First Report of a Novel Potyvirus from Florida Causing Chlorotic Mottling in Squash (Cucurbita pepo)

During the 2010 to 2011 growing seasons, nine cucurbit leaf samples including cantaloupe, cucumber, pumpkin, squash, and watermelon, showing mosaic and mottling, were collected from fields in the Homestead and Tampa areas in Florida (1). Eight of the nine samples were positive by dot-immunobinding assay (DIBA) and reverse transcription (RT)-PCR for either Watermelon mosaic virus (WMV), Papaya ringspot virus (PRSV-W), or mixed infection of both viruses. One squash sample from the Homestead area showing unique symptoms including chlorotic spots, yellowing, mottling, vein clearing, and mild mosaic was negative by RT-PCR against PRSV-W, Squash vein yellowing virus (SqVYV), WMV, and Zucchini yellow mosaic virus (ZYMV).The presence of virus-like particles (VLP) from symptomatic squash leaves (1) was prepared as described previously (2). Typical potyvirus-like particles ~700 nm long and 12 to 14 nm wide were observed by electron microscope from VLP preparations. Analysis of VLP on SDS-PAGE demonstrated a slightly larger coat protein (CP) (37 kDa compared with PRSV-W [35 kDa]). Sap from symptomatic squash leaf samples or VLP was mechanically inoculated to 10 squash seedlings at cotyledon stage using 0.1 M K2HPO4 buffer. Chlorotic spots were observed on the first true leaf 7 days post inoculation. However, symptoms became more severe by 2 to 3 weeks post inoculation and systemically infected leaves showed chlorosis and mottling similar to the original symptoms when tissues were collected from the field. Mock-inoculated control squash seedlings did not produce any symptoms. Symptomatic leaves from mechanically infected squash plants were used for VLP preparations and virus particles and size of the CP on SDS-PAGE was observed as before. Total RNA was extracted from VLP (2) and tested by RT-PCR using universal Potyviridae primers (forward primer 5′-CACGGATCCCGGG (T)17AGC and reverse primer 5′-GGBAAYAAYAGYGGDCARCC (3) to amplify a fragment from the 3′ end of the genome (including part of NIb gene, whole CP). A band of 1.2 kb was observed when the PCR product was analyzed on 1% agarose gel. PCR product was purified using QIAquick PCR Purification Kit (QIAGEN, USA), cloned (pGEM-T Easy Vector, Promega, USA), and sequenced in both directions. Consensus sequence was obtained from at least five clones and submitted to GenBank (KC522968). A BLASTn comparing the sequence from the squash potyvirus to others in GenBank found the highest similarity was 72.0% at nucleotide level and 64.8% at amino acid level with PRSV-W (JN831646), and less than 70% nucleotide similarity with WMV (NC_006262) and SqVYV (NC_010521). Based on the particle morphology, CP size on SDS-PAGE, nucleotide identity with other cucurbit potyviruses, and unique symptoms, it is concluded that this could be a new potyvirus. The threshold for classifying distinct species in Potyviridae is less than 76% identity at nucleotide level for either CP gene or the whole genome (4). This virus has been tentatively named as Squash chlorosis mottling virus (SqCMV). Florida is one of the leading states in acreage and production of cucurbits in the United States. The emergence of this new virus could be a potential future threat to cucurbits production. References: (1) A. Ali et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2012-0824-01-RS, 2012. (2) A. Ali et al. Plant Dis. 96:243, 2012. (3) A. Gibbs and A. Mackenzie. J. Virol. Methods 63:9, 1997. (4) A. M. Q. King et al. Virus Taxonomy-ICTV 9th Report:1071, 2012.

Download Full-text

Widespread Occurrence of Wheat spindle streak mosaic virus in Belgium

Plant Disease ◽

10.1094/pd-90-0723 ◽

2006 ◽

Vol 90 (6) ◽

pp. 723-728 ◽

Cited By ~ 12

Author(s):

C. Vaïanopoulos ◽

A. Legrève ◽

C. Lorca ◽

V. Moreau ◽

S. Steyer ◽

...

