Suppression of Rhizoctonia solani anastomosis group 8 in Australia and its biological nature

1996 ◽  
Vol 28 (6) ◽  
pp. 727-732 ◽  
Author(s):  
Bronwyn M. Wiseman ◽  
S.M. Neate ◽  
K.Ophel Keller ◽  
S.E. Smith
Keyword(s):  
Rhizoctonia Solani ◽  
Anastomosis Group ◽  
Biological Nature

scholarly journals Temperature, Moisture, and Seed Treatment Effects on Rhizoctonia solani Root Rot of Soybean

Plant Disease ◽  
2003 ◽  
Vol 87 (5) ◽  
pp. 533-538 ◽  
Author(s):  
A. E. Dorrance ◽  
M. D. Kleinhenz ◽  
S. A. McClure ◽  
N. T. Tuttle
Keyword(s):  
Soil Moisture ◽  
Rhizoctonia Solani ◽  
Root Rot ◽  
Seed Treatment ◽  
Anastomosis Group ◽  
Control Measures ◽  
Root Weight ◽  
Wide Range ◽  
Plant Stand ◽  
Growth Chamber Studies

The effects of temperature and soil moisture on infection and disease development by Rhizoctonia solani on soybean were studied individually. In addition, the anastomosis group of R. solani isolates recovered from soybean from 35 fields in 15 counties was determined. All of the 44 isolates recovered in this study were AG-2-2 IIIB. Five isolates of R. solani were able to infect and colonize soybean roots and hypocotyls at 20, 24, 28, and 32°C in growth chamber studies. The temperatures evaluated in this study were not limiting to the isolates tested. In greenhouse studies, nine R. solani isolates and a noninoculated control were evaluated at 25, 50, 75, and 100% soil moisture holding capacity (MHC). Root weights were greater and percent stand averages higher at 50 and 75% than at 25 or 100% MHC; however, as percentage of control, the main effect on percent moisture for percent stand, plant height, or root weight was not significant. There were significant differences among the isolates for the percent stand, root rot rating, and root fresh weight of soybean in each study. In both temperature and moisture studies, the R. solani isolates could be separated as predominantly causing (i) seed rot, as detected by greatly reduced plant stand; (ii) root rot generally having no effect on plant stand but a high root rot rating and low root weight; or (iii) hypocotyl lesions, having no effect on plant stand, a low root rot score, and a high number of red lesions on the hypocotyl. In the greenhouse seed treatment evaluations of five fungicides, there was no fungicide by isolate interaction using these pathogenic types of R. solani. None of the seed treatments evaluated in this study provided 100% control of the four isolates tested. Due to the wide range of environmental factors that permit R. solani infection and disease on soybeans, other control measures that last all season, such as host resistance, should be emphasized.

Highly polymorphic microsatellite loci in the rice- and maize-infecting fungal pathogen Rhizoctonia solani anastomosis group 1 IA

2008 ◽  
Vol 8 (3) ◽  
pp. 686-689 ◽  
Author(s):  
M. ZALA ◽  
B. A. MCDONALD ◽  
J. BERNARDES DE ASSIS ◽  
M. B. CIAMPI ◽  
M. STORARI ◽  
...  
Keyword(s):  
Rhizoctonia Solani ◽  
Microsatellite Loci ◽  
Fungal Pathogen ◽  
Anastomosis Group ◽  
Polymorphic Microsatellite ◽  
Group 1

Characterization of a new subgroup of Rhizoctonia solani anastomosis group 3 (AG-3 TM) associated with tomato leaf blight

2020 ◽  
Vol 86 (6) ◽  
pp. 457-467
Author(s):  
Tomoo Misawa ◽  
Daisuke Kurose ◽  
Kuniaki Shishido ◽  
Takeshi Toda ◽  
Shiro Kuninaga
Keyword(s):  
Rhizoctonia Solani ◽  
Anastomosis Group ◽  
Tomato Leaf ◽  
Leaf Blight ◽  
Group 3

scholarly journals Rhizoctonia solani Anastomosis Group 3 is Predominant in Potato Tubers in Poland

Plant Disease ◽  
2013 ◽  
Vol 97 (9) ◽  
pp. 1245-1245 ◽  
Author(s):  
J. W. Woodhall ◽  
B. Lutomirska ◽  
J. C. Peters ◽  
P. S. Wharton
Keyword(s):  
Rhizoctonia Solani ◽  
Tap Water ◽  
Anastomosis Group ◽  
Black Scurf ◽  
Crop Rotations ◽  
Potato Tubers ◽  
Hyphal Fusion ◽  
Group 3 ◽  
Plant Pathol ◽  
Potato Crops

