A sex chromosome inversion is associated with copy number variation of mitochondrial DNA in zebra finch sperm

AbstractPropulsion of sperm cells via movement of the flagellum is of vital importance for successful fertilization. Presumably, the energy for this movement comes from the mitochondria in the sperm midpiece. Larger midpieces may contain more mitochondria, which should enhance the energetic capacity and hence promote mobility. Due to an inversion polymorphism on their sex chromosome TguZ, zebra finches (Taeniopygia guttata castanotis) exhibit large within-species variation in sperm midpiece length, and those sperm with the longest midpieces swim the fastest. Here, we test through quantitative real-time PCR in zebra finch ejaculates whether the inversion genotype has an effect on the copy number of mitochondrial DNA. Taking the inversion genotype as a proxy for midpiece length, we find that zebra finches with longer midpieces indeed have more copies of the mitochondrial DNA in their ejaculates than those with shorter midpieces, with potential downstream effects on the rate of ATP production and sperm swimming speed. This study sheds light on the proximate cause of a fitness-relevant genetic polymorphism, suggesting the involvement of central components of gamete energy metabolism.Data availabilitySupplementary data file

Download Full-text

A sex chromosome inversion is associated with copy number variation of mitochondrial DNA in zebra finch sperm

Royal Society Open Science ◽

10.1098/rsos.211025 ◽

2021 ◽

Vol 8 (9) ◽

pp. 211025

Author(s):

Ulrich Knief ◽

Wolfgang Forstmeier ◽

Bart Kempenaers ◽

Jochen B. W. Wolf

Keyword(s):

Mitochondrial Dna ◽

Copy Number Variation ◽

Zebra Finch ◽

Copy Number ◽

Sex Chromosome ◽

Species Variation ◽

Zebra Finches ◽

Mtdna Copy Number ◽

Number Variation ◽

Sperm Midpiece

The propulsion of sperm cells via movement of the flagellum is of vital importance for successful fertilization. While the exact mechanism of energy production for this movement varies between species, in avian species energy is thought to come predominantly from the mitochondria located in the sperm midpiece. Larger midpieces may contain more mitochondria, which should enhance the energetic capacity and possibly promote mobility. Due to an inversion polymorphism on their sex chromosome TguZ , zebra finches ( Taeniopygia guttata castanotis ) exhibit large within-species variation in sperm midpiece length, and those sperm with the longest midpieces swim the fastest. Here, we test through quantitative real-time PCR in zebra finch ejaculates whether the inversion genotype has an effect on the copy number of mitochondrial DNA (mtDNA). We find that zebra finches carrying the derived allele (correlated with longer sperm midpieces) have more copies of the mtDNA in their ejaculates than those homozygous for the ancestral allele (shorter midpieces). We suggest downstream effects of mtDNA copy number variation on the rate of adenosine triphosphate production, which in turn may influence sperm swimming speed and fertilization success. Central components of gamete energy metabolism may thus be the proximate cause for a fitness-relevant genetic polymorphism, stabilizing a megabase-scale inversion at an intermediate allele frequency in the wild.

Download Full-text

Whole-body & muscle responses to aerobic exercise training and withdrawal in ageing & COPD

European Respiratory Journal ◽

10.1183/13993003.01507-2021 ◽

2021 ◽

pp. 2101507

Author(s):

Lorna E. Latimer ◽

Dumitru Constantin-Teodosiu ◽

Bhavesh Popat ◽

Despina Constantin ◽

Linzy Houchen-Wolloff ◽

...

Keyword(s):

Mitochondrial Dna ◽

Exercise Training ◽

Aerobic Exercise ◽

Copy Number ◽

Aerobic Exercise Training ◽

Whole Body ◽

Dna Copy Number ◽

Mitochondrial Content ◽

Atp Production ◽

Mitochondrial Dna Copy Number

COPD patients exhibit lower peak oxygen consumption (V̇O2PEAK), altered muscle metabolism and impaired exercise tolerance compared with age-matched controls. Whether these traits reflect muscle level deconditioning (impacted by ventilatory constraints) and/or dysfunction in mitochondrial ATP production capacity is debated. By studying aerobic exercise training (AET) at a matched relative intensity and subsequent exercise withdrawal period (EW) we aimed to elucidate the whole-body and muscle mitochondrial responsiveness of healthy-young (HY), healthy-older (HO) and COPD volunteers to whole-body exercise.The HY (n=10), HO (n=10) and COPD (n=20) volunteers were studied before, after eight-weeks AET (65% V̇O2PEAK) and after four-weeks EW. V̇O2PEAK, muscle maximal mitochondrial ATP production rates (MAPR), mitochondrial content, mitochondrial DNA copy number and abundance of 59 targeted fuel metabolism mRNAs were determined at all time-points.Muscle MAPR (normalised for mitochondrial content) was not different for any substrate combination in HO, HY and COPD at baseline, but mitochondrial DNA copy number relative to a nuclear-encoded house-keeping gene was greater in HY (mean±sd) (804±67) than in HO (631±69), p=0.041. AET increased V̇O2PEAK in HO (17%, p=0.002) and HY (21%, p<0.001) but not COPD (p=0.603). Muscle MAPR for palmitate increased with training in HO (57%, p=0.041) and HY (56%, p=0.003) and decreased with EW in HO (−45%, p=0.036) and HY (−30%, p=0.016), but was unchanged in COPD (p=0.594). Mitochondrial DNA copy number increased with AET in HY (66%, p=0.001) but not HO (p=0.081) or COPD (p=0.132). The observed changes in muscle mRNA abundance were similar in all groups after AET and EW.Intrinsic mitochondrial function was not impaired by ageing or COPD in the untrained state. Whole-body and muscle mitochondrial responses to AET were robust in HY, evident in HO, but deficient in COPD. All showed robust muscle mRNA responses. Higher relative exercise intensities during whole-body training may be needed to maximise whole-body and muscle mitochondrial adaptation in COPD.

