First Report of Cucurbit chlorotic yellows virus Infecting Cucumber, Melon, and Squash in Iran

Yellowing diseases of field- and greenhouse-grown cucurbits are becoming increasingly important in many cucurbit cultivation areas in Iran. Virus surveys were conducted from 2011 to 2012 in greenhouse-grown cucumber (Cucumis sativus L.) and field-cultivated cucumber, squash (Cucurbita sp.) and melon (Cucumis melo L.) in Tehran, Semnan, Bushehr, Hormozgan, Isfahan, Yazd, and Fars provinces, the major cucurbit-growing areas in Iran. Leaf samples with various symptoms, e.g., chlorosis, interveinal chlorotic spots on lower leaves, bright yellow color or sever yellowing on older leaves, were collected and screened for the presence of the whitefly transmitted criniviruses (family Closteroviridae) Cucurbit chlorotic yellows virus (CCYV) and Cucurbit yellow stunting disorder virus (CYSDV) through double-antibody sandwich (DAS)-ELISA, using CCYV and CYSDV specific antisera (DSMZ, Germany). The ELISA results showed that of 347 cucumber leaf samples originating from cucumber greenhouses, 170 and 65 were positive for CCYV and CYSDV, respectively, and 45 samples were infected with both viruses. In addition, of 147 leaf samples collected from melon, cucumber, and squash grown in open fields, 57 and 53 were infected with CCYV and CYSDV, respectively, and 14 were infected with both viruses. These results indicate that these two viruses are widely distributed on these cucurbit crops in Iran. CCYV was not detected in Bushehr and CYSDV was not detected in Isfahan and Hormozgan provinces. To confirm the presence of CCYV and CYSDV, total RNA was extracted (Sigma Chemical, St. Louis, MO) from 18 samples that reacted positive in DAS-ELISA originating from different surveyed provinces. RT-PCR was carried out using specific primers Crini-s2 (5′-CATTCCTACCTGTTTAGCCA-3′) (2) and Crini-as1 (5′-ATCCTTCGCAGTGAAAAACC-3′) to amplify a 460-bp fragment of the HSP70 gene and CCYV using specific primers CCYV-HSP-F1 (5′-TGCGTATGTCAATGGTGTTATG-3′) and CCYV-HSP-R1 (5′-ATCCTTCGCAGTGAAAAACC-3′) to amplify a 462-bp fragment of the HSP70 gene (latter 3 primers from [3]). Expected DNA fragments for CYSDV and CCYV were amplified from 11 (CCYV 7/11, CYSDV 4/11) of 18 samples but not from any of the healthy controls. Further analysis by sequencing three selected PCR products amplified with primers CCYV-HSP-F1/R1 showed complete consensus among the sequences, and in comparison with sequences available at GenBank, the highest identities were obtained to Asian CCYV isolates (94% nt/98% aa identity). The CCYV sequences were deposited in GenBank under accessions KC559449 to KC559451. The identity of the amplified CYSDV DNA could also be confirmed by sequencing of three PCR products. CCYV has first been proven to occur in different countries in East Asia and has recently been reported from Sudan (2) and Lebanon (1), indicating the putative spread of the virus wherever cucurbits are grown and its vector, the whitefly Bemisia tabaci, is present. Large populations of whiteflies were present in all surveyed areas. However, to our knowledge, this is the first report for the occurrence of CCYV in Iran. In conclusion, the presence of CCYV and CYSDV in the major cucurbit growing provinces and the large whitefly population pose a serious threat to cucurbit production in Iran. References: (1) P. E. Abrahamian et al. Plant Dis. 96:1704, 2012. (2) K. Hamed et al. Plant Dis. 95:1321, 2011. (3) R. Zeng et al. Plant Dis. 95:354, 2011.