Keyword(s):

Mosaic Virus ◽

Real Time ◽

The United States ◽

Yellow Mosaic Virus ◽

Virus Concentration ◽

Rt Pcr ◽

Enzymelinked Immunosorbent Assay ◽

Mild Mosaic Virus ◽

First Time ◽

Virus Quantification

In order to assess the occurrence of Wheat spindle streak mosaic virus (WSSMV) in Belgium, a reverse-transcription polymerase chain reaction (RT-PCR) was developed, targeting WSSMV isolates from Canada, France, Germany, Italy, and the United States. The primers also were designed for virus quantification by real-time RT-PCR with SYBR-Green. No cross-reaction with soilborne cereal viruses such as Barley mild mosaic virus, Barley yellow mosaic virus, Soilborne cereal mosaic virus, and Soil-borne wheat mosaic virus was observed. The RT-PCR and real-time quantitative RT-PCR allowed a more sensitive detection of WSSMV than enzymelinked immunosorbent assay. The incidence of WSSMV in Belgium was evaluated using a bioassay with wheat cvs. Cezanne and Savannah and rye cv. Halo, grown in 104 Belgian soils. The presence of WSSMV was detected from plants grown in 32% of the soils. The RT-PCR methods developed here, combined with large sampling, allowed WSSMV to be detected for the first time in Belgium. The real-time quantitative RT-PCR was developed as a tool for evaluating the resistance to WSSMV by quantifying the virus concentration in wheat cultivars.

Download Full-text

First Report of Cucumber mosaic virus Associated with Capsicum chinense var. Scotch Bonnet in Florida

Plant Disease ◽

10.1094/pdis-12-13-1276-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1016-1016 ◽

Cited By ~ 1

Author(s):

B. Babu ◽

H. Dankers ◽

M. L. Paret

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Yellow Mosaic Virus ◽

Hot Pepper ◽

Crystalline Inclusion ◽

Post Inoculation ◽

Capsicum Chinense ◽

Rt Pcr ◽

First Report ◽

Pcr Assays

Scotch bonnet (Capsicum chinense) is a tropical hot pepper variety that is grown in South America, the Caribbean Islands, and in Florida, and is an important cash crop. In Florida, scotch bonnet is grown on ~100 acres annually. Virus-like leaf symptoms including mosaic and yellow mottling were observed on scotch bonnet plants in a field at Quincy, FL, with a disease incidence of ~5%. Two symptomatic and one non-symptomatic plant sample were collected from this field for identification of the causal agent associated with the symptoms. Viral inclusion assays (2) of the epidermal tissues of the symptomatic scotch bonnet samples using Azure A stain indicated the presence of spherical aggregates of crystalline inclusion bodies. Testing of the symptomatic samples using lateral flow immunoassays (Immunostrips, Agdia, Elkhart, IN) specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Pepper mild mottle virus (PMMoV), Tobacco mosaic virus (TMV), Zucchini yellow mosaic virus (ZYMV), and Papaya ringspot virus (PRSV), showed a positive reaction only to CMV. The sap from an infected leaf sample ground in 0.01 M Sorensons phosphate buffer (pH 7.0) was used to mechanically inoculate one healthy scotch bonnet plant (tested negative for CMV with Immunostrip) at the 2- to 3-leaf stage. The inoculated plant developed mild mosaic and mottling symptoms 12 to 14 days post inoculation. The presence of CMV in the mechanically inoculated plant was further verified using CMV Immunostrips. Total RNA was extracted (RNeasy Plant Mini Kit, Qiagen, Valencia, CA) from the previously collected two symptomatic and one non-symptomatic scotch bonnet samples. The samples were subjected to reverse-transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, Grand Island, NY), and using multiplex RT-PCR primer sets (1). The primers were designed to differentiate the CMV subgroup I and II, targeting the partial coat protein gene and the 3′UTR. The RT-PCR assays using the multiplex primers produced an amplicon of 590 bp, with the CMV subgroup I primers. The RT-PCR product was only amplified from the symptomatic leaf samples. The obtained amplicons were gel eluted, and directly sequenced bi-directionally (GenBank Accession Nos. KF805389 and KF805390). BLAST analysis of these sequences showed 97 to 98% nucleotide identities with the CMV isolates in the NCBI database. The isolates collected in Florida exhibited highest identity (98%) with the CMV isolate from tomato (DQ302718). These results revealed the association of CMV subgroup I with symptomatic scotch bonnet leaf samples. Although CMV has been reported from scotch bonnet, this is the first report of its occurrence in Florida. References: (1) S. Chen et al. Acta Biochim Biophys Sin. 43:465, 2011. (2) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986.

