Potensi dan Karakteristik Bakteri Simbion Karang Lunak Sinularia sp. sebagai Anti Bakteri Escherichia coli dari Perairan Pulau Gili Labak Madura Indonesia

Gili Labak merupakan pulau kecil di Kabupaten Sumenep-Madura yang memiliki keanekaragaman karang lunak melimpah salah satunya Sinularia sp.. Beberapa studi literatur menyatakan bahwa Sinularia sp. memiliki berbagai jenis bakteri simbion yang berperan penting dalam siklus hidup karang lunak ini. Bakteri yang bersimbiosis dengan Sinularia sp. memiliki potensi besar sebagai agen anti bakteri khususnya bakteri gram negatif Escherichia coli. Identifikasi isolat bakteri yang bersimbiosis dengan Sinularia sp. ini merupakan alternatif upaya pemanfaatan sumberdaya karang lunak secara konservatif dan keberlanjutan. Penelitian ini bertujuan untuk mengetahui potensi anti bakteri dan mengidentifikasi jenis bakteri simbion dari ekstrak karang lunak Sinularia Sp. yang berasal dari perairan Gili Labak Madura. Metode yang digunakan dalam penelitian ini adalah uji zona hambat bakteri menggunakan overlay dan metode difusi dengan media ZoBell 2216E. Karakteristik molekuler sampel diamati menggunakan metode PCR 16s rDNA dengan ekstraksi DNA menggunakan Chelex 100 dan Primer amplifikasi PCR 27F dan 1492R. Pohon filogenetik dibangun dengan menggunakan aplikasi MEGA 6. Hasil penelitian diketahui dari 4 isolat bakteri (L2.2, L2.3, L2.4, dan L2.5), terdapat 1 isolat yang yang memiliki aktivitas antibakteri Escherichia coli kuat yaitu Isolat L2.5. Isolat L2.5 memiliki diameter zona hambat terbesar yaitu 2.207 ± 0.401 cm. Strain bakteri aktif di Isolat L2.5 adalah Virgibacillus marismortui dengan kemiripan urutan 100%. Hasil penelitian ini menjadi informasi awal yang dapat digunakan sebagai referensi untuk mengoptimalkan potensi pemanfaatan bakteri Virgibacillus marismortui di bidang bioteknologi laut khususnya industri farmasi di masa yang akan datang. Gili Labak is a small island in Madura district which has a diversity of soft coral Sinularia sp. Several literature studies state that Sinularia sp. has various types of symbiotic bacteria that play an important role in the life cycle of this soft coral. This symbiotic bacterium with Sinularia sp. has great potential as an antibacterial agent especially inhibiting of gram-negative bacteria Escherichia coli. Identification of bacterial isolates that are in symbiosis with Sinularia sp. is an alternative to conservative and sustainable use of soft coral resources. This study aims to determine the anti-bacterial potential and identify the type of bacteria from the soft coral extract of Sinularia sp. from the waters of Gili Labak-Madura. The method used in this research is bacterial inhibition zone test using overlay and diffusion methods with ZoBell 2216E media. Molecular characteristics of samples were observed using PCR 16s rDNA method with DNA extraction using Chelex 100 and PCR amplification primers 27F and 1492R. Phylogenetic trees were constructed using MEGA 6 application. The results showed that there were 4 isolates (L2.2, L2.3, L2.4, and L2.5), there was 1 isolate that had strong Escherichia coli antibacterial activity, namely Isolate L2.5. L2.5 isolate has the largest inhibitory zone diameter of 2.207 ± 0.401 cm. The active bacterial strain in the L2.5 isolate was Virgibacillus marismortui with 100% sequence similarity. The results of this study serve as initial information that can be used as a reference to optimize the potential utilization of Virgibacillus marismortui bacteria in marine biotechnology, especially the pharmaceutical industry in the future.