Download Full-text

First Report of Cucurbit chlorotic yellows virus Infecting Melon in China

Plant Disease ◽

10.1094/pdis-08-10-0613 ◽

2011 ◽

Vol 95 (3) ◽

pp. 354-354 ◽

Cited By ~ 11

Author(s):

R. Zeng ◽

F. M. Dai ◽

W. J. Chen ◽

J. P. Lu

Keyword(s):

Cucumis Melo ◽

Specific Primers ◽

Virus Diagnosis ◽

High Tunnel ◽

First Report ◽

Reverse Transcription Pcr ◽

Yellow Color ◽

Large Populations ◽

Pcr Products ◽

Cucurbit Chlorotic Yellows Virus

In October 2007, symptoms of chlorosis on the upper leaves and a bright yellow color on the lower leaves were observed sporadically on hami melon (Cucumis melo cv. Xuelihong) in a high tunnel in Nanhui of Shanghai, China. Disease progresses from initial mottling of leaves into leaves that are completely yellow with the veins remaining green. The oldest leaves develop symptoms first, so these leaves have a pronounced even yellow color. In October 2009, these symptoms were found in all melons produced in the suburbs of Shanghai. These symptoms were similar to those caused by Cucurbit yellow stunting disorder virus (CYSDV) and Cucurbit chlorotic yellows virus (CCYV) (1–3). Twelve samples from symptomatic melons were collected in the Jiading, Nanhui, Fengxian, and Chongming districts of Shanghai for virus diagnosis. Large populations of whiteflies were observed in association with the diseased cucurbit crops. Total RNA was extracted with Trizol reagents (Invitrogen, Carlsbad, CA). We used random primers (9-mer) for reverse transcription-PCR. Extracts were for CYSDV using specific primers CYSDV-CP-F (5′-ATGGCGAGTTCGAGTGAGAA-3′) and CYSDV-CP-R (5′-TCAATTACCACAGCCACCTG-3′) to amplify a 756-bp fragment of coat protein gene and CCYV using specific primers CCYV-HSP-F1 (5′-TGCGTATGTCAATGGTGTTATG-3′) and CCYV-HSP-R1 (5′-ATCCTTCGCAGTGAAAAACC-3′) to amplify a 462-bp fragment of the HSP gene (1). CYSDV was not found in all samples. The expected 462-bp target fragment of CCYV was obtained in all samples but not from any of the healthy controls. All the 462-bp PCR products were cloned to pGEM-T vector (Promega, Madison, WI) and sequenced. All sequences obtained were homologous. A comparison of the submitted sequence (GenBank Accession No. HQ148667) with those in GenBank showed that the sequence had 100% nucleotide identity to the Hsp70h sequences of (CCYV) isolates from Japan (Accession Nos. AB523789 and AB457591) (1,4), Taiwan (Accession No. HM120250) (2), and mainland of China (Accession Nos. GU721105, GU721108, and GU721110). CCYV is a new member of the genus Crinivirus, first discovered in Japan in 2004 (4) and reported in Taiwan in 2009 (2). To our knowledge, this is the first report of CCYV on melon in China. References: (1) Y. Gyoutoku et al. Jpn. J. Phytopathol. 75:109, 2009. (2) L.-H. Huang et al. Plant Dis. 94:1168, 2010. (3) L. Z. Liu et al. Plant Dis.94:485, 2010. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Download Full-text

First Report of Cucurbit chlorotic yellows virus Infecting Muskmelon and Cucumber in Sudan

Plant Disease ◽

10.1094/pdis-04-11-0349 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1321-1321 ◽

Cited By ~ 22

Author(s):

K. Hamed ◽

W. Menzel ◽

G. Dafalla ◽

A. M. A. Gadelseed ◽

S. Winter

Keyword(s):

Direct Sequencing ◽

Coat Protein Sequence ◽

Cucumber Plant ◽

Rt Pcr ◽

Cucumis Sativus L ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Cucurbit Chlorotic Yellows Virus ◽