Download Full-text

First Report of Alfalfa mosaic virus in Viburnum lucidum in Spain

Plant Disease ◽

10.1094/pdis-92-7-1132b ◽

2008 ◽

Vol 92 (7) ◽

pp. 1132-1132 ◽

Cited By ~ 2

Author(s):

M. C. Cebrián ◽

M. C. Córdoba-Sellés ◽

A. Alfaro-Fernández ◽

J. A. Herrera-Vásquez ◽

C. Jordá

Keyword(s):

Mosaic Virus ◽

Natural Infection ◽

Alfalfa Mosaic Virus ◽

The United States ◽

Rt Pcr ◽

Water Control ◽

First Report ◽

Pcr Product ◽

Pcr Assays ◽

The Mediterranean

Viburnum sp. is an ornamental shrub widely used in private and public gardens. It is common in natural wooded areas in the Mediterranean Region. The genus includes more than 150 species distributed widely in climatically mild and subtropical regions of Asia, Europe, North Africa, and the Americas. In January 2007, yellow leaf spotting in young plants of Viburnun lucidum was observed in two ornamental nurseries in the Mediterranean area of Spain. Symptoms appeared sporadically depending on environmental conditions but normally in cooler conditions. Leaf tissue from 24 asymptomatic and five symptomatic plants was sampled and analyzed by double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany) and Alfalfa mosaic virus (AMV) (SEDIAG S.A.S, Longvic, France). All symptomatic plants of V. lucidum were positive for Alfalfa mosaic virus (AMV). The presence of AMV was tested in the 29 samples by one-step reverse transcription (RT)-PCR with the platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) using primers derived from a partial fragment of the coat protein gene of AMV (2). The RT-PCR assays produced an expected amplicon of 700 bp in the five symptomatic seropositive samples. No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR assays. One PCR product was purified (High Pure PCR Product Purification Kit; Roche Diagnostics, Mannheim, Germany) and directly sequenced (GenBank Accession No. EF427449). BLAST analysis showed 96% nucleotide sequence identity to an AMV isolate described from Phlox paniculata in the United States (GenBank Accession No. DQ124429). This virosis has been described as affecting Viburnum tinus L. in France (1). To our knowledge, this is the first report of natural infection of Viburnum lucidum with AMV in Spain, which might have important epidemiological consequences since V. lucidum is a vegetatively propagated ornamental plant. References: (1) L. Cardin et al. Plant Dis. 90:1115, 2006. (2) Ll. Martínez-Priego et al. Plant Dis. 88:908, 2004.

Download Full-text

First Report of the Occurrence of Grapevine fanleaf virus in Washington State Vineyards

Plant Disease ◽

10.1094/pdis-92-8-1250a ◽

2008 ◽

Vol 92 (8) ◽

pp. 1250-1250 ◽

Cited By ~ 3

Author(s):

T. Mekuria ◽

R. R. Martin ◽

R. A. Naidu

Keyword(s):

Pacific Northwest ◽

Mixed Infection ◽

Consensus Sequence ◽

Amino Acid Level ◽

Pairwise Comparison ◽

The United States ◽

Washington State ◽

Rt Pcr ◽

Grapevine Fanleaf Virus ◽

First Report

Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5′-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231–2250) and reverse primer (5′-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533–2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.

