scholarly journals First Report of Pseudomonas oryzihabitans Causing Stem and Leaf Rot on Muskmelon in China

Plant Disease ◽  
2021 ◽  
Author(s):  
JuFen Li ◽  
Ganghan Zhou ◽  
Tan Wang ◽  
Tao Lin ◽  
yiwen wang ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Distilled Water ◽  
Phylogenetic Tree Analysis ◽  
First Report ◽  
Rot Disease ◽  
The 16S Rrna Gene ◽  
Leaf Rot

Muskmelon (Cucumis melo L.) is an important economic crop in China, which is planted on more than 376, 000 hectares with over 13 million tons of annual fruit production. In February 2020, a serious bacterial stem and leaf rot disease on muskmelon plants was observed in greenhouses in Liguo Town, Ledong County, Hainan Province, China (18.54° N, 108.87° E), with disease incidences being approximately 10 to 12%. Initially, soft rot symptoms appeared on petioles and stems, showing yellow bacterial ooze signs, which was different from the milky white ooze produced by Erwinia tracheiphila infection. The infected tissues of petioles, stems, and leaves eventually developed into browning and withering symptoms. To isolate and identify the causal agent, the lesion tissues were sterilized by immersion in 75% ethanol for 30 s, washed three times with sterile water, and then cut and soaked in 1 ml of distilled water for 10 min. The suspension was serially diluted and spread on Luria-Bertani agar (LB) medium. After incubation at 28°C for 24 to 36 h, the resulted bacterial colonies were tiny and were streaked on LB plate for further culture. After purification, the colonies were yellow, circular, smooth-margined, and two independent representative isolates CM-11 and CM-12 were used for further validation experiments. The electron microscope analysis showed that the pathogen was rod-shaped, with a length of 1.34 ± 0.22 μm and a width of 0.54 ± 0.06 μm (N=50), and had a single terminal flagellum. The gram staining of the two isolates was negative. Moreover, the tested strains were positive for catalase but negative for oxidase and were able to utilize D-glucose, L-arabinose, and D-mannitol. Morphological, physiological, and biochemical characteristics of both isolates were consistent with those of Pseudomonas spp. To verify the species identity of the bacterial pathogens, genomic DNA of isolates CM-11 and CM-12 was extracted and several conserved genes were amplified and sequenced, including the 16S rRNA gene with primers 27F/1492R (GenBank MW187499 and MW187500), rpoB gene with primers V4/LAPS27 (MW201910 and MW446819), and gyrB gene with primers gyrBBAUP2/APrU (MW187501 and MW187502) (Mulet et al. 2010). In the BLAST analysis, the 16S rRNA sequences showed a 99% similarity to that of Pseudomonas oryzihabitans strains TH19 (LC026009), AA21 (MG571765). The rpoB and gyrB sequences showed high similarity (> 98%) to P. oryzihabitans strains FDAARGOS_657. The phylogenetic tree analysis of rpoB and gyrB genes further verified that the two isolates CM-11 and CM-12 were most closely related to P. oryzihabitans species. Consequently, the two pathogenic isolates CM-11 and CM-12 were identified as P. oryzihabitans. Both strains of CM-11 and CM-12 were tested to accomplish Koch's postulates. Young branches of muskmelons (cultivar Yugu, 10 days after pollination) were chosen as the material for inoculation. Ten healthy detached branches were placed in 15 ml tubes by submerging the cutting wound in 5 ml of the bacterial suspension (108 CFU/ml). Ten additional branches were implemented with sterilized distilled water as a negative control. The inoculated branches were placed in a plastic box containing moistened paper at 28°C. Rotting symptoms appeared within 5 days after infection, while the control samples remained healthy. Bacteria were re-isolated from diseased tissues, and the 16S rRNA gene sequences of the isolates showed the same as those from the original pathogen. Panicle blight and grain discoloration disease caused by P. oryzihabitans on rice has been described in China (Hou et al. 2020). It’s also recently found that P. oryzihabitans caused center blackening disease on muskmelon fruit in Korea (Choi et al. 2019). This study indicated that it was a causative agent of stem and leaf rot disease during the field growth period. To the best of our knowledge, this is the first report of P. oryzihabitans causing muskmelon stem rot in China.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals Molecular identification and genotyping of Atopobium vaginae, 16s rRNA gene from Bacterial Vaginosis miscarriage women in AL-Hillah city