Open Fields

In summer 2009, a survey for virus diseases in cucurbits was conducted in open fields and plastichouses in Khartoum State, the most important growing area for cucurbits in Sudan. Chlorosis and yellowing symptoms on middle and lower leaves were observed on many muskmelon (Cucumis melo L.) plants grown in open fields in the Assilat agricultural scheme and on approximately 80% of the cucumber (Cucumis sativus L.) plants grown in plastichouses in Khartoum North. Large populations of whiteflies (Bemisia tabaci L.) were present in both locations. Leaf symptoms that were observed were similar to those caused by Cucurbit chlorotic yellows virus (CCYV), a recently described new Crinivirus species infecting cucurbits in Japan (4), indicating presence of this virus previously only reported from Japan, Taiwan (2), and China (1). Samples from seven symptomatic muskmelon leaves were collected from individual plants grown in different open fields in Assilat and from a symptomatic cucumber plant grown in a plastichouse. Total RNA was extracted from these samples with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) to amplify putative CCYV sequences with primers (Crini-s2 5′-CATTCCTACCTGTTTAGCCA and Crini-as2 5′-TGCACTTATAATCTGCTGGTAC) designed from CCYV sequences available at GenBank. A 353-bp DNA fragment of the HSP70 gene was amplified by reverse transcription (RT)-PCR for all samples. Further analysis by direct sequencing of two PCR products showed 99 to 100% nt sequence identity to Asian CCYV isolates. Amplification of the coat protein sequence with the primer pair (CCYV-CPs 5′-ATGGAGAAGACTGACAATAAACAA and CCYV-CPas 5′-TTTACTACAACCTCCCGGTG) followed by cloning and sequencing yielded a 760-bp fragment having 99% nucleotide sequence identity to all Asian isolates. For confirmation, dsRNA preparations of symptomatic muskmelon tissue (collected in June 2010) were made, showing dsRNA patterns typical for criniviruses after separation on agarose gels. This dsRNA was used as template for random RT-PCR followed by sequencing of the cloned PCR products (3). Comparison with sequences available at GenBank revealed that cDNA sequences from dsRNA also were 99 to 100% identical to the CCYV genome sequence (AB523788.1). Whitefly transmission of the virus was confirmed by giving a population of B. tabaci an acquisition access period of 24 h and a further 24 h on muskmelon and cucumber seedlings. Symptoms were observed after 5 to 7 days, and the presence of CCYV was confirmed by RT-PCR. In conclusion, symptoms, RT-PCR, and dsRNA sequencing results confirm the presence and establishment of CCYV in cucurbit crops in Sudan. It is remarkable that the sequences obtained from the Sudanese samples show only negligible sequence differences from Asian isolates. Because of the large whitefly vector populations, the spread of CCYV to neighboring countries in Africa and potentially southern Europe, or wherever cucurbits are grown, can be expected. To our knowledge, this is the first report of CCYV in Sudan and outside Eastern Asia. The sequences obtained in this study have been submitted to GenBank under Accession Nos. JF807053 to JF807055. References: (1) Q. S. Gu et al. Plant Dis. 95:73, 2011. (2) L. H. Huang et al. Plant Dis. 94:1168, 2010. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Download Full-text

First Report of Cucurbit yellow stunting disorder virus in Morocco

Plant Disease ◽

10.1094/pdis.2000.84.5.596c ◽

2000 ◽

Vol 84 (5) ◽

pp. 596-596 ◽

Cited By ~ 24

Author(s):

C. Desbiez ◽

H. Lecoq ◽

S. Aboulama ◽

M. Peterschmitt

Keyword(s):