Rhizoctonia solani is a species complex of 13 related but genetically distinct anastomosis groups (AGs). In potato, R. solani can infect the stems, stolons, and roots, resulting in quantitative losses. It can also cause qualitative losses through blemishes occurring on progeny tubers, such as black scurf and elephant hide (corky cracking). Knowledge of the AG in local populations is important because they differ in host range, fungicide sensitivity, and disease severity (2). To determine the AGs present in Poland, 54 tuber samples displaying typical R. solani symptoms were taken from six different fields in 2011. The fields were representative of five different administrative regions of Poland and from at least 10 different varieties. Rhizoctonia was isolated from tubers by placing symptomatic material on to tap water agar amended with streptomycin and penicillin and after 2 to 3 days Rhizoctonia colonies were identified and hyphal tips of these transferred to potato dextrose agar. Rhizoctonia was successfully isolated from 48 tubers displaying black scurf and two tubers displaying elephant hide symptoms. DNA was extracted from Rhizoctonia cultures using a Wizard Food kit (Promega) and the AG was determined using specific real-time PCR assays (1). All Rhizoctonia isolates were determined to be AG3 and this was confirmed for 10 selected isolates by observing hyphal fusion with a known AG3 tester isolate (Rs08) as described previously (3). Pairings were also conducted amongst the 10 Polish isolates, C2 reactions were typically observed indicating numerous vegetative compatible groups are present. This study shows that AG3 is likely to be the predominant AG in potato tubers in Poland. This is similar to other studies in Europe, which have all determined that AG3 accounts for at least 92% of isolates from potato (2,3). AG2-1, 4, and 5 have also been found in tubers worldwide and climate and certain crop rotations can influence the presence of these other AGs in potato tubers (2). However, climate and crop rotations in Poland are similar to other parts of Europe so the predominance of AG3 is expected. AG3 was also isolated from elephant hide symptoms; however, it was more frequently isolated from sclerotia. The ability of AG3 to prolifically produce sclerotia and thereby survive on seed tubers may explain its predominance in potato crops (4). Therefore, studies focusing on the management of Rhizoctonia potato disease in Poland should consider AG3 in the first instance. References: (1) G. E. Budge et al. Plant Pathol. 58:1071, 2009. (2) L. Tsror. J. Phytopathol. 158:649, 2010. (3) J. W. Woodhall et al. Plant Pathol. 56:286, 2007. (4) J. W. Woodhall et al. Plant Pathol. 57:5, 2008.

Severity, Distribution, and Losses from Taproot Cankers Caused by Rhizoctonia solani in Peanuts1

1988 ◽  
Vol 15 (2) ◽  
pp. 73-75 ◽  
Author(s):  
John T. Turner ◽  
Paul A. Backman
Keyword(s):  
Rhizoctonia Solani ◽  
Surface Area ◽  
Disease Severity ◽  
Negative Correlation ◽  
Root Rot ◽  
High Frequency ◽  
Significant Negative Correlation ◽  
Anastomosis Group ◽  
Group 4

Abstract Research on the ecology of peanut roots from fields in Georgia, Florida, and Alabama revealed a high frequency of sunken, dark cankers on the taproot which persisted to harvest. Isolations from these cankers resulted in recovery of Rhizoctonia solani anastomosis group 4 (AG-4) from more than 50% of the cankers. A survey of peanut fields being harvested during early September revealed that 28% of the fields had an average of more than 50% of the taproot surface area cankered. In contrast, for fields in the same area harvested one month later, 77% had disease severities of less than 25% and none were greater than 50%. In an experiment conducted in 1984, roots from 64 plots were examined and rated for root rot severity and yield. When taproot disease severity was regressed against yield, a highly significant negative correlation (r2 − 0.60, P<0.01) was found.

scholarly journals First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 456-456 ◽  
Author(s):  
G. Mercado Cárdenas ◽  
M. Galván ◽  
V. Barrera ◽  
M. Carmona
Keyword(s):  
Rhizoctonia Solani ◽  
Morphological Characteristics ◽  
Its Region ◽  
Morphological Characters ◽  
Anastomosis Group ◽  
Staining Procedure ◽  
Nuclear Staining ◽  
Tobacco Plants ◽  
First Report ◽  
Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

scholarly journals Characterization and Pathogenicity of Rhizoctonia solani Isolates Affecting Pisum sativum in North Dakota

Plant Disease ◽  
2012 ◽  
Vol 96 (5) ◽  
pp. 666-672 ◽  
Author(s):  
F. M. Mathew ◽  
R. S. Lamppa ◽  
K. Chittem ◽  
Y. W. Chang ◽  
M. Botschner ◽  
...  
Keyword(s):  
Pisum Sativum ◽  
North Dakota ◽  
Rhizoctonia Solani ◽  
Resistance Breeding ◽  
Its Region ◽  
Anastomosis Group ◽  
Field Pea ◽  
State University ◽  
Dry Bean ◽  
North Dakota State University

