an unlikely pathogen.

Download Full-text