Important Change ◽

Enzyme Linked Immunosorbent Assay ◽

Yellow Leaf ◽

Vegetable Crops ◽

Specific Primers ◽

First Report ◽

Large Populations ◽

Healthy Control ◽

Symptomless Plant ◽

Beet Pseudo Yellows Virus

In October, 1999, severe yellowing symptoms were observed in a melon (Cucumis melo L.) crop grown under plastic tunnels in the region of Agadir, Morocco. Large populations of whiteflies (Bemisia tabaci) were noticed during the early stages of the crop. At harvest, leaf samples were collected from two symptomatic plants and one symptomless plant. A mature yellow leaf was assayed from each symptomatic plant and for one of these two plants a younger leaf exhibiting only yellow spots. Cucurbit aphid-borne yellows virus, which causes similar symptoms in melons, was not detected by double-antibody sandwich enzyme-linked immunosorbent assay tests. Total RNA was extracted from fresh leaf tissues and submitted to reverse transcription and polymerase chain reaction with primers specific to two whitefly-transmissible viruses: Beet pseudo-yellows virus (BPYV) and Cucurbit yellow stunting disorder virus (CYSDV) (2). No amplification was obtained with BPYV-specific primers. In contrast, an expected 465-bp product was amplified in all samples from symptomatic plants with CYSDV-specific primers. No amplification was detected in samples from the symptomless plant nor from healthy control plants. B. tabaci-transmitted CYSDV has been reported in the Middle East, southwestern Europe, and North America (1,4). This is the first report of CYSDV in Morocco, and it follows the first report of another B. tabaci-transmitted virus, Tomato yellow leaf curl virus, in tomato (3), suggesting an important change in the viral pathosystem affecting vegetable crops in Morocco. References: (1) Kao et al. Plant Dis. 84:101, 2000. (2) Livieratos et al. Plant Pathol. 47:362, 1998. (3) Peterschmitt et al. Plant Dis. 83:1074, 1999. (4) Wisler et al. Plant Dis. 82:270, 1998.

Download Full-text

First Report of Colletotrichum acutatum on Tomato and Apple Fruits in the Czech Republic

Plant Disease ◽

10.1094/pdis-10-11-0849-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 769-769 ◽

Cited By ~ 4

Author(s):

J. Víchová ◽

B. Staňková ◽

R. Pokorný

Keyword(s):

Czech Republic ◽

Tomato Fruit ◽

Colletotrichum Acutatum ◽

Distilled Water ◽

Species Determination ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Pcr Products ◽

Apple Fruits

Apple (Malus domestica Borkh.) is a fruit traditionally grown in the Czech Republic, and tomatoes (Solanum lycopersicum Mill.), too, are widely raised in this region. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. Earlier, this pathogen caused disease on strawberry in the Czech Republic (2), and now it has become an important pathogen on safflower (4). During the 2010 harvest, anthracnose symptoms were noticed on the fruits of apple and tomato. Infected apples fruits (localities Velká Bíteš and Znojmo) and tomatoes (localities Velká Bíteš and Žabčice) were collected. Typical symptoms on fruit surfaces were round, brown, shriveled and sunken spots, 1.2 to 2.0 cm, with orange conidial masses appearing on the spots. A fungus was isolated from each host on potato dextrose agar and cultured at 25 ± 2°C for 10 days. Mycelium was superficial, partly immersed, and white to gray with occurrence of orange conidial masses. Conidia of the tomato and apple isolates were colorless and fusiform. The size of conidia from the apple and tomato isolates, respectively, ranged from 11 to 15 × 2.5 to 3.5 μm and 11 to 16 × 2.5 to 4 μm. Morphological characteristics suggested that the isolated fungi was a Colletotrichum sp. To fulfill Koch's postulates, healthy tomato and apple fruits were disinfected with 3% sodium hypochlorite for 2 min and rinsed in sterile distilled water. Fruits were pinpricked with a sterile needle and 10 μl of a spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity of 70 ± 5%, and a photoperiod of 12 h. Similar disease symptoms as in the collected fruits were observed on tomato fruits at 7 days and apple fruits at 20 days after inoculation, while no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded a PCR product (450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the tomato fruit isolate (Accession No. JN676199) and apple fruit isolate (Accession No. JN676198) matched with 100% similarity to the C. acutatum sequences in GenBank. The control isolate of C. gloeosporioides matched 100% to sequences AJ749682 and AJ749692. To our knowledge, this is the first report of C. acutatum on tomato and apple fruits in the Czech Republic. This pathogen can endanger the production and storage of apples and tomatoes in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett. 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 95:79, 2011.

