Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.

The influence of mutations in the mitochondrial DNA (mtDNA) on the bioenergetic metabolism of the cell is still poorly understood. Many of the mutations in the mtDNA affect the expression of the mitochondrial genome. Investigations on cells from patients are not easy, especially as the mitochondrial DNA is heteroplasmic and this state is changed in culture. Moreover, the nuclear background and the mitochondrial haplotype may affect the behaviour of cells. Transfer of patient mitochondria to rho zero cell lines is also not optimal as these cells in general have many nuclear changes which may also affect cell behaviour. Thus, we decided to use inhibitors of mitochondrial genome expression, such as thiamphenicol, ethidium bromide and dideoxycytidine to investigate the bioenergetic metabolism of HeLa cells. We found that oxidative phosphorylation and glycolysis participate equally in ATP production in HeLa cells and that decreased activity of the respiratory chain leads to increased glycolysis and the reduction of cell growth. Insufficient ATP production in the oxidative phosphorylation process was not compensated by increased proliferation of the mitochondria. However, we were able to show that there are some mechanisms compensating limited expression of the mitochondrial genome within the mitochondria. Experiments with dideoxycytidine revealed that 10-fold decrease of the mtDNA copy number resulted in almost normal activity of cytochrome c oxidase. We found that mtDNA depletion is compensated mostly on the level of RNA metabolism in the mitochondria. Thus, our results are in agreement with the hypothesis that transcription initiation rather than mtDNA copy number is a rate limiting factor for expression of the mitochondrial genome.

Download Full-text

Mechanisms of Human Mitochondrial DNA Maintenance: The Determining Role of Primary Sequence and Length over Function

Molecular Biology of the Cell ◽

10.1091/mbc.10.10.3345 ◽

1999 ◽

Vol 10 (10) ◽

pp. 3345-3356 ◽

Cited By ~ 54

Author(s):

Carlos T. Moraes ◽

Lesley Kenyon ◽

Huiling Hao

Keyword(s):

Mitochondrial Dna ◽

Oxidative Phosphorylation ◽

Copy Number ◽

Human Cells ◽

Mtdna Copy Number ◽

Molecular Features ◽

Mtdna Replication ◽

Selection For ◽

Dna Maintenance

Although the regulation of mitochondrial DNA (mtDNA) copy number is performed by nuclear-coded factors, very little is known about the mechanisms controlling this process. We attempted to introduce nonhuman ape mtDNA into human cells harboring either no mtDNA or mutated mtDNAs (partial deletion and tRNA gene point mutation). Unexpectedly, only cells containing no mtDNA could be repopulated with nonhuman ape mtDNA. Cells containing a defective human mtDNA did not incorporate or maintain ape mtDNA and therefore died under selection for oxidative phosphorylation function. On the other hand, foreign human mtDNA was readily incorporated and maintained in these cells. The suicidal preference for self-mtDNA showed that functional parameters associated with oxidative phosphorylation are less relevant to mtDNA maintenance and copy number control than recognition of mtDNA self-determinants. Non–self-mtDNA could not be maintained into cells with mtDNA even if no selection for oxidative phosphorylation was applied. The repopulation kinetics of several mtDNA forms after severe depletion by ethidium bromide treatment showed that replication and maintenance of mtDNA in human cells are highly dependent on molecular features, because partially deleted mtDNA molecules repopulated cells significantly faster than full-length mtDNA. Taken together, our results suggest that mtDNA copy number may be controlled by competition for limiting levels of trans-acting factors that recognize primarily mtDNA molecular features. In agreement with this hypothesis, marked variations in mtDNA levels did not affect the transcription of nuclear-coded factors involved in mtDNA replication.

Download Full-text

Asymmetrical allocation of mitochondrial DNA to blastomeres during the first two cleavages in mouse embryos

Reproduction Fertility and Development ◽

10.1071/rd10076 ◽

2010 ◽

Vol 22 (8) ◽

pp. 1247 ◽

Cited By ~ 6

Author(s):

Yuichi Kameyama ◽

Hidehisa Ohnishi ◽

Gaku Shimoi ◽

Ryoichi Hashizume ◽

Masao Ito ◽

...

