Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).

Download Full-text

DNA Barcoding Tanaman Daluga (Cyrtosperma spp) dari Kepulauan Sangihe Berdasarkan Gen matK (DNA Barcoding Daluga Plant (Cyrtosperma spp) of Sangihe Island Based on matK Gene)

JURNAL BIOS LOGOS ◽

10.35799/jbl.5.2.2015.10547 ◽

2015 ◽

Vol 5 (2) ◽

Author(s):

Eka Julianti ◽

Arthur Pinaris ◽

Edy F Lengkong ◽

Beivy J Kolondam

Keyword(s):

Dna Barcoding ◽

Dna Extraction ◽

Genomic Dna ◽

Nutritional Value ◽

Dna Amplification ◽

Alternative Food ◽

Universal Primers ◽

The Family ◽

Matk Gene ◽

Solis Biodyne

Abstrak Tanaman daluga (Cyrtosperma spp.) termasuk dalam famili Araceae (talas-talasan), umbinya berpotensi sebagai tanaman pangan alternatif karena mempunyai nilai gizi yang tinggi. Tanaman ini banyak terdapat di Kepulauan Sangihe. Penelitian ini dilakukan untuk mengetahui DNA barcoding daluga hijau, kuning dan belang-belang dengan menggunakan gen matK (maturase K). Ekstraksi DNA menggunakan Genomic DNA Mini Kit Plant (Geneaid), amplifikasi DNA menggunakan Kit PCR 5x FirePol Master Mix (Solis Biodyne) dan sepasang primer universal yaitu matK-3F-r (5’CGTACAGTACTTTTGTGTTTACGAG 3’) dan matK-1R-f (5’ACC CAGTCCATCTGGAAATCTTGGTTC3’). Hasil penelitian menunjukkan bahwa tanaman daluga hijau, daluga kuning, dan daluga belang-belang dari Kepulauan Sangihe memiliki sekuens DNA yang identik (kemiripan 100%). Daluga yang diteliti memiliki kemiripan sekuens dengan sampel di NCBI yaitu dengan Cyrtosperma macrotum (99,88%), Podolasia stipitata (99,50%), Dracontium polyphyllum (99,38 %), Pycnospatha arietina (99,38%) dan Dracontioides desciscen (99%). Dari hasil penelitian ini dapat disimpulkan bahwa DNA barcoding tanaman daluga dari kepulauan Sangihe berdasarkan gen matK belum dapat membedakan variasi intraspesies. Kata kunci: daluga, dalugha, Cyrtosperma spp. Abstract Daluga (Cyrtosperma spp.) plant belongs to the family Araceae, the corm is potential as an alternative food because it has a high nutritional value. The plant is widely available in Sangihe Island. This study aimed to determine the DNA barcoding of green daluga, yellow daluga and mottled daluga using matK gene (maturase K). The DNA extraction used Genomic DNA Mini Kit Plant (Geneaid) and DNA amplification used the Kit PCR 5x FirePol Master Mix (Solis Biodyne) and universal primers matK-3F-R (5' CGTACAGTACTT TTGTGTTTACGAG 3') and matK-1R-f (5'ACCCAGAAATGGATCTCTTCCTGG TTC3'). The result showed that the green daluga, yellow daluga and mottled daluga from Sangihe Islands were identical (100% similarity). Daluga from Sangihe had similarities with the sample sequences in NCBI, namely Cyrtosperma macrotum (99.88%), Podolasia stipitata (99.50%), Dracontium polyphyllum (99,38%) Pycnospatha arietina (99.38%) and Dracontioides desciscen (99%). From these results it could be concluded that DNA barcoding of daluga plant from Sangihe based on the matK gene could not distinguish variations intraspesies. Keywords: daluga, dalugha, Cyrtosperma spp.

Download Full-text

Identification of a Bacterial Consortium with Biotechnological Potential for Arsenic Bioremediation

Advanced Materials Research ◽

10.4028/www.scientific.net/amr.825.540 ◽

2013 ◽

Vol 825 ◽

pp. 540-543

Author(s):

Mariana Moreira ◽

Silvana de Queiroz Silva ◽

Mônica Cristina Teixeira

Keyword(s):