Download Full-text

First Report of Cucurbit aphid-borne yellows virus in Iran Causing Yellows on Four Cucurbit Crops

Plant Disease ◽

10.1094/pd-90-0526a ◽

2006 ◽

Vol 90 (4) ◽

pp. 526-526 ◽

Cited By ~ 7

Author(s):

K. Bananej ◽

C. Desbiez ◽

C. Wipf-Scheibel ◽

I. Vahdat ◽

A. Kheyr-Pour ◽

...

Keyword(s):

Citrullus Lanatus ◽

Healthy Plant ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Chain Reactions ◽

Reference Isolate ◽

Sigma Chemical ◽

International Mycological Institute ◽

Das Elisa

A survey was conducted from 2001 to 2004 in the major cucurbit-growing areas in Iran to reassess the relative incidence of cucurbit viruses. Severe yellowing symptoms were observed frequently on older leaves of cucurbit plants in various regions in outdoor crops, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae) (1,2). Leaf samples (n = 1019) were collected from plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita sp.), and watermelon (Citrullus lanatus L.) showing various virus-like symptoms (mosaic, leaf deformation, yellowing). All samples, collected from 15 provinces, were screened for the presence of CABYV by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with IgGs and alkaline phosphatase-conjugated IgGs against a CABYV reference isolate (1). Of the 1,019 samples tested, 471 were positive for CABYV using DAS-ELISA. Some of the positive samples had typical severe yellowing symptoms while symptoms in other samples were masked by mosaic or leaf deformations caused by other viruses frequently found in mixed infections (data not shown). During the entire survey, CABYV was detected by DAS-ELISA in 201 of 503 melon samples, 72 of 129 cucumber samples, 158 of 249 squash samples, and 40 of 138 watermelon samples. These results indicate that CABYV is widely distributed on four cucurbit species in the major growing areas of Iran. In order to confirm CABYV identification, total RNA extracts (TRI-Reagent, Sigma Chemical, St Louis, MO) were obtained from 25 samples that were positive using DAS-ELISA originating from Khorasan (n = 4), Esfahan (n = 6), Teheran (n = 3), Hormozgan (n = 4), Azerbaiejan-E-Sharqi (n = 4), and Kerman (n = 4). Reverse transcription-polymerase chain reactions (RT-PCR) were carried out using forward (5′-CGCGTGGTTGTGG-TCAACCC-3′) and reverse (5′-CCYGCAACCGAGGAAGATCC-3′) primers designed in conserved regions of the coat protein gene according to the sequence of a CABYV reference isolate (3) and three other unpublished CABYV sequences. RT-PCR experiments yielded an expected 479-bp product similar to the fragment amplified with extracts from the reference isolate. No amplification of the product occurred from healthy plant extracts. To our knowledge, this is the first report of the occurrence of CABYV in Iran on various cucurbit species. The high frequency (46.2%) with which CABYV was detected in the samples assayed indicates that this virus is one of the most common virus infecting cucurbits in Iran. References: (1) H. Lecoq et al. Plant Pathol. 41:749, 1992 (2) M. A. Mayo and C. J. D'Arcy. Page 15 in: The Luteoviridae. H. G. Smith and H. Barker, eds. CAB International Mycological Institute, Wallingford, UK, 1999. (3) H. Guilley et al. Virology 202:1012, 1994.