Keyword(s):

Mitochondrial Dna ◽

Copy Number ◽

Inner Cell Mass ◽

Cell Mass ◽

Atp Content ◽

Mtdna Copy Number ◽

Early Cleavage ◽

Atp Production ◽

Trophectoderm Cells ◽

Whole Egg

A recent report showed higher oxygen consumption, adenosine triphosphate (ATP) production and mitochondrial localisation in trophectoderm cells than in the inner cell mass of mouse blastocysts. We hypothesised that this phenomenon was due to the asymmetrical distribution of mitochondria in the blastomeres during the earlier stages. Oocytes, 2-cell embryos and 4-cell embryos were analysed to determine the volume, ATP content and mitochondrial DNA (mtDNA) copy number in the whole egg and individual blastomeres. Significant differences were detected in the volumes of cytoplasm and ATP contents between blastomeres from the 2-cell and 4-cell embryos. Moreover, whilst remaining stable in whole embryos, mtDNA copy number differed between blastomeres, indicating that mitochondria in oocytes are unevenly delivered into the daughter blastomeres during the first two cleavages. Although their volume and ATP content were not correlated, there was a significant correlation between volume and mtDNA copy number in 2- and 4-cell blastomeres. These results indicate that the number of mitochondria delivered to blastomeres during early cleavage is not precisely equal, suggesting that the allocation of mitochondria into daughter blastomeres is affected by uneven cytoplasmic distribution during cytokinesis in the oocyte and mother blastomeres.

Download Full-text

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

Reproduction Fertility and Development ◽

10.1071/rdv33n2ab31 ◽

2021 ◽

Vol 33 (2) ◽

pp. 123

Author(s):

E. J. Gutierrez ◽

F. B. Diaz ◽

K. R. Bondioli

Keyword(s):

Mitochondrial Dna ◽

Copy Number ◽

Pure Water ◽

Digital Pcr ◽

Control Group ◽

Atp Content ◽

Mtdna Copy Number ◽

Atp Production ◽

Mitochondrial Dna Copy Number ◽

Mitochondrial Number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P<0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

Download Full-text

mtDNA in the Pathogenesis of Cardiovascular Diseases

Disease Markers ◽

10.1155/2021/7157109 ◽

2021 ◽

Vol 2021 ◽

pp. 1-8

Author(s):

Lili Wang ◽

Qianhui Zhang ◽

Kexin Yuan ◽

Jing Yuan

Keyword(s):

Heart Failure ◽

Cardiovascular Disease ◽

Mitochondrial Dna ◽

Copy Number ◽

Heart Diseases ◽

Mtdna Copy Number ◽

Cardiac Inflammation ◽

Ischemic Heart Diseases ◽

Metabolic Functions ◽

Underlying Mechanisms

The incidence rate of cardiovascular disease (CVD) has been increasing year by year and has become the main cause for the increase of mortality. Mitochondrial DNA (mtDNA) plays a crucial role in the pathogenesis of CVD, especially in heart failure and ischemic heart diseases. With the deepening of research, more and more evidence showed that mtDNA is related to the occurrence and development of CVD. Current studies mainly focus on how mtDNA copy number, an indirect biomarker of mitochondrial function, contributes to CVD and its underlying mechanisms including mtDNA autophagy, the effect of mtDNA on cardiac inflammation, and related metabolic functions. However, no relevant studies have been conducted yet. In this paper, we combed the current research status of the mechanism related to the influence of mtDNA on the occurrence, development, and prognosis of CVD, so as to find whether these mechanisms have something in common, or is there a correlation between each mechanism for the development of CVD?

Download Full-text

Variability in mitochondrial import, mitochondrial health and mtDNA copy number using Type II and Type V CRISPR effectors

10.1101/2020.03.10.985606 ◽

2020 ◽

Author(s):

Zuriñe Antón ◽

Grace Mullally ◽

Holly Ford ◽

Marc W. van der Kamp ◽

Mark D. Szczelkun ◽

...