Download Full-text

Asymmetrical allocation of mitochondrial DNA to blastomeres during the first two cleavages in mouse embryos

Reproduction Fertility and Development ◽

10.1071/rd10076 ◽

2010 ◽

Vol 22 (8) ◽

pp. 1247 ◽

Cited By ~ 6

Author(s):

Yuichi Kameyama ◽

Hidehisa Ohnishi ◽

Gaku Shimoi ◽

Ryoichi Hashizume ◽

Masao Ito ◽

...

Keyword(s):

Mitochondrial Dna ◽

Copy Number ◽

Inner Cell Mass ◽

Cell Mass ◽

Atp Content ◽

Mtdna Copy Number ◽

Early Cleavage ◽

Atp Production ◽

Trophectoderm Cells ◽

Whole Egg

A recent report showed higher oxygen consumption, adenosine triphosphate (ATP) production and mitochondrial localisation in trophectoderm cells than in the inner cell mass of mouse blastocysts. We hypothesised that this phenomenon was due to the asymmetrical distribution of mitochondria in the blastomeres during the earlier stages. Oocytes, 2-cell embryos and 4-cell embryos were analysed to determine the volume, ATP content and mitochondrial DNA (mtDNA) copy number in the whole egg and individual blastomeres. Significant differences were detected in the volumes of cytoplasm and ATP contents between blastomeres from the 2-cell and 4-cell embryos. Moreover, whilst remaining stable in whole embryos, mtDNA copy number differed between blastomeres, indicating that mitochondria in oocytes are unevenly delivered into the daughter blastomeres during the first two cleavages. Although their volume and ATP content were not correlated, there was a significant correlation between volume and mtDNA copy number in 2- and 4-cell blastomeres. These results indicate that the number of mitochondria delivered to blastomeres during early cleavage is not precisely equal, suggesting that the allocation of mitochondria into daughter blastomeres is affected by uneven cytoplasmic distribution during cytokinesis in the oocyte and mother blastomeres.

Download Full-text

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

Reproduction Fertility and Development ◽

10.1071/rdv33n2ab31 ◽

2021 ◽

Vol 33 (2) ◽

pp. 123

Author(s):

E. J. Gutierrez ◽

F. B. Diaz ◽

K. R. Bondioli

Keyword(s):

Mitochondrial Dna ◽

Copy Number ◽

Pure Water ◽

Digital Pcr ◽

Control Group ◽

Atp Content ◽

Mtdna Copy Number ◽

Atp Production ◽

Mitochondrial Dna Copy Number ◽

Mitochondrial Number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P<0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

Download Full-text

Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.

Acta Biochimica Polonica ◽

10.18388/abp.2006_3319 ◽

2006 ◽

Vol 53 (3) ◽

pp. 485-495 ◽

Cited By ~ 22

Author(s):

Janusz Piechota ◽

Roman Szczesny ◽

Kamila Wolanin ◽

Aleksander Chlebowski ◽

Ewa Bartnik

Keyword(s):

Mitochondrial Dna ◽

Mitochondrial Genome ◽

Oxidative Phosphorylation ◽

Hela Cells ◽

Transcription Initiation ◽

Copy Number ◽

Mitochondrial Haplotype ◽

Mtdna Copy Number ◽

Atp Production ◽

Bioenergetic Metabolism

The influence of mutations in the mitochondrial DNA (mtDNA) on the bioenergetic metabolism of the cell is still poorly understood. Many of the mutations in the mtDNA affect the expression of the mitochondrial genome. Investigations on cells from patients are not easy, especially as the mitochondrial DNA is heteroplasmic and this state is changed in culture. Moreover, the nuclear background and the mitochondrial haplotype may affect the behaviour of cells. Transfer of patient mitochondria to rho zero cell lines is also not optimal as these cells in general have many nuclear changes which may also affect cell behaviour. Thus, we decided to use inhibitors of mitochondrial genome expression, such as thiamphenicol, ethidium bromide and dideoxycytidine to investigate the bioenergetic metabolism of HeLa cells. We found that oxidative phosphorylation and glycolysis participate equally in ATP production in HeLa cells and that decreased activity of the respiratory chain leads to increased glycolysis and the reduction of cell growth. Insufficient ATP production in the oxidative phosphorylation process was not compensated by increased proliferation of the mitochondria. However, we were able to show that there are some mechanisms compensating limited expression of the mitochondrial genome within the mitochondria. Experiments with dideoxycytidine revealed that 10-fold decrease of the mtDNA copy number resulted in almost normal activity of cytochrome c oxidase. We found that mtDNA depletion is compensated mostly on the level of RNA metabolism in the mitochondria. Thus, our results are in agreement with the hypothesis that transcription initiation rather than mtDNA copy number is a rate limiting factor for expression of the mitochondrial genome.

Download Full-text