2013 ◽  
Vol 11 (01) ◽  
pp. 74-82
Author(s):  
Ilham A. Bunyan ◽  
Asmaa K. Gatea ◽  
Alaa K. Hameed
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Phylogenetic Tree ◽  
Rrna Gene ◽  
City Hospital ◽  
Phylogenetic Tree Analysis ◽  
Tree Analysis ◽  
Columbia Blood Agar ◽  
The 16S Rrna Gene ◽  
Atopobium Vaginae

This study was aimed to determine the Atopobium vaginae associated BV in vaginosis women and women with miscarriage. Also other aim, the DNA sequencing was performed for phylogenetic tree analysis of 16SrRNA gene in local Atopobium vaginae isolates in comparison with NCBI-Genbank global Atopobium vaginae isolates and finally submission of the present isolates in NCBI-Genbank database. One hundred fifty (150) high vaginal swabs were collected from women with vaginosis(Seventy five samples were taken from married vaginosis women without miscarriage and Seventy five samples from vaginosis women with miscarriage) from Babylon city hospital and private clinics. The age of patient (15– 45) years. The sample was collected by disposable swabs, genomic DNA was extracted from these swabs. 16s rRNA gene detection by polymerase chain reaction technique . Atopobium vaginae was isolated on Columbia blood agar supplemented with antibiotic for the first time in Iraq, the study confirmed that 9 (12.00%) and 5(6.66%) of Atopobium vaginae out of 150 swabs isolated from miscarriage and non-miscarriage vaginosis women respectively. According to the detection of the 16S rRNA gene, the study revealed that 69(92.00%)and 47(62.66%)of Atopobium vaginae out of 150 swabs obtained from miscarriage and non-miscarriage vaginosis women respectively. BLAST analysis showed that the 16S rRNA gene shared more than 98- 99% sequence compatibility with the sequences of Atopobium vaginae. Furthermore, the phylogenetic tree analysis of the 16S rRNA gene indicated that local Atopobium vaginae (NO.1 and NO. 2 ) isolates shared higher homology with other Atopobium vaginae isolates available in the GenBank. The homology of the nucleotides was between (99.17% and 98.75%) respectively.

scholarly journals First Report of Bacterial Blight of Pomegranate Caused by Xanthomonas axonopodis pv. punicae in Turkey

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1427-1427 ◽  
Author(s):  
S. M. Icoz ◽  
I. Polat ◽  
G. Sulu ◽  
M. Yilmaz ◽  
A. Unlu ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Blight ◽  
Acid Methyl Ester ◽  
Rrna Gene ◽  
Original Strain ◽  
Gene Sequences ◽  
Xanthomonas Axonopodis ◽  
First Report ◽  
The 16S Rrna Gene

Pomegranate (Punica granatum L.) is an increasingly important fruit crop that is widely cultivated in Turkey. Typical bacterial blight symptoms were observed since spring of 2011 in pomegranate orchards located in Antalya Province. Symptoms were characterized by dark brown, angular to irregularly shaped spots on leaves and fruit; cankers on stems, branches, and trunks; and split trunks. The pathogen was isolated from leaf spots on naturally infected plants showing typical symptoms onto yeast dextrose chalk agar. Bright yellow bacterial colonies were consistently isolated. Bacterial strains were characterized as gram negative, oxidase negative, catalase positive, tobacco hypersensitivity positive, and able to produce acid from L-arabinose, D-galactose, D-glucose, and D-mannitol but not from D-xylose. Pathogenicity of the representative bacterial strain Serik-4 was performed on 2-year-old pomegranate plants cv. Hicaz. Leaves were sprayed until runoff with bacterial cell suspensions containing 107 CFU/ml. Inoculated plants were covered with transparent plastic bags to maintain moisture for 48 h. Negative control plants were inoculated with sterile distilled water. Plants were then incubated in a greenhouse at 30°C for 14 days. Symptoms on leaves included dark brown, angular to irregularly shaped water soaked lesions along the veins of the inoculated plants 10 days after inoculation. No lesions developed on the control plants. The symptoms on inoculated plants were similar to those on naturally infected plants. Yellow bacterial colonies were re-isolated from the inoculated plants and identified as the same as the original strain by conventional tests and FAME analysis, thus fulfilling Koch's postulates. Fatty acid methyl ester profiling of the representative strain Serik-4 using GC-MIDI (Microbial Identification Inc, Newark, DE) identified the genus of the bacterium as Xanthomonas. The identity of Serik-4 was further confirmed by amplifying the 16S rRNA gene with the universal primers 27F and 1492R (3) and sequence analysis (GenBank Accession No. KM007073). The 16S rRNA gene sequences of Serik-4 was 99% identical to the corresponding gene sequences of the Xanthomonas axonopodis pv. punicae strain present in the NCBI database (JQ067629.1). High incidence of bacterial blight caused by X. axonopodis pv. punicae on pomegranate has been previously reported in India (2), Pakistan (1), and South Africa (4). To our knowledge, this is the first report of bacterial blight on pomegranate caused by X. axonopodis pv. punicae in Turkey. References: (1) M. A. Akhtar and M. H. R. Bhatti. Pakistan J. Agric. Res. 13:95, 1992. (2) R. Chand and R. Kishun. Indian Phytopathol. 44:370, 1991. (3) D. J. Lane. Page 115 in: Nucleic Acid Techniques in Bacterial Systematics, 1991. (4) Y. Petersen et al. Australas. Plant Pathol. 39:544, 2010.