Keyword(s):

Mitochondrial Genome ◽

Copy Number ◽

Protein Targeting ◽

Mitochondrial Dynamics ◽

Mitochondrial Protein ◽

Mitochondrial Diseases ◽

Basic Research ◽

Strategy Development ◽

Mtdna Copy Number ◽

Mitochondrial Import

ABSTRACTCurrent methodologies for targeting the mitochondrial genome for basic research and/or therapeutic strategy development in mitochondrial diseases are restricted by practical limitations and technical inflexibility. The development of a functional molecular toolbox for CRISPR-mediated mitochondrial genome editing is therefore desirable, as this could enable precise targeting of mtDNA haplotypes using the precision and tuneability of CRISPR enzymes; however, published reports of “MitoCRISPR” systems have, to date, lacked reproducibility and independent corroboration. Here, we have explored the requirements for a functional MitoCRISPR system in human cells by engineering several versions of CRISPR nucleases, including the use of alternative mitochondrial protein targeting sequences and smaller paralogues, and the application of gRNA modifications that reportedly induce mitochondrial import. We demonstrate varied mitochondrial targeting efficiencies and influences on mitochondrial dynamics/function of different CRISPR nucleases, with Lachnospiraceae bacterium ND2006 (Lb) Cas12a being better targeted and tolerated than Cas9 variants. We also provide evidence of Cas9 gRNA association with mitochondria in HeLa cells and isolated yeast mitochondria, even in the absence of a targeting RNA aptamer. Finally, we present evidence linking mitochondrial-targeted LbCas12a/crRNA with increased mtDNA copy number dependent upon DNA binding and cleavage activity. We discuss reproducibility issues and the future steps necessary if MitoCRISPR is to be realised.

Download Full-text

A sex chromosome inversion is associated with copy number variation of mitochondrial DNA in zebra finch sperm

10.1101/776054 ◽

2019 ◽

Author(s):

Ulrich Knief ◽

Wolfgang Forstmeier ◽

Bart Kempenaers ◽

Jochen B. W. Wolf

Keyword(s):

Mitochondrial Dna ◽

Zebra Finch ◽

Copy Number ◽

Sex Chromosome ◽

Data Availability ◽

Species Variation ◽

Zebra Finches ◽

Chromosome Inversion ◽

Atp Production ◽

Sperm Midpiece

AbstractPropulsion of sperm cells via movement of the flagellum is of vital importance for successful fertilization. Presumably, the energy for this movement comes from the mitochondria in the sperm midpiece. Larger midpieces may contain more mitochondria, which should enhance the energetic capacity and hence promote mobility. Due to an inversion polymorphism on their sex chromosome TguZ, zebra finches (Taeniopygia guttata castanotis) exhibit large within-species variation in sperm midpiece length, and those sperm with the longest midpieces swim the fastest. Here, we test through quantitative real-time PCR in zebra finch ejaculates whether the inversion genotype has an effect on the copy number of mitochondrial DNA. Taking the inversion genotype as a proxy for midpiece length, we find that zebra finches with longer midpieces indeed have more copies of the mitochondrial DNA in their ejaculates than those with shorter midpieces, with potential downstream effects on the rate of ATP production and sperm swimming speed. This study sheds light on the proximate cause of a fitness-relevant genetic polymorphism, suggesting the involvement of central components of gamete energy metabolism.Data availabilitySupplementary data file

Download Full-text

Gene by environmental interactions affecting oxidative phosphorylation and thermal sensitivity

AJP Regulatory Integrative and Comparative Physiology ◽

10.1152/ajpregu.00008.2016 ◽

2016 ◽

Vol 311 (1) ◽

pp. R157-R165 ◽

Cited By ~ 13

Author(s):

Tara Z. Baris ◽

Pierre U. Blier ◽

Nicolas Pichaud ◽

Douglas L. Crawford ◽

Marjorie F. Oleksiak

Keyword(s):