Burkholderia Cepacia ◽

Iron Sulfide ◽

Denaturing Gradient Gel Electrophoresis ◽

Dna Amplification ◽

Bacterial Consortium ◽

Universal Primers ◽

Ribosomal Database Project ◽

Sulfate Reducing ◽

Gradient Gel Electrophoresis ◽

Reducing Bacteria

The objective of this work was to identify one bacterial consortium adapted to the cultivation in the presence of trivalent arsenic (AsIII). Samples were cultured in flasks containing modified Postgate C liquid medium (selective for sulfate-reducing bacteria, SRB). Six different As concentrations were used: 0.5, 1.0, 2.0, 4.0, 8.0 and 16 mg l-1. The growth of sulfate reducing microorganisms was indirectly observed by the formation of an iron sulfide black precipitate and also by the Eh measures.100 ml aliquots of cultured media were centrifuged and stored at-20°C for DNA extraction by phenol/chloroform method. Universal primers 968F-GC 1392R (Bacteria domain) were used for 16S ribosomal DNA amplification. Microbial diversity was evaluated by denaturing gradient gel electrophoresis (DGGE). After DGGE analysis 7 different bands were selected, cut, sequenced and analyzed using the Ribosomal Database Project Release. Consortium microorganisms identified were: Pantoea agglomerans, Enterobacter sp, Citrobacter sp, Cupriavidusmetallidurans, Ralstonia sp, Burkholderia cepacia and Bacillus sp. Thus the microbial consortium here identified is a good candidate for bioremediation of arsenic contaminated areas and effluents.

Download Full-text

Research Paper DNA barcode identification of fish products from Guiyang markets in southwest China

Journal of Food Protection ◽

10.4315/jfp-21-258 ◽

2022 ◽

Author(s):

Qian Tang ◽

Qi Luo ◽

Qian Duan ◽

Lei Deng ◽

Renyi Zhang

Keyword(s):

Dna Barcoding ◽

Molecular Identification ◽

Fish Consumption ◽

Southwest China ◽

Dna Barcode ◽

Guizhou Province ◽

Accurate Identification ◽

Continuous Growth ◽

Fish Products ◽

Fresh Frozen

Nowadays, the global fish consumption continues to rise along with the continuous growth of the population, which has led to the dilemma of overfishing of fishery resources. Especially high-value fish that are overfished are often replaced by other fish. Therefore, the accurate identification of fish products in the market is a problem worthy of attention. In this study, full-DNA barcoding (FDB) and mini-DNA barcoding (MDB) used to detect the fraud of fish products in Guiyang, Guizhou province in China. The molecular identification results showed that 39 of the 191 samples were not consistent with the labels. The mislabelling of fish products for fresh, frozen, cooked and canned were 11.70%, 20.00%, 34.09% and 50.00%, respectively. The average kimura 2 parameter distances of MDB within species and genera were 0.27% and 5.41%, respectively; while average distances of FDB were 0.17% within species and 6.17% within genera. In this study, commercial fraud is noticeable, most of the high-priced fish were replaced of low-priced fish with a similar feature. Our study indicated that DNA barcoding is a valid tool for the identification of fish products and that it allows an idea of conservation and monitoring efforts, while confirming the MDB as a reliable tool for fish products.

Download Full-text

Phylogenetic Analysis of Black Peper (Piper Spp.) Population Collected in Different Locations of Vietnam Based on the ITSU1-4 Gene Region

10.21203/rs.3.rs-844711/v1 ◽

2021 ◽

Author(s):

Sonexay Rasphone ◽

Long Thanh Dang ◽

Hoan Nguyen ◽

Ngoc Quang Nguyen ◽

Oanh Thi Duong ◽

...

Keyword(s):

Dna Barcoding ◽

Ribosomal Dna ◽

Maximum Likelihood Method ◽

Dna Barcode ◽

Population Expansion ◽

Nuclear Ribosomal Dna ◽

Likelihood Method ◽

Gene Region ◽

Universal Primers ◽

Intraspecific Distance

Abstract Background: The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. To compare and find out the analysis genetic diversity difference some pepper individuals collected in different localities in Vietnam when using the ITS of nuclear ribosomal DNA. The ITS gene region from the nuclear genomes were tested for their suitability as DNA barcoding regions of thirty-nine pepper individuals. Universal primers were used, and sequenced products were analyzed using the Maximum Likelihood method and Tamura-Nei model in the MEGA X program.Results: We did not observe high variability in intraspecific distance within the ITSu1-4 gene region between individuals, ranged from 0.000 to 0.155 (mean = 0.033). The size of the gene region has fluctuated from 667 to 685 bp between different individuals with the percentage (G + C) contained in the ITSu1-4 gene region was ranged from 54.776% to 60.805%, mean = 60.174%. The values of Fu’s Fs, D, Fu and Li’s D* and F* were negative as well (Fs = -0.209, D = -1.824; P < 0.05, D* = -1.205; not significant, P > 0.10 and F* = -1.699; not significant, 0.10 > P > 0.05), indicating an excess of recently derived haplotypes and suggesting that either population expansion or background selection has occurred. The value Strobeck’s S the obtained between individuals in a population is high (S = 0.684). The results of evolutionary relationships of taxa obtained 3 groups with the highest value of Fst is shown in the pairs of groups II and III (Fst = 0.151), and the lowest is in groups II and I (Fst = 0.015). All of the new sequences have been deposited in GeneBank under the following accession numbers MZ636718 to MZ636756.Conclusions: This database is an important resource for researchers working on Species of pepper in Vietnam and also provides a tool to create ITSu1-4 databases for any given taxonomy.