Download Full-text

(257) Pepino Mosaic Virus: Variability in U.S. Isolates

HortScience ◽

10.21273/hortsci.40.4.1089b ◽

2005 ◽

Vol 40 (4) ◽

pp. 1089B-1089

Author(s):

Clarissa J. Maroon-Lango ◽

Mary Ann Guaragna ◽

Ramon Jordan ◽

John Hammond ◽

Murali Bandla ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

Amino Acid Level ◽

The United States ◽

Full Length ◽

Nucleotide Level ◽

Tomato Fruits ◽

Pepino Mosaic Virus ◽

Infected Tomato ◽

Germplasm Accessions

Pepino mosaic virus (PepMV) was first found in pepino (Solanum muricatum) growing in coastal Peru in 1974 and described in 1980; it reappeared in protected tomato (Lycopersiconesculentum) in the Netherlands in 1999. Since then, it has been reported to occur in tomato in several countries including Austria, Belgium, Canada, France, Germany, Italy, Peru, Spain and the Canary Islands, the United Kingdom, and in 11 states within the United States. Three strains of PepMV found in the United States have been cloned and sequenced. Full-length genomic sequences were obtained for two strains, PepMV-US1 and PepMV-US2, from co-infected tomato plant samples from Arizona. The 3'-end sequence of PepMV-US3 came from infected tomato fruits from Maryland. The genome organization, motifs and domains typical of the genus Potexvirus, and of other PepMV isolates, were found in full-length sequences of both US1 and US2 isolates. Direct comparison of US1 and US2 at the nucleotide level revealed an 86.3% identity; whereas, when individually compared to the French and Spanish isolates, which share ∼99% identity at the nucleotide level, US1 and US2 had 82% and 79% identities to each, respectively. Pair-wise gene-for-gene comparisons between United States and European isolates revealed a similar trend. While unique, US1 is more closely related to the previously reported European isolates than is US2. The CP of US3 is nearly identical to the European isolates at the amino acid level. None of 18 tomato germplasm accessions or 10 cultivars were resistant to mechanical inoculation with US3; in contrast, no infection was detected in nine pepper cultivars or four germplasm accessions. Plants grown from seeds of infected tomato fruits did not test positive for PepMV.

Download Full-text

First Report of Peanut mottle virus Infecting Soybean in South Korea

Plant Disease ◽

10.1094/pdis-04-14-0356-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1285-1285 ◽

Cited By ~ 5

Author(s):

S. Lim ◽

Y.-H. Lee ◽

D. Igori ◽

F. Zhao ◽

R. H. Yoo ◽

...

Keyword(s):

