Asymmetrical allocation of mitochondrial DNA to blastomeres during the first two cleavages in mouse embryos

2010 ◽  
Vol 22 (8) ◽  
pp. 1247 ◽  
Author(s):  
Yuichi Kameyama ◽  
Hidehisa Ohnishi ◽  
Gaku Shimoi ◽  
Ryoichi Hashizume ◽  
Masao Ito ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Inner Cell Mass ◽  
Cell Mass ◽  
Atp Content ◽  
Mtdna Copy Number ◽  
Early Cleavage ◽  
Atp Production ◽  
Trophectoderm Cells ◽  
Whole Egg

A recent report showed higher oxygen consumption, adenosine triphosphate (ATP) production and mitochondrial localisation in trophectoderm cells than in the inner cell mass of mouse blastocysts. We hypothesised that this phenomenon was due to the asymmetrical distribution of mitochondria in the blastomeres during the earlier stages. Oocytes, 2-cell embryos and 4-cell embryos were analysed to determine the volume, ATP content and mitochondrial DNA (mtDNA) copy number in the whole egg and individual blastomeres. Significant differences were detected in the volumes of cytoplasm and ATP contents between blastomeres from the 2-cell and 4-cell embryos. Moreover, whilst remaining stable in whole embryos, mtDNA copy number differed between blastomeres, indicating that mitochondria in oocytes are unevenly delivered into the daughter blastomeres during the first two cleavages. Although their volume and ATP content were not correlated, there was a significant correlation between volume and mtDNA copy number in 2- and 4-cell blastomeres. These results indicate that the number of mitochondria delivered to blastomeres during early cleavage is not precisely equal, suggesting that the allocation of mitochondria into daughter blastomeres is affected by uneven cytoplasmic distribution during cytokinesis in the oocyte and mother blastomeres.

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

2021 ◽  
Vol 33 (2) ◽  
pp. 123
Author(s):  
E. J. Gutierrez ◽  
F. B. Diaz ◽  
K. R. Bondioli
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Pure Water ◽  
Digital Pcr ◽  
Control Group ◽  
Atp Content ◽  
Mtdna Copy Number ◽  
Atp Production ◽  
Mitochondrial Dna Copy Number ◽  
Mitochondrial Number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P<0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

scholarly journals Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.

2006 ◽  
Vol 53 (3) ◽  
pp. 485-495 ◽  
Author(s):  
Janusz Piechota ◽  
Roman Szczesny ◽  
Kamila Wolanin ◽  
Aleksander Chlebowski ◽  
Ewa Bartnik
Keyword(s):  
Mitochondrial Dna ◽  
Mitochondrial Genome ◽  
Oxidative Phosphorylation ◽  
Hela Cells ◽  
Transcription Initiation ◽  
Copy Number ◽  
Mitochondrial Haplotype ◽  
Mtdna Copy Number ◽  
Atp Production ◽  
Bioenergetic Metabolism

The influence of mutations in the mitochondrial DNA (mtDNA) on the bioenergetic metabolism of the cell is still poorly understood. Many of the mutations in the mtDNA affect the expression of the mitochondrial genome. Investigations on cells from patients are not easy, especially as the mitochondrial DNA is heteroplasmic and this state is changed in culture. Moreover, the nuclear background and the mitochondrial haplotype may affect the behaviour of cells. Transfer of patient mitochondria to rho zero cell lines is also not optimal as these cells in general have many nuclear changes which may also affect cell behaviour. Thus, we decided to use inhibitors of mitochondrial genome expression, such as thiamphenicol, ethidium bromide and dideoxycytidine to investigate the bioenergetic metabolism of HeLa cells. We found that oxidative phosphorylation and glycolysis participate equally in ATP production in HeLa cells and that decreased activity of the respiratory chain leads to increased glycolysis and the reduction of cell growth. Insufficient ATP production in the oxidative phosphorylation process was not compensated by increased proliferation of the mitochondria. However, we were able to show that there are some mechanisms compensating limited expression of the mitochondrial genome within the mitochondria. Experiments with dideoxycytidine revealed that 10-fold decrease of the mtDNA copy number resulted in almost normal activity of cytochrome c oxidase. We found that mtDNA depletion is compensated mostly on the level of RNA metabolism in the mitochondria. Thus, our results are in agreement with the hypothesis that transcription initiation rather than mtDNA copy number is a rate limiting factor for expression of the mitochondrial genome.