scholarly journals First Report of Pectobacterium parmentieri Causing Blackleg on Potato in Inner Mongolia, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yaning Cao ◽  
Qinghua Sun ◽  
Zhiwen Feng ◽  
Utpal Handique ◽  
Jian Wu ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Inner Mongolia ◽  
Rrna Gene ◽  
Pectobacterium Carotovorum ◽  
Distilled Water ◽  
First Report ◽  
Potato Plants ◽  
Sequence Identity ◽  
Carotovorum Subsp

Blackleg on potato plants (Solanum tuberosum) is caused by Pectobacterium spp. and Dickeya spp. (Charkowski, 2018) worldwide. From June to August in both 2018 and 2019, cases of blackleg were investigated in potato-producing areas in Hulunbuir, Ulanqab, and Hohhot in Inner Mongolia, China. The total surveyed field area was about 200 hectares. The plants showed typical blackleg symptoms, such as black and stunted stems or curled leaves (Fig. S1), and the number of infected plants were counted. The disease showed an incidence of around 8%. Five diseased plants were collected from a 10 ha potato field with approximately 75,000 potato plants (cv. mainly Favorita and Xisen) per hectare. Two-centimeter-long samples of symptomatic stems were removed from the selected plants using a sterile scalpel. The surfaces of the samples were disinfected with 75% ethanol for 2 min. They were then rinsed with sterile distilled water and soaked in 5 ml sterile distilled water for 30 min. Aliquots of three tenfold dilutions of this solution were plated onto the crystal violet pectate agar (CVP) plate and incubated for 3 days at 28°C (Ge et al., 2018). A single bacterial colony that showed pitting on CVP plates (Fig. S2) was picked with a toothpick, streaked onto nutritional agar (She et al., 2013) to obtain pure colonies. Amplification of a 1.4-kb segment containing 16S rRNA gene was performed on the pure colonies using the universal primer set 27F/1492R (Monciardini et al., 2002). The amplicons were sequenced and submitted to the GenBank Nucleotide Basic Local Alignment Search Tool analysis. The 16S rRNA gene sequences of four isolates (GenBank accession numbers: MN626412, MN626449, MN625916, and MT235556) showed more than 99% sequence identity to Pectobacterium parmentieri type strain RNS 08-42-1A (NR_153752.1) (Fig. S3). Six housekeeping genes proA (MT427753-MT427756), gyrA (MT427757–MT427760), icdA (MT427761-MT427764), mdh (MT427765–MT427768), gapA (MT427769-MT427772), and rpoS (MT427773–MT427776) of these four isolates were amplified and sequenced (Ma et al., 2007, Waleron et al., 2008). All sequences showed 99% to 100% sequence identity with Pectobacterium parmentieri strains. Phylogenetic trees (Fig. S4) were constructed by multi-locus sequence analysis (MLSA) using MEGA 6.0 software (Tamura et al., 2013). The samples were tested against Koch’s postulates on potato seedlings (cv. Favorita) by injecting 100 μl bacterial suspension (107 CFU/ml) or sterile phosphate buffered solution into the stems 2 cm above the base (Ge et al., 2018). The seedlings were incubated at 21°C and 80% humidity (She et al., 2013). Three to 5 days after inoculation, only infected seedlings showed similar symptoms as those observed in the field: the infected area turned black and rotten (Fig. S5). Bacterial colonies isolated from these symptomatic seedlings were identified using the same methods described above and were identified as inoculated Pectobacterium parmentieri strains. Blackleg on potato plants has been reported to be caused by Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum, and Pectobacterium carotovorum subsp. brasiliense in China (Zhao et al., 2018). To our knowledge, this is the first report of blackleg of potato caused by Pectobacterium parmentieri in Inner Mongolia, China. We believe that this report will draw attention to the identification of this pathogen, which is essential to disease management.