Nucleotide Sequence ◽

South Korea ◽

Mosaic Virus ◽

Soybean Mosaic Virus ◽

Nucleotide Sequences ◽

Mottle Virus ◽

Post Inoculation ◽

Rt Pcr ◽

First Report ◽

Pcr Product

In July 2013, soybean (Glycine max) plants at the research field in Daegu, South Korea, showed virus-like symptoms, such as mosaic, mottle, yellowing, and stunting. Overall, there were approximately 1% of soybean plants that showed these symptoms. Sixteen soybean samples were collected based on visual symptoms and subjected to laboratory characterization. Total RNA was extracted from each sample with the Tri Reagent (Molecular Research Center, Cincinnati, OH) and cDNA was synthesized using random N25 primer with RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA), according to the manufacturers' instructions. All samples were tested by PCR with Prime Taq Premix (2X) (GeNet Bio, Daejeon, Korea) and primer sets specific to Soybean mosaic virus (SMV; 5′-CATATCAGTTTGTTGGGCA-3′ and 5′-TGCCTATACCCTCAACAT-3′), Peanut stunt virus (PSV; 5′-TGACCGCGTGCCAGTAGGAT-3′ and 5′-AGGTDGCTTTCTWTTGRATTTA-3′), Soybean yellow mottle mosaic virus (SYMMV; 5′-CAACCCTCAGCCACATTCAACTAT-3′ and 5′-TCTAACCACCCCACCCGAAGGATT-3′), and Soybean yellow common mosaic virus (SYCMV; 5′-TTGGCTGAGAGGAGTGGCTT-3′ and 5′-TGCGGTCGTGTAGTCAGTG-3′). Among 16 samples tested, five were positive for SMV and two for SYMMV. Three samples were found infected by both SMV and SYMMV and four by both SMV and PSV. Since two of the symptomatic samples were not infected by viruses described above, a pair of primers specific to Peanut mottle virus (PeMoV; 5′-GCTGTGAATTGTTGTTGAGAA-3′ and 5′-ACAATGATGAAGTTCGTTAC-3′) was tested (1). All 16 samples were subjected to RT-PCR with primers specific to PeMoV. Four were found positive for PeMoV. Two of them were already found infected with SYMMV. In order to identify the complete nucleotide sequences of PeMoV coat protein (CP), another primer set (5′-TGAGCAGGAAAGAATTGTTTC-3′ and 5′-GGAAGCGATATACACACCAAC-3′) was used. RT-PCR product was cloned into RBC TA Cloning Vector (RBC Bioscience, Taipei, Taiwan) and the nucleotide sequence of the insert was determined by Macrogen (Seoul, Korea). CP gene of the PeMoV (GenBank Accession No. KJ664838) showed the highest nucleotide sequence identity with PeMoV isolate Habin (KF977830; 99% identity), and the highest amino acid identity with GenBank Accession No. ABI97347 (100% identity). In order to fulfill Koch's postulates, several G. max cv. Williams 82 were inoculated with the extracts of PeMoV-infected leaf tissue. At 14 days post-inoculation, plants showed systemic mottle symptoms. These symptomatic plants were subjected to RT-PCR, and the nucleotide sequences of the PCR product were found identical to that of the virus in the inoculum. To our knowledge, this is the first report of soybean-infecting PeMoV, a member of the genus Potyvirus in the family Potyviridae, in South Korea. Reference: (1) R. G. Dietzgen et al. Plant Dis. 85:989, 2001.

Download Full-text

First Report of Grapevine leafroll-associated virus 1 Infecting Grapevines in India

Plant Disease ◽

10.1094/pdis-07-12-0647-pdn ◽

2012 ◽

Vol 96 (12) ◽

pp. 1828-1828 ◽

Cited By ~ 7

Author(s):

S. Kumar ◽

S. D. Sawant ◽

I. S. Sawant ◽

K. Prabha ◽

R. K. Jain ◽

...

Keyword(s):