Interactions of blastomeres suggest changes in cell surface adhesiveness during the formation of inner cell mass and trophectoderm in the preimplantation mouse embryo

Development ◽  
1982 ◽  
Vol 70 (1) ◽  
pp. 133-152
Author(s):  
Susan J. Kimber ◽  
M. Azim ◽  
H. Surani ◽  
Sheila C. Barton
Keyword(s):  
Inner Cell Mass ◽  
Single Cells ◽  
Cell Mass ◽  
Cell Stage ◽  
Trophectoderm Cells ◽  
Adhesive Surface ◽  
Preimplantation Mouse Embryo ◽  
Divergent Differentiation ◽  
Preimplantation Mouse ◽  
The Difference

Whole 8-cell morulae can be aggregated with isolated inner cell masses from blastocysts. On examining semithin light microscope sections of such aggregates we found that cells of the morula changed shape and spread over the surface of the ICM, thus translocating it to the inside of the aggregate. Using single cells from 8-cell embryos in combination with single cells from other stage embryos or isolated ICMs we show that 1/8 blastomeres spread over other cells providing a suitably adhesive surface. The incidence of spreading is high with inner cells from 16-cell embryos (56 %) and 32-cell embryos (62%) and isolated inner cell masses (64%). In contrast, the incidence of spreading of 1/8 blastomeres is low over outer cells from 16-cell embryos (26%) and 32-cell embryos (13%). Blastomeres from 8-cell embryos do not spread over unfertilized 1-cell eggs, 1/2 or 1/4 cells or trophectoderm cells contaminating isolated ICMs. When 1/8 cells are aggregated in pairs they flatten on one another (equal spreading) as occurs at compaction in whole 8-cell embryos. However, if 1/8 is allowed to divide to 2/16 in culture one of the cells engulfs the other (51-62/ pairs). Based on the ideas of Holtfreter (1943) and Steinberg (1964,1978) these results are interpreted to indicate an increase in adhesiveness at the 8-cell stage as well as cytoskeletal mobilization. Following the 8-cell stage there is an increase in adhesiveness of inside cells while the outside cells decrease in adhesiveness. The difference in adhesiveness between inside and outside cells in late morulae is probably central to the divergent differentiation of (inner) ICM and (outer) trophectoderm cell populations.

scholarly journals mtDNA in the Pathogenesis of Cardiovascular Diseases

2021 ◽  
Vol 2021 ◽  
pp. 1-8
Author(s):  
Lili Wang ◽  
Qianhui Zhang ◽  
Kexin Yuan ◽  
Jing Yuan
Keyword(s):  
Heart Failure ◽  
Cardiovascular Disease ◽  
Mitochondrial Dna ◽  
Copy Number ◽  
Heart Diseases ◽  
Mtdna Copy Number ◽  
Cardiac Inflammation ◽  
Ischemic Heart Diseases ◽  
Metabolic Functions ◽  
Underlying Mechanisms

The incidence rate of cardiovascular disease (CVD) has been increasing year by year and has become the main cause for the increase of mortality. Mitochondrial DNA (mtDNA) plays a crucial role in the pathogenesis of CVD, especially in heart failure and ischemic heart diseases. With the deepening of research, more and more evidence showed that mtDNA is related to the occurrence and development of CVD. Current studies mainly focus on how mtDNA copy number, an indirect biomarker of mitochondrial function, contributes to CVD and its underlying mechanisms including mtDNA autophagy, the effect of mtDNA on cardiac inflammation, and related metabolic functions. However, no relevant studies have been conducted yet. In this paper, we combed the current research status of the mechanism related to the influence of mtDNA on the occurrence, development, and prognosis of CVD, so as to find whether these mechanisms have something in common, or is there a correlation between each mechanism for the development of CVD?