Oxidative Phosphorylation ◽

Complex I ◽

Thermal Sensitivity ◽

Single Species ◽

Mitochondrial Haplotype ◽

Acclimation Temperature ◽

Atp Production ◽

Acute Response ◽

Relative Contribution ◽

Mitochondrial Genotype

The oxidative phosphorylation (OxPhos) pathway is responsible for most aerobic ATP production and is the only metabolic pathway with proteins encoded by both nuclear and mitochondrial genomes. In studies examining mitonuclear interactions among distant populations within a species or across species, the interactions between these two genomes can affect metabolism, growth, and fitness, depending on the environment. However, there is little data on whether these interactions impact natural populations within a single species. In an admixed Fundulus heteroclitus population with northern and southern mitochondrial haplotypes, there are significant differences in allele frequencies associated with mitochondrial haplotype. In this study, we investigate how mitochondrial haplotype and any associated nuclear differences affect six OxPhos parameters within a population. The data demonstrate significant OxPhos functional differences between the two mitochondrial genotypes. These differences are most apparent when individuals are acclimated to high temperatures with the southern mitochondrial genotype having a large acute response and the northern mitochondrial genotype having little, if any acute response. Furthermore, acute temperature effects and the relative contribution of Complex I and II depend on acclimation temperature: when individuals are acclimated to 12°C, the relative contribution of Complex I increases with higher acute temperatures, whereas at 28°C acclimation, the relative contribution of Complex I is unaffected by acute temperature change. These data demonstrate a complex gene by environmental interaction affecting the OxPhos pathway.

Download Full-text

Ginsenosides Rb1 and Rg1 Protect Primary Cultured Astrocytes against Oxygen-Glucose Deprivation/Reoxygenation-Induced Injury via Improving Mitochondrial Function

International Journal of Molecular Sciences ◽

10.3390/ijms20236086 ◽

2019 ◽

Vol 20 (23) ◽

pp. 6086 ◽

Cited By ~ 8

Author(s):

Meng Xu ◽

Qing Ma ◽

Chunlan Fan ◽

Xue Chen ◽

Huiming Zhang ◽

...

Keyword(s):

Oxidative Phosphorylation ◽

Cell Viability ◽

Mitochondrial Function ◽

Copy Number ◽

Glucose Deprivation ◽

Oxygen Glucose Deprivation ◽

Ros Production ◽

Protective Effects ◽

Mtdna Copy Number ◽

Cultured Astrocytes

This study aimed to evaluate whether ginsenosides Rb1 (20-S-protopanaxadiol aglycon) and Rg1 (20-S-protopanaxatriol aglycon) have mitochondrial protective effects against oxygen-glucose deprivation/reoxygenation (OGD/R)-induced injury in primary mouse astrocytes and to explore the mechanisms involved. The OGD/R model was used to mimic the pathological process of cerebral ischemia-reperfusion in vitro. Astrocytes were treated with normal conditions, OGD/R, OGD/R plus Rb1, or OGD/R plus Rg1. Cell viability was measured to evaluate the cytotoxicity of Rb1 and Rg1. Intracellular reactive oxygen species (ROS) and catalase (CAT) were detected to evaluate oxidative stress. The mitochondrial DNA (mtDNA) copy number and mitochondrial membrane potential (MMP) were measured to evaluate mitochondrial function. The activities of the mitochondrial respiratory chain (MRC) complexes I–V and the level of cellular adenosine triphosphate (ATP) were measured to evaluate oxidative phosphorylation (OXPHOS) levels. Cell viability was significantly decreased in the OGD/R group compared to the control group. Rb1 or Rg1 administration significantly increased cell viability. Moreover, OGD/R caused a significant increase in ROS formation and, subsequently, it decreased the activity of CAT and the mtDNA copy number. At the same time, treatment with OGD/R depolarized the MMP in the astrocytes. Rb1 or Rg1 administration reduced ROS production, increased CAT activity, elevated the mtDNA content, and attenuated the MMP depolarization. In addition, Rb1 or Rg1 administration increased the activities of complexes I, II, III, and V and elevated the level of ATP, compared to those in the OGD/R groups. Rb1 and Rg1 have different chemical structures, but exert similar protective effects against astrocyte damage induced by OGD/R. The mechanism may be related to improved efficiency of mitochondrial oxidative phosphorylation and the reduction in ROS production in cultured astrocytes.

Download Full-text

Targeting reduced mitochondrial DNA quantity as a therapeutic approach in pediatric high-grade gliomas

Neuro-Oncology ◽

10.1093/neuonc/noz140 ◽

2019 ◽

Vol 22 (1) ◽

pp. 139-151 ◽

Cited By ~ 10

Author(s):

Han Shen ◽

Man Yu ◽

Maria Tsoli ◽

Cecilia Chang ◽

Swapna Joshi ◽

...