Amino Acid ◽

Acid Level ◽

Amino Acid Level ◽

The United States ◽

Pinot Noir ◽

Rt Pcr ◽

Nucleotide Level ◽

First Report ◽

Leafroll Disease ◽

Das Elisa

Viticulture, one of the most remunerative farming enterprises of India, is seriously affected by leafroll disease, which accounts for 62% of the losses in grape production worldwide due to viral diseases (4). Grapevine leafroll-associated virus 3 and 1 (GLRaV-3 and GLRaV-1) of the family Closteroviridae are the two most common viruses associated with the leafroll disease of grapevine (1). GLRaV-3 was previously confirmed in India through RT-PCR, cloning, and sequencing (2). A survey was conducted during 2010 and 2011 in the Nashik and Pune regions of western India and reddening of interveinal areas and downward rolling, typical symptoms of leafroll disease in dark fruited cultivars, were observed, first in 2010 and subsequently in 2011. Fourteen leafroll symptomatic samples from seven cultivars of seven vineyards were collected during 2011. Samples were subjected to double antibody sandwich (DAS)-ELISA using commercially available antibodies against GLRaV-3 and GLRaV-1 (Bioreba, Reinach, Switzerland) (2). An asymptomatic sample from another cultivar of a different vineyard and samples from two plantlets of two different cultivars produced in tissue culture were used as negative controls. GLRaV-1 was detected in two cultivars, Shiraj (Nashik region) and Pinot Noir (Pune region) using DAS-ELISA. GLRaV-1 was detected either alone in cultivar Pinot Noir or as mixed infection with GLRaV-3 in cultivar Shiraj. To further confirm the presence of GLRaV-1 in these two cultivars, crude extract from petioles of these two cultivars were subjected to one step reverse transcription (RT)-PCR using GLRaV-1 specific primers pORF9F and pORF9R (GGCTCGAGATGGCGTCACTTATACCTA and CCTCTAGACACCAAATTGCTAGCGA, respectively) (3). The ˜650 bp amplicons were cloned in pGEM-T easy vector and three independent clones of each amplicon were sequenced in both directions. The cloned amplified product was 646 bp, including 630 bp of p24 protein (ORF9) of GLRaV-1. Comparative sequence analysis, using the BioEdit 7.0.3 program ( http://www.mbio.ncsu.edu/BioEdit/BioEdit.html ), of ORF9 of the virus under study from the cultivars Pinot Noir and Shiraj shared maximum sequence identity of 95.8 and 96.1%, respectively, at the nucleotide level with the Clatervine isolate from the United States (GenBank Accession No. HQ833477). The corresponding values of maximum identities at the amino acid level were 96.6 and 96.1%, respectively, with the same Clatervine isolate. The maximum identity between these two isolates of GLRaV-1 was 96.1% at nucleotide level and 95.7% at amino acid level. To the best of our knowledge, this study represents the first report of GLRaV-1 from India. Grape production in India could be impacted by this virus; thus, identification of the virus is important. References: (1) B. Akbas et al. Hort. Sc. (Prague). 36: 97, 2009. (2) S. Kumar et al. Virus Genes. 45:195, 2012. (3) A. Little and M. A. Rezaian. Arch. Virol. 151:753, 2006. (4) A. Little et al. Virus Res. 80:109, 2001.

Download Full-text

First Report of Freesia sneak virus in Freesia sp. in Virginia

Plant Disease ◽

10.1094/pdis-93-9-0965b ◽

2009 ◽

Vol 93 (9) ◽

pp. 965-965 ◽

Cited By ~ 7

Author(s):

A. M. Vaira ◽

M. A. Hansen ◽

C. Murphy ◽

M. D. Reinsel ◽

J. Hammond

Keyword(s):

Nucleic Acid ◽

Mosaic Virus ◽

The United States ◽

Research Unit ◽

Yellow Mosaic Virus ◽

Cdna Clones ◽

Rt Pcr ◽

Degenerate Primers ◽

First Report ◽

Leaf Necrosis

In the spring of 2008, freesia, cvs. Honeymoon and Santana, with striking virus-like symptoms similar to freesia leaf necrosis disease were received by the Virginia Tech Plant Disease Clinic from a cut-flower nursery in Gloucester, VA and forwarded for analysis to the USDA-ARS Floral and Nursery Plants Research Unit in Beltsville, MD. Approximately 25% of the plants had coalescing, interveinal, chlorotic, whitish, necrotic or dark brown-to-purple necrotic spots on leaves. Symptomatic plants were scattered within the planting. Fifteen symptomatic plants were collected between March and May of 2008, and nucleic acid extracts were analyzed for ophiovirus infection by reverse transcription (RT)-PCR with ophiovirus-specific degenerate primers (2). The diagnostic 136-bp ophiovirus product from the RdRp gene was amplified from 14 of 15 freesia plants tested. A partially purified virus preparation was analyzed by transmission electron microscopy and potyvirus- and ophiovirus-like particles were detected. The potyviruses, Freesia mosaic virus (FreMV) and Bean yellow mosaic virus (BYMV), each cause mosaic symptoms (3), although BYMV may induce necrosis late in the season. RT-PCR performed on the same nucleic acid samples using potyvirus coat protein (CP)-specific degenerate primers D335 and U335 (1) amplified the diagnostic 335-bp fragment from 2 of 15 plants. Cloned sequence from these plants was identified as FreMV. The ophiovirus CP gene was amplified by RT-PCR and cloned from two symptomatic freesia plants using primers FreSVf-CP-XhoI 5′-GACTCGAGAAATGTCTGGAAAATACTCTGTTC-3′ and FreSVf-CP-BamHI 5′-CCAGGATCCTTAGATAGTGAATCCATAAGCTG-3′, based on the sequence of Freesia sneak virus (FreSV) isolates from freesia (GenBank No. DQ885455) and lachenalia (4). The approximate 1.3-kb amplicon was cloned and sequences of two cDNA clones were identical (GenBank No. FJ807730). The deduced amino acid sequence showed 99% identity with the Italian FreSV CP sequence (GenBank No. DQ885455), confirming FreSV in the symptomatic freesia plants. To our knowledge, this is the first report of FreSV in Virginia and the United States. Soilborne freesia leaf necrosis disease has been reported in Europe since the 1970s (3); several viral causal agents have been hypothesized but recent findings correlate best with the ophiovirus. In Virginia, the presence of FreSV, but not FreMV, was strongly correlated with the leaf necrosis syndrome. FreSV, likely soilborne through Olpidium brassicae, may pose a new soilborne threat for bulbous ornamentals, since it has been recently detected also in Lachenalia spp. (Hyacinthaceae) from South Africa (4). Although specific testing of O. brassicae was not performed, the disease may potentially persist in the soil for years in O. brassicae resting spores and development of symptoms may be affected by environmental conditions (3). References: (1) S. A. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) A. M. Vaira et al. Arch.Virol. 148:1037, 2003. (3) A. M. Vaira et al. Acta Hortic. 722:191, 2006. (4) A. M. Vaira et al. Plant Dis. 91:770, 2007.