scholarly journals A sex chromosome inversion is associated with copy number variation of mitochondrial DNA in zebra finch sperm

2019 ◽  
Author(s):  
Ulrich Knief ◽  
Wolfgang Forstmeier ◽  
Bart Kempenaers ◽  
Jochen B. W. Wolf
Keyword(s):  
Mitochondrial Dna ◽  
Zebra Finch ◽  
Copy Number ◽  
Sex Chromosome ◽  
Data Availability ◽  
Species Variation ◽  
Zebra Finches ◽  
Chromosome Inversion ◽  
Atp Production ◽  
Sperm Midpiece

AbstractPropulsion of sperm cells via movement of the flagellum is of vital importance for successful fertilization. Presumably, the energy for this movement comes from the mitochondria in the sperm midpiece. Larger midpieces may contain more mitochondria, which should enhance the energetic capacity and hence promote mobility. Due to an inversion polymorphism on their sex chromosome TguZ, zebra finches (Taeniopygia guttata castanotis) exhibit large within-species variation in sperm midpiece length, and those sperm with the longest midpieces swim the fastest. Here, we test through quantitative real-time PCR in zebra finch ejaculates whether the inversion genotype has an effect on the copy number of mitochondrial DNA. Taking the inversion genotype as a proxy for midpiece length, we find that zebra finches with longer midpieces indeed have more copies of the mitochondrial DNA in their ejaculates than those with shorter midpieces, with potential downstream effects on the rate of ATP production and sperm swimming speed. This study sheds light on the proximate cause of a fitness-relevant genetic polymorphism, suggesting the involvement of central components of gamete energy metabolism.Data availabilitySupplementary data file

Trophectodermal processes regulate the expression of totipotency within the inner cell mass of the mouse expanding blastocyst

Development ◽  
1984 ◽  
Vol 84 (1) ◽  
pp. 63-90
Author(s):  
Tom P. Fleming ◽  
Paul D. Warren ◽  
Julia C. Chisholm ◽  
Martin H. Johnson
Keyword(s):  
Inner Cell Mass ◽  
Cell Mass ◽  
Central Area ◽  
Ultrastructural Changes ◽  
Trophectoderm Cells ◽  
Junctional Complexes ◽  
Secondary Lysosomes ◽  
Cytoplasmic Processes ◽  
Cellular Cover

Mouse blastocysts, aged 0, 2, 6 and 12 h from the onset of cavitation, were examined by transmission (TEM) and scanning (SEM) electron microscopy. In TEM sections, trophectoderm cells (TE) differed morphologically from those of the inner cell mass (ICM) by their flattened shape, paler cytosol staining and polarized disposition of both junctional complexes (apicolateral) and intracellular secondary lysosomes (SL; basal). Throughout this period of development, cytoplasmic processes, characterized by abundant SLs, cover approximately 80 % of the juxtacoelic face of the ICM. These processes are shown to be derived from the basal surface of TE cells intermediately placed between polar and mural regions. In SEM preparations of the juxtacoelic ICM surface, revealed by ‘cracking open’ blastocysts, the processes appear as tongue-shaped, centripetally oriented structures which terminate collectively at a central area on the ICM surface. The potential of cultured ICMs to generate TE was demonstrated following their immunosurgical isolation from blastocysts aged up to 12 h post cavitation and by examining the sequence of ultrastructural changes associated with TE generation by ICMs from 2 h blastocysts. In contrast, the juxtacoelic cells of similarly aged ICMs observed in situ in ultrasections of intact embryos showed little or no evidence of totipotency expression as judged by the absence of TE characteristics. Since TE expression within presumptive ICM cells is thought to be generated by an asymmetry of cell contacts (Johnson & Ziomek, 1983), we propose that the juxtacoelic TE processes, by providing a cellular cover to the ICM, function in suppressing the expression in situ of ICM totipotency.

scholarly journals Targeting reduced mitochondrial DNA quantity as a therapeutic approach in pediatric high-grade gliomas