scholarly journals First Report Regarding Potato Scab Caused by Streptomyces acidiscabies in Uruguay

Plant Disease ◽  
2012 ◽  
Vol 96 (7) ◽  
pp. 1064-1064 ◽  
Author(s):  
M. I. Lapaz ◽  
E. Verdier ◽  
M. J. Pianzzola
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Potato Scab ◽  
Rrna Gene ◽  
Genus Streptomyces ◽  
Pathogenicity Genes ◽  
First Report ◽  
Streptomyces Acidiscabies ◽  
Potato Scab Disease ◽  
The 16S Rrna Gene

Potato scab disease is caused by gram-positive filamentous bacteria in the genus Streptomyces. A great variety of species cause this disease, but Streptomyces scabies is the most ancient of these pathogens and can be found in a worldwide distribution, whereas S. turgidiscabies and S. acidiscabies are newly emerged pathogens (2). During the autumn of 2010, potato (Solanum tuberosum) crops had large economic losses by common scab, corresponding to 29% of the total potato-cultivation area (according to our survey), which was unusual in Uruguay. Specifically, the disease was very aggressive and the tubers showed particularly deep scab lesions. We isolated the Streptomyces species present in these particular scab lesions of tubers collected in July 2010 from one of the three potato cultivation areas (San José). A total of 19 Streptomyces spp. strains were isolated and identified using classical and molecular techniques. Morphological characteristics of colonies and microscopic structure of the mycelium were observed (1). Molecular characterization by conventional PCR was carried out using primers directed to specific regions of the 16S rRNA gene for the genus Streptomyces, Aci1: (5′-TCACTCCTGCCTGCATGGGCG-3′) and Aci2: (5′-CGACAGCTCCCTCCCACAAG-3′). Also, regions of two pathogenicity genes, namely txtAB and nec1, were amplified and confirmed by sequencing (2). Additionally, melanin production and pathogenicity of the isolates was determined by inoculation of potato discs (1). Six of the 19 strains succeeded in PCR amplification with primers specific to Streptomyces acidiscabies, which has white, aerial hypha and flexuous spore chains. These strains did not produce melanin on tyrosine agar media. The amplified fragments for 16S rRNA and pathogenicity genes from one representative strain 61 were sequenced. BLASTn analysis of the 16S rRNA gene sequence obtained of the strain 61 (Accession No. JN206667) showed the highest similarity (100%) with S. acidiscabies type strain 84-01-182 (GenBank Accession No. FJ007427.1). Pathogenicity of the isolate was tested on tuber slices. The isolate was grown on YME for 5 to 7 days at 28°C and agar plugs from the sporulating colonies were inverted onto excised tuber tissue. Disks were incubated at 28°C in the dark and the presence of necrosis was evaluated after 5 days (1). All tuber slice assays were repeated three times. The noninoculated control tuber slices did not show any necrosis, while those inoculated with the strain did. To our knowledge, this is the first report of S. acidiscabies causing potato scab disease in Uruguay. References: (1) D. H. Park et al. Plant Dis. 87:1290, 2003. (2) L. A. Wanner. Phytopathology 96:1361, 2006.

scholarly journals First Report of Pantoea agglomerans Causing Leaf Blight and Vascular Wilt in Maize and Sorghum in Mexico