A New Tool for Faster Construction of Marine Biotechnology Collaborative Networks

The increasing and rapid development in technologies, infrastructures, computational power, data availability and information flow has enabled rapid scientific advances. These entail transdisciplinary collaborations that maximize sharing of data and knowledge and, consequently, results, and possible technology transfer. However, in emerging scientific fields it is sometimes difficult to provide all necessary expertise within existing collaborative circles. This is especially true for marine biotechnology that directly addresses global societal challenges. This article describes the creation of a platform dedicated to facilitating the formation of short or mid-term collaborative networks in marine biotechnology. This online platform (https://www.ocean4biotech.eu/map/) enables experts (researchers and members of the marine biotechnology community in general) to have the possibility to showcase their expertise with the aim of being integrated into new collaborations/consortia on the one hand, or to use it as a search tool to complement the expertise in planned/running collaborations, on the other. The platform was created within the Ocean4Biotech (European transdisciplinary networking platform for marine biotechnology) Action, funded under the framework of the European Cooperation in Science and Technology (COST). To build the platform, an inquiry was developed to identify experts in marine biotechnology and its adjunct fields, to define their expertise, to highlight their infrastructures and facilities and to pinpoint the main bottlenecks in this field. The inquiry was open to all experts in the broad field of marine biotechnology, including non-members of the consortium. The inquiry (https://ee.kobotoolbox.org/single/UKVsBNtD) remains open for insertion of additional expertise and the resulting interactive map can be used as a display and search tool for establishing new collaborations.

Blue Economy and Blue Activities: Opportunities, Challenges, and Recommendations for The Bahamas

Following the global shutdown of tourism at the onset of the COVID-19 pandemic, small island developing states such as The Bahamas had their economies immobilized due to their heavy dependence on the industry. Beyond economic recovery in a post COVID-19 paradigm, the blue economy, blue growth, and associated activities offer pathways for a more resilient economy and is well-suited for The Bahamas. This paper suggests conduits for economic development using a traditional strength, coastal and marine tourism, in conjunction with the emerging fields of ocean renewable energy, offshore aquaculture, marine biotechnology, and bioprospecting. The interlinkages between each activity are discussed. Knowledge gaps in offshore aquaculture, ocean renewable energy, marine biotechnology, and marine environment monitoring are identified. In each sector case, strategic and tactical decision-making can be achieved through the exploitation of ocean numerical modeling and observations, and consequently should be invested in and developed alongside the requisite computational resources. Blue growth is encouraged, but instances of blue injustice are also highlighted. Crucially, pursuing blue economy activities should be given top national priority for economic recovery and prosperity.

Genomic Characterization of the Barnacle Balanus improvisus Reveals Extreme Nucleotide Diversity in Coding Regions

Barnacles are key marine crustaceans in several habitats, and they constitute a common practical problem by causing biofouling on man-made marine constructions and ships. Despite causing considerable ecological and economic impacts, there is a surprising void of basic genomic knowledge, and a barnacle reference genome is lacking. We here set out to characterize the genome of the bay barnacle Balanus improvisus (= Amphibalanus improvisus) based on short-read whole-genome sequencing and experimental genome size estimation. We show both experimentally (DNA staining and flow cytometry) and computationally (k-mer analysis) that B. improvisus has a haploid genome size of ~ 740 Mbp. A pilot genome assembly rendered a total assembly size of ~ 600 Mbp and was highly fragmented with an N50 of only 2.2 kbp. Further assembly-based and assembly-free analyses revealed that the very limited assembly contiguity is due to the B. improvisus genome having an extremely high nucleotide diversity (π) in coding regions (average π ≈ 5% and average π in fourfold degenerate sites ≈ 20%), and an overall high repeat content (at least 40%). We also report on high variation in the α-octopamine receptor OctA (average π = 3.6%), which might increase the risk that barnacle populations evolve resistance toward antifouling agents. The genomic features described here can help in planning for a future high-quality reference genome, which is urgently needed to properly explore and understand proteins of interest in barnacle biology and marine biotechnology and for developing better antifouling strategies.