Download Full-text

First Report of Colletotrichum acutatum sensu lato Causing Anthracnose on Gooseberry Fruits in the Czech Republic

Plant Disease ◽

10.1094/pdis-01-13-0080-pdn ◽

2013 ◽

Vol 97 (9) ◽

pp. 1249-1249 ◽

Cited By ~ 1

Author(s):

J. Víchová ◽

B. Jílková ◽

R. Pokorný

Keyword(s):

Czech Republic ◽

Morphological Characteristics ◽

Colletotrichum Acutatum ◽

Species Determination ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Sterile Needle ◽

Pcr Products ◽

Pathogen Dna

Gooseberry (Ribes uva-crispa L.) is a commonly grown fruit tree or bush in the Czech Republic. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. This pathogen has been reported causing anthracnose on strawberry in the Czech Republic (2), and recently it has become an important pathogen on the fruits of apple and tomato (4). In 2012, anthracnose symptoms were noticed on fruits of gooseberry (locality Pribyslavice, near Brno). The symptoms on fruit surfaces were round, brown, shriveled, sunken spots of 1.2 to 2.0 cm, with orange conidial masses on the spots. The pathogen was isolated from symptomatic fruits on PDA and cultured at 25 ± 2°C. The color of colonies varied with age from white to gray with occurrence of orange conidial masses. Conidia were colorless and fusiform, size 13 to 17 × 4 to 5 μm (n = 100). The morphological characteristics classified the pathogen as a Colletotrichum sp. To fulfill Koch's postulates, 25 disinfested healthy gooseberry fruits were pinpricked by sterile needle and 10 μl of spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity 70 ± 5%. Similar anthracnose symptoms were observed on all of gooseberry fruits a week after inoculation, whereas no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (size 490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded PCR product (size 450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the gooseberry fruit isolates (Accession No. JX843763 and JX843764) matched with 100% similarity to the C. acutatum sequences in GenBank. To our knowledge, this is the first report of C. acutatum sensu lato on gooseberry fruits in the Czech Republic. This pathogen can endanger the production of gooseberry fruits in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett., 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 96:769, 2012.

Download Full-text

First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽

10.1094/pdis-93-9-0970a ◽

2009 ◽

Vol 93 (9) ◽

pp. 970-970 ◽

Cited By ~ 4

Author(s):

R. M. Castro ◽

E. Hernandez ◽

F. Mora ◽

P. Ramirez ◽

R. W. Hammond

Keyword(s):

Costa Rica ◽

Sequence Analysis ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Download Full-text

First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea

Plant Disease ◽

10.1094/pdis-10-20-2254-pdn ◽

2021 ◽

Author(s):

Hae-Ryun Kwak ◽

Hui-Seong Byun ◽

Hong-Soo Choi ◽

Jong-Woo Han ◽

Chang-Seok Kim ◽

...

Keyword(s):

Coat Protein ◽

South Korea ◽

East Asia ◽

Rna Extraction ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Chlorotic Mottle ◽

Cucurbit Chlorotic Yellows Virus

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

Download Full-text

First Report of Potato mop-top virus on Potato in Poland

Plant Disease ◽

10.1094/pdis-94-7-0920a ◽

2010 ◽

Vol 94 (7) ◽

pp. 920-920 ◽

Cited By ~ 9

Author(s):

M. Budziszewska ◽

P. Wieczorek ◽

K. Nowaczyk ◽

N. Borodynko ◽

H. Pospieszny ◽

...

Keyword(s):

Pcr Amplification ◽

Potato Production ◽

Amino Acid Identity ◽

Sequence Comparisons ◽

First Report ◽

Pcr Products ◽

Potato Mop Top Virus ◽

Negative Controls ◽

North And South America ◽

Das Elisa

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5′GGTTTGTTTACCACCCTTGG3′ (3) and PMTV2 5′AAAAGCCTGAGCGGTTAATTG3′ (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

Download Full-text

First Report of Cucurbit chlorotic yellows virus Infecting Cucurbits in Taiwan

Plant Disease ◽

10.1094/pdis-94-9-1168b ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168 ◽