Download Full-text

Molecular Identification of Reptiles from Tabuk Region of Saudi Arabia Through DNA Barcoding: A Case Study

DNA Barcoding and Molecular Phylogeny ◽

10.1007/978-3-030-50075-7_16 ◽

2020 ◽

pp. 253-264

Author(s):

Bishal Dhar ◽

Mohua Chakraborty ◽

Madhurima Chakraborty ◽

Sorokhaibam Malvika ◽

N. Neelima Devi ◽

...

Keyword(s):

Saudi Arabia ◽

Dna Barcoding ◽

Molecular Identification

Download Full-text

Do House Wrens (Troglodytes aedon) add spider egg cases to their nests for heterospecific cleaning?

Canadian Journal of Zoology ◽

10.1139/cjz-2018-0016 ◽

2019 ◽

Vol 97 (1) ◽

pp. 50-56

Author(s):

C.L. Gable ◽

T.J. Underwood ◽

G.P. Setliff

Keyword(s):

Dna Barcoding ◽

Body Condition ◽

Significant Relationship ◽

The Body ◽

Troglodytes Aedon ◽

House Wren ◽

Late Season ◽

House Wrens ◽

Significant Difference

House Wrens (Troglodytes aedon Vieillot, 1809) regularly add spider egg cases (Arachnida: Araneae) to their nests, which may be an example of heterospecific cleaning. This behavior involves one animal employing another to remove parasites from their nests. In House Wren nests, juvenile spiders hatching from egg cases may facilitate the reduction of mites that feed on nestlings. We tested this ectoparasite reduction hypothesis by monitoring House Wren nests for spider egg cases and by collecting completed nests to compare the number of spider egg cases and Dermanyssus hirundinis (Hermann, 1804) mites. No significant relationship was found between the number of spider egg cases and number of D. hirundinis mites in nests. We also found no significant relationship between the number of D. hirundinis mites in nests and the body condition of nestlings. Finally, no significant difference was found between the number of D. hirundinis mites in early versus late season nests, but significantly more spider egg cases were added to late season nests. Of a subsample of spider egg cases dissected, we found that 28% contained spider eggs or embryos. We also identified three species of juvenile spiders from House Wren nests using DNA barcoding. Overall, we found no evidence that spider egg cases reduce the number of D. hirundinis mites or engender better quality offspring in House Wren nests.

Download Full-text

A molecular identification of medicinal Rheum Species cultivated germplasm from the northwest of China using DNA barcoding

Genetic Resources and Crop Evolution ◽

10.1007/s10722-021-01276-4 ◽

2021 ◽

Author(s):

Dawei Chen ◽

Hui Zhang ◽

Libo Chang ◽

Lingyun Jia ◽

Kun Sun

Keyword(s):

Dna Barcoding ◽

Molecular Identification

Download Full-text

Use of molecular methods in identification of species, age and sex of insects useful in forensic entomology

Issues of Forensic Science ◽

10.34836/pk.2014.286.4 ◽

2014 ◽

Vol 286 ◽

pp. 66-69

Author(s):

Joanna Stojak ◽

Keyword(s):

Dna Barcoding ◽

Species Identification ◽

Environmental Conditions ◽

Forensic Entomology ◽

Sex Identification ◽

The Body ◽

Molecular Methods ◽

Insect Larvae ◽

Identification Of Species ◽

Age And Sex

Forensic entomology uses insects to determine the time, cause and place of death. To this end, two entomological methods are used. The development-based method uses the patterns of insect larvae development under the specific thermal and environmental conditions. The succession-based method analyzes the sequence of insect succession on the body in various environmental conditions. The proper insect species identification is essential in both methods. In this article, the molecular methods of species, age and sex identification are presented such as DNA barcoding or DNA-HRM-PCR.

Download Full-text