2019 ◽  
Vol 22 (1) ◽  
pp. 139-151 ◽  
Author(s):  
Han Shen ◽  
Man Yu ◽  
Maria Tsoli ◽  
Cecilia Chang ◽  
Swapna Joshi ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Glucose Metabolism ◽  
Mitochondrial Function ◽  
Copy Number ◽  
Pyruvate Dehydrogenase Kinase ◽  
High Grade ◽  
Mtdna Copy Number ◽  
Mitochondrial Oxidation ◽  
High Grade Gliomas

Abstract Background Despite increased understanding of the genetic events underlying pediatric high-grade gliomas (pHGGs), therapeutic progress is static, with poor understanding of nongenomic drivers. We therefore investigated the role of alterations in mitochondrial function and developed an effective combination therapy against pHGGs. Methods Mitochondrial DNA (mtDNA) copy number was measured in a cohort of 60 pHGGs. The implication of mtDNA alteration in pHGG tumorigenesis was studied and followed by an efficacy investigation using patient-derived cultures and orthotopic xenografts. Results Average mtDNA content was significantly lower in tumors versus normal brains. Decreasing mtDNA copy number in normal human astrocytes led to a markedly increased tumorigenicity in vivo. Depletion of mtDNA in pHGG cells promoted cell migration and invasion and therapeutic resistance. Shifting glucose metabolism from glycolysis to mitochondrial oxidation with the adenosine monophosphate–activated protein kinase activator AICAR (5-aminoimidazole-4-carboxamide ribonucleotide) or the pyruvate dehydrogenase kinase inhibitor dichloroacetate (DCA) significantly inhibited pHGG viability. Using DCA to shift glucose metabolism to mitochondrial oxidation and then metformin to simultaneously target mitochondrial function disrupted energy homeostasis of tumor cells, increasing DNA damage and apoptosis. The triple combination with radiation therapy, DCA and metformin led to a more potent therapeutic effect in vitro and in vivo. Conclusions Our results suggest metabolic alterations as an onco-requisite factor of pHGG tumorigenesis. Targeting reduced mtDNA quantity represents a promising therapeutic strategy for pHGG.

Defects in the allocation of cells to the inner cell mass and trophectoderm of parthenogenetic mouse blastocysts

1996 ◽  
Vol 8 (8) ◽  
pp. 1193 ◽  
Author(s):  
B Mognetti ◽  
D Sakkas
Keyword(s):  
Inner Cell Mass ◽  
Cell Mass ◽  
Substantial Reduction ◽  
Cell Lineage ◽  
Blastocyst Stage ◽  
Trophectoderm Cells ◽  
Parthenogenetic Development ◽  
Preimplantation Stage ◽  
Parthenogenetic Mouse Embryos ◽  
Parthenogenetic Embryos

Diploid parthenogenetic mouse embryos (which possess two maternally-derived genomes) can develop only as far as the 25-somite stage when transferred in utero and exhibit a substantial reduction in trophoblast tissue. The loss of cultured parthenogenetic embryos during postimplantation indicates that a defect in cell lineage may be evident as early as the blastocyst stage. The possibility that a defect may already be reflected at the preimplantation stage was investigated by examining the allocation of cells to the trophectoderm (trophoblast progenitor cells) and the inner cell mass of haploid and diploid parthenogenetic mouse blastocysts. Utilizing a differential labelling technique for counting cells, diploid parthenogenetic blastocysts were found to have fewer inner cell mass cells and trophectoderm cells than their haploid counterparts and normal blastocysts. In addition, both haploid and diploid parthenogenetic blastocysts had a lower inner cell mass: trophectoderm ratio than normal blastocysts. Thus, the relatively poor development of the trophectoderm lineage at the postimplantation stage is not reflected by a reduction in its allotment of cells at its first appearance. Nevertheless, the findings indicate that parthenogenetic development is already compromised at the blastocyst stage, and provide evidence that the expression of imprinted genes has significance for the development of the embryo at the preimplantation stage.

Sign in / Sign up

Export Citation Format

Share Document