Download Full-text

First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States

Plant Disease ◽

10.1094/pdis-08-14-0792-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 292-292 ◽

Cited By ~ 8

Author(s):

J. Hammond ◽

D. Bampi ◽

M. D. Reinsel

Keyword(s):

United States ◽

The Netherlands ◽

Mosaic Virus ◽

Consensus Sequence ◽

Chenopodium Quinoa ◽

The United States ◽

Rt Pcr ◽

Protein Amino Acid ◽

Lily Symptomless Virus ◽

Plantago Asiatica

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription–polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.

Download Full-text

Occurrence, Distribution and Biological variability of Zucchini Yellow Mosaic Virus in cucurbits of Khuzestan province, South west of Iran

International Journal of Plant Biology ◽

10.4081/pb.2011.e6 ◽

2011 ◽

Vol 2 (1) ◽

pp. 6

Author(s):

Somayeh Safara ◽

Jamshid Hayati ◽

Mohammad Roayaei Ardakani ◽

Mina Kohi Habibi

Keyword(s):

Mosaic Virus ◽

Inclusion Bodies ◽

Zucchini Yellow Mosaic Virus ◽

Plant Viruses ◽

Elisa Test ◽

Yellow Mosaic Virus ◽

Rt Pcr ◽

Khuzestan Province ◽

Pcr Product ◽

Das Elisa

ZYMV is one of the most important plant viruses that cause economical damage in cucurbits. The symptoms of ZYMV in different cucurbits include stunting, yellowing, mottling, severe mosaic, leaf and fruit deformation, blistering and shoe string. Investigation on occurrence of this virus, in Khuzestan province was carried out in November 2009, April and May 2010 by collecting cucurbits samples from different cucurbits fields. After DAS-ELISA test, ZYMV was maintained in squash. Then total RNA were extracted and were tested by RT-PCR. Using RT-PCR, fragments belonging to N-terminal of coat protein and C-terminal of nuclear inclusion bodies were replicated. PCR product for investigation of replication was loaded in 1% agarose gel. From seven regions in Khuzestan, 175 leaf samples showing different symptoms (yellowing, mosaic, deformation and blistering) were collected. Seventy one samples out of total samples (175 samples) showed ZYMV infection. Occurrence of Zucchini Yellow Mosaic Virus in Khuzestan province was confirmed, using serological and RT-PCR tests. Infection of ZYMV in Khuzestan province (40.5%) is higher than the average of Iran’s infection (38%). This article is first report of occurrence ZYMV in different regions of Khuzestan province except Dezful.

Download Full-text