Acreage of dry field pea (Pisum sativum) in North Dakota has increased approximately eightfold from the late 1990s to the late 2000s to over 200,000 ha annually. A coincidental increase in losses to root rots has also been observed. Root rot in dry field pea is commonly caused by a complex of pathogens which included Fusarium spp. and Rhizoctonia solani. R. solani isolates were obtained from roots sampled at the three- to five-node growth stage from North Dakota pea fields and from symptomatic samples received at the Plant Diagnostic Lab at North Dakota State University in 2008 and 2009. Using Bayesian inference and maximum likelihood analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA), 17 R. solani pea isolates were determined to belong to anastomosis group (AG)-4 homogenous group (HG)-II and two isolates to AG-5. Pathogenicity of select pea isolates was determined on field pea and two rotation hosts, soybean and dry bean. All isolates caused disease on all hosts; however, the median disease ratings were higher on green pea, dry bean, and soybean cultivars when inoculated with pea isolate AG-4 HG-II. Identification of R. solani AGs and subgroups on field pea and determination of relative pathogenicity on rotational hosts is important for effective resistance breeding and appropriate rotation strategies.

scholarly journals A New Method for the Quantification of Rhizoctonia solani and R. oryzae from Soil

Plant Disease ◽  
2005 ◽  
Vol 89 (7) ◽  
pp. 767-772 ◽  
Author(s):  
T. C. Paulitz ◽  
K. L. Schroeder
Keyword(s):  
Rhizoctonia Solani ◽  
Pacific Northwest ◽  
Slow Growth ◽  
Anastomosis Group ◽  
Selective Medium ◽  
Soil Cores ◽  
Hyphal Morphology ◽  
Detection And Diagnosis ◽  
Production Areas ◽  
Inexpensive Technique

Rhizoctonia solani anastomosis group (AG) 8 and R. oryzae are important root pathogens on wheat and barley in the dryland production areas of the inland Pacific Northwest. R. solani AG-8 is difficult to isolate from root systems and quantify in soil because of slow growth and low population densities. However, both pathogens form extensive hyphal networks in the soil and can grow a considerable distance from a food base. A quantitative assay of active hyphae was developed, using wooden toothpicks as baits inserted into sample soils. After 2 days in soil, toothpicks were placed on a selective medium, and the numbers of colonies that grew after 24 h were counted under a dissecting microscope. R. solani and R. oryzae could be distinguished from other fungi based on hyphal morphology. This method was tested in natural soils amended with known inoculum densities of R. solani AG-8 and R. oryzae. Regressions were used to compare the inoculum density or toothpick colonization curves to a predicted curve based on the volume of the toothpicks. The slopes and y intercept of log-log transformed regressions did not differ from the predicted curves in most cases. This technique was used to assess the hyphal activity of R. solani AG-8 and R. oryzae from soil cores taken from various positions in and around Rhizoctonia bare patches at two locations. Activity of R. solani was highest in the center and inside edge of the patch, but there was no effect of patch position on R. oryzae. This simple and inexpensive technique can be used for detection and diagnosis in grower fields and to study the ecology and epidemiology of Rhizoctonia spp.

scholarly journals Controlling Rhizoctonia Damping-off of Chinese Mustard by Using Endomycorrhizal Rhizoctonia spp. Isolated from Orchid Mycorrhizae

Plant Disease ◽  
2016 ◽  
Vol 100 (1) ◽  
pp. 85-91 ◽  
Author(s):  
Jr-Hau Jiang ◽  
Si-Loi Tam ◽  
Takeshi Toda ◽  
Lung-Chung Chen
Keyword(s):  
Phylogenetic Analysis ◽  
Rhizoctonia Solani ◽  
Disease Severity ◽  
Anastomosis Group ◽  
Effective Strategy ◽  
Damping Off ◽  
Binucleate Rhizoctonia ◽  
Orchid Mycorrhizae ◽  
Almost All ◽  
Test Plants

Inoculation of hypovirulent Rhizoctonia spp. has been recognized as an effective strategy for protecting plants against damping-off caused by pathogenic Rhizoctonia spp. In this study, endomycorrhizal Rhizoctonia spp. isolated from fungal pelotons in orchid plants were used for controlling Rhizoctonia damping-off of Chinese mustard. According to phylogenetic analysis and anastomosis group (AG) determination, the virulence of three isolates of multinucleate Rhizoctonia solani in AG-6; eight isolates of binucleate Rhizoctonia in AG-A, AG-B, AG-G, AG-P, and AG-R; and two isolates of binucleate R. repens were evaluated using test plants. All isolates, except that in AG-R, caused low disease severity in 10-day-old radish (0.10 to 0.61), cucumber (0.28 to 0.54), and Chinese mustard (0.18 to 0.65). By contrast, pathogenic isolates in AG-4 killed almost all test plants with symptoms of collapsed hypocotyl and wilted leaves (0.88 to 0.96). Of the 13 endomycorrhizal Rhizoctonia isolates assessed, AG-P isolates Cno10-3 and CalS1-2 provided 91 and 100% protection, respectively, against R. solani AG-4 in 26-day-old Chinese mustard. This study revealed that endomycorrhizal Rhizoctonia spp. in orchid have the potential to biologically control damping-off of Chinese mustard.

Sign in / Sign up

Export Citation Format

Share Document