Keyword(s):

Mitochondrial Dna ◽

Glucose Metabolism ◽

Mitochondrial Function ◽

Copy Number ◽

Pyruvate Dehydrogenase Kinase ◽

High Grade ◽

Mtdna Copy Number ◽

Mitochondrial Oxidation ◽

High Grade Gliomas

Abstract Background Despite increased understanding of the genetic events underlying pediatric high-grade gliomas (pHGGs), therapeutic progress is static, with poor understanding of nongenomic drivers. We therefore investigated the role of alterations in mitochondrial function and developed an effective combination therapy against pHGGs. Methods Mitochondrial DNA (mtDNA) copy number was measured in a cohort of 60 pHGGs. The implication of mtDNA alteration in pHGG tumorigenesis was studied and followed by an efficacy investigation using patient-derived cultures and orthotopic xenografts. Results Average mtDNA content was significantly lower in tumors versus normal brains. Decreasing mtDNA copy number in normal human astrocytes led to a markedly increased tumorigenicity in vivo. Depletion of mtDNA in pHGG cells promoted cell migration and invasion and therapeutic resistance. Shifting glucose metabolism from glycolysis to mitochondrial oxidation with the adenosine monophosphate–activated protein kinase activator AICAR (5-aminoimidazole-4-carboxamide ribonucleotide) or the pyruvate dehydrogenase kinase inhibitor dichloroacetate (DCA) significantly inhibited pHGG viability. Using DCA to shift glucose metabolism to mitochondrial oxidation and then metformin to simultaneously target mitochondrial function disrupted energy homeostasis of tumor cells, increasing DNA damage and apoptosis. The triple combination with radiation therapy, DCA and metformin led to a more potent therapeutic effect in vitro and in vivo. Conclusions Our results suggest metabolic alterations as an onco-requisite factor of pHGG tumorigenesis. Targeting reduced mtDNA quantity represents a promising therapeutic strategy for pHGG.

Download Full-text

Mitochondrial import, health and mtDNA copy number variability seen when using type II and type V CRISPR effectors

Journal of Cell Science ◽

10.1242/jcs.248468 ◽

2020 ◽

Vol 133 (18) ◽

pp. jcs248468 ◽

Cited By ~ 2

Author(s):

Zuriñe Antón ◽

Grace Mullally ◽

Holly C. Ford ◽

Marc W. van der Kamp ◽

Mark D. Szczelkun ◽

...

Keyword(s):

Mitochondrial Genome ◽

Copy Number ◽

Protein Targeting ◽

Mitochondrial Dynamics ◽

Mitochondrial Protein ◽

Mitochondrial Diseases ◽

Mtdna Copy Number ◽

Data Link ◽

Mitochondrial Import ◽

Type V

ABSTRACTCurrent methodologies for targeting the mitochondrial genome for research and/or therapy development in mitochondrial diseases are restricted by practical limitations and technical inflexibility. A molecular toolbox for CRISPR-mediated mitochondrial genome editing is desirable, as this could enable targeting of mtDNA haplotypes using the precision and tuneability of CRISPR enzymes. Such ‘MitoCRISPR’ systems described to date lack reproducibility and independent corroboration. We have explored the requirements for MitoCRISPR in human cells by CRISPR nuclease engineering, including the use of alternative mitochondrial protein targeting sequences and smaller paralogues, and the application of guide (g)RNA modifications for mitochondrial import. We demonstrate varied mitochondrial targeting efficiencies and effects on mitochondrial dynamics/function of different CRISPR nucleases, with Lachnospiraceae bacterium ND2006 (Lb) Cas12a being better targeted and tolerated than Cas9 variants. We also provide evidence of Cas9 gRNA association with mitochondria in HeLa cells and isolated yeast mitochondria, even in the absence of a targeting RNA aptamer. Our data link mitochondrial-targeted LbCas12a/crRNA with increased mtDNA copy number dependent upon DNA binding and cleavage activity. We discuss reproducibility issues and the future steps necessary for MitoCRISPR.

Download Full-text