Cited By ~ 33

Author(s):

L.-H. Huang ◽

H.-H. Tseng ◽

J.-T. Li ◽

T.-C. Chen

Keyword(s):

Citrullus Lanatus ◽

Bottle Gourd ◽

Insect Vector ◽

Silverleaf Whitefly ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Dna Fragment ◽

Cucurbit Chlorotic Yellows Virus

In April 2009, chlorosis, yellows, and bleaching accompanied with green veins and brittleness on the lower leaves of cantaloupe (Cucumis melo L.) were observed in Lunbei Township, Yunlin County, Taiwan. The same symptoms were also found on cucumber (Cucumis sativus L.), pumpkin (Cucurbita moschata Duchesne), watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai), bottle gourd (Lagenaria siceraria (Molina) Standl.), and oriental pickling melon planted in other areas of Yunlin and Changhua counties in central Taiwan. Large populations of whiteflies were observed in association with the diseased cucurbit crops, and they were further identified as silverleaf whitefly (Bemisia argentifolii Bellows & Perring) by PCR with specific primers BaBF (5′-CCACTATAATTATTGCTGTTCCCACA-3′) and l2-N-3014R (5′-TCCAATGCACTAATCTGCCATATTA-3′) (3). In June 2009, samples from symptomatic cantaloupe were collected for virus diagnosis. Flexuous filamentous virions of 700 to 900 nm were observed in crude sap of the symptomatic cantaloupe tissues with transmission electron microscopy. On the basis of the suspected insect vector, symptomology, and virus morphology, a Crinivirus species was suspected as the causal agent. A nested reverse transcription (RT)-PCR assay with degenerate deoxyinosine-containing primers developed for detection of Closterovirus and Crinivirus (1) was conducted. Total RNAs extracted from 16 symptomatic cantaloupe samples with a Plant Total RNA Miniprep Purification Kit (Hopegen, Taichung, Taiwan) were analyzed, and a 0.5-kb DNA fragment was amplified from eight of them. The PCR products were sequenced and the sequences were identical among samples. A comparison of the submitted sequence (Accession No. HM120250) with those in GenBank showed that the sequence was identical to the Hsp70h sequences of Cucurbit chlorotic yellows virus (CCYV) isolates from Japan (Accession No. AB523789) (4) and China (Accession Nos. GU721105, GU721108, and GU721110). To identify CCYV infection in the field, the specific primers, Crini-hsp70-f (5′-GCCATAACCATTACGGGAGA-3′) and Crini-hsp70-r (5′-CGCAGTGAAAAACCCAAACT-3′), that amplify a 389-bp DNA fragment corresponding to the nucleotide 1,324 to 1,712 of RNA2 of the original CCYV Japan isolate (Accession No. AB523789) were designed for detection of CCYV. In RT-PCR analyses, CCYV was identified in cantaloupe (305 of 599 samples), watermelon (27 of 93 samples), cucumber (all 15 samples), melon (82 of 92 samples), pumpkin (8 of 10 samples), and bottle gourd (10 of 17 samples) showing chlorosis and yellowing. The 389-bp DNA fragment was also amplified by RT-PCR with the primer pair Crini-hsp70-f/Crini-hsp70-r from total RNA extracts of 29 of 116 silverleaf whitefly individuals collected from the diseased cantaloupe fields in Lunbei Township from August to October, 2009. CCYV is a newly characterized Crinivirus species, first discovered in Japan in 2004 (2) and also found in China in 2009. To our knowledge, this is the first report that CCYV is emerging as a threat to cucurbit productions in Taiwan. References: (1) C. I. Dovas and N. I. Katis. J. Virol. Methods 109:217, 2003. (2) Y. Gyoutoku et al. Jpn. J. Phytopathol. 75:109, 2009. (3) C. C. Ko et al. J. Appl. Entomol. 131:542, 2007. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Download Full-text