Plant Disease ◽  
2007 ◽  
Vol 91 (10) ◽  
pp. 1365-1365 ◽  
Author(s):  
G. Morales-Valenzuela ◽  
H. V. Silva-Rojas ◽  
D. Ochoa-Martínez ◽  
E. Valadez-Moctezuma ◽  
B. Alarcón-Zúñiga ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Dna Analysis ◽  
Leaf Blight ◽  
Pantoea Agglomerans ◽  
Rrna Gene ◽  
Vascular Wilt ◽  
First Report ◽  
Central Highland ◽  
The 16S Rrna Gene

Zea mays and Sorghum bicolor are important crops for animal and human nutrition worldwide. In the Central Highland Valley of Mexico, both crops are extremely important, and research is aimed toward increasing yield, disease resistance, and crop adaptation from 1,900- to 2,700-m elevation. In a 3-year field breeding experiment (2004 to 2006), leaf blight and vascular wilt symptoms were frequently observed in contiguous plots of maize and sorghum crops in Montecillo, Mexico and maize plots in Tecamac, Mexico. To identify and characterize the causal agent of these symptoms, isolations were conducted on leaves from areas where healthy and diseased tissues converged. Leaf sections of 1 cm2 from both crops were disinfested, placed on casamino acid-peptone-glucose (CPG) medium, and incubated at 28°C. After 48 h, only yellow colonies were observed and 12 isolates were selected for further characterization. Physiological and biochemical tests indicated that the isolates were nonfluorescent on King's B medium, and API 50 CHE (bioMérieux, Marcy l'Etoile, France) revealed that they were negative for gelatin hydrolysis, indole production, acid production from raffinose and positive for utilization of glycerol, D-glucose, mannitol, arbutine, esculine, salicine, cellobiose, maltose, melibiose, D-fucose, and D-arabitol; all characteristics of Pantoea agglomerans. Further identification of these isolates was accomplished by DNA analysis. For DNA analysis, 1.4-kbp fragments of the 16S rRNA gene were amplified with primer set 8F/1492R (3) and sequenced with U514F/800R universal primers (2). Five sequences were obtained and deposited in GenBank (Accession Nos. EF050806 to EF050810). A phylogenetic tree was constructed using the UPGMA method (mega version 3.1). Results of the phylogenetic analysis grouped the species P. ananatis, P. stewartti, and P. agglomerans into three clusters. The five unknown sequences were grouped into the P. agglomerans cluster. There was a 98 to 99% similarity of the five 16S rRNA gene sequences with P. agglomerans strain type ATCC 27155. Pathogenicity of the 12 isolates was confirmed by injecting 108 CFU mL–1 of inoculum into stems of 3-week-old maize cv. Triunfo and sorghum cold tolerant hybrid (A1×B5)×R1 seedlings in the greenhouse at 28°C and 80% relative humidity. Also, seedlings were inoculated with water, nonpathogenic isolates of P. agglomerans from maize (GM13, and HLA1), and not inoculated as negative controls. Three replications were included for each isolate and control. All test strains developed water-soaked lesions on juvenile leaves at 8 days postinoculation and were followed by chlorotic to straw-colored leaf streaks and then leaf blight symptoms at 3 weeks postinoculation. All negative control seedlings did not develop symptoms. In addition, the 12 isolates were infiltrated at 107 CFU mL–1 into tobacco leaves that displayed a hypersensitive response at 4 days, indicating the presence of the type III secretion system (1). Isolates were reisolated, and the 16S rRNA gene fragments were 100% similar to their original isolate sequences. P. agglomerans has been reported to affect other crops, including chinese taro in Brazil (2007), onion in the United States (2006) and South Africa (1981), and pearl millet in Zimbabwe (1997); however, to our knowledge, this is the first report of P. agglomerans associated with leaf blight and vascular wilt symptoms in maize and sorghum in the Central Highland Valley of Mexico. References: (1) J. Alfano and A. Collmer. Annu. Rev. Phytopathol 42:385, 2004. (2) Y. Anzai et al. Int. J. Syst. Evol. Microbiol. 50:1563, 2000. (3) M. Sasoh et al. Appl. Environ. Microbiol. 72:1825, 2006.

scholarly journals First Report of Bud Soft Rot on Agave angustifolia Caused by Pantoea dispersa in Mexico

Plant Disease ◽  
2021 ◽  
Author(s):  
FRANCISCO PALEMON ◽  