The Essentials of Marine Biotechnology

Coastal countries have traditionally relied on the existing marine resources (e.g., fishing, food, transport, recreation, and tourism) as well as tried to support new economic endeavors (ocean energy, desalination for water supply, and seabed mining). Modern societies and lifestyle resulted in an increased demand for dietary diversity, better health and well-being, new biomedicines, natural cosmeceuticals, environmental conservation, and sustainable energy sources. These societal needs stimulated the interest of researchers on the diverse and underexplored marine environments as promising and sustainable sources of biomolecules and biomass, and they are addressed by the emerging field of marine (blue) biotechnology. Blue biotechnology provides opportunities for a wide range of initiatives of commercial interest for the pharmaceutical, biomedical, cosmetic, nutraceutical, food, feed, agricultural, and related industries. This article synthesizes the essence, opportunities, responsibilities, and challenges encountered in marine biotechnology and outlines the attainment and valorization of directly derived or bio-inspired products from marine organisms. First, the concept of bioeconomy is introduced. Then, the diversity of marine bioresources including an overview of the most prominent marine organisms and their potential for biotechnological uses are described. This is followed by introducing methodologies for exploration of these resources and the main use case scenarios in energy, food and feed, agronomy, bioremediation and climate change, cosmeceuticals, bio-inspired materials, healthcare, and well-being sectors. The key aspects in the fields of legislation and funding are provided, with the emphasis on the importance of communication and stakeholder engagement at all levels of biotechnology development. Finally, vital overarching concepts, such as the quadruple helix and Responsible Research and Innovation principle are highlighted as important to follow within the marine biotechnology field. The authors of this review are collaborating under the European Commission-funded Cooperation in Science and Technology (COST) Action Ocean4Biotech – European transdisciplinary networking platform for marine biotechnology and focus the study on the European state of affairs.

Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).

Marine Biotechnology: Challenges and Development Market Trends for the Enhancement of Biotic Resources in Industrial Pharmaceutical and Food Applications. A Statistical Analysis of Scientific Literature and Business Models

Biotechnology is an essential tool for the sustainable exploitation of marine resources, although the full development of their potential is complicated by a series of cognitive and technological limitations. Thanks to an innovative systematic approach that combines the meta-analysis of 620 articles produced worldwide with 29 high TRL (Technology Readiness Level) European funded projects, the study provides an assessment of the growth prospects of blue biotechnologies, with a focus on pharmaceutical and food applications, and the most promising technologies to overcome the main challenges in the commercialization of marine products. The results show a positive development trend, with publications more than doubled from 2010 (36) to 2019 (70). Biochemical and molecular characterization, with 150 studies, is the most widely used technology. However, the emerging technologies in basic research are omics technologies, pharmacological analysis and bioinformatics, which have doubled the number of publications in the last five years. On the other hand, technologies for optimizing the conditions of cultivation, harvesting and extraction are central to most business models with immediate commercial exploitation (65% of high-TRL selected projects), especially in food and nutraceutical applications. This research offers a starting point for future research to overcome all those obstacles that restrict the marketing of products derived from organisms.

Nutraceuticals

Therapeutic compounds can be derived from various natural sources like plants, animals, marine organisms, and micro-organisms. Although the marine biota accounts for around 50% of the total world biodiversity, their potential as a rich source of bioactive products and their applications in both pharmaceutical and nutraceutical industries have only recently been identified through several scientific studies. Marine biotechnology is an upcoming area that involves about the study of marine microorganisms and animals including algae, sponges, and coral as a novel source of bioactive substances that can be used in the treatment of various human diseases like cancer, anaemia, diarrhea, obesity, diabetes, atopic dermatitis, Crohn's disease, etc. Very limited scientific data is available on the bioactive potential of marine microorganisms. This chapter deals with the exploitation of microbes from marine sources as potential sources for various nutraceuticals and their possibilities for applications in a variety of diseases and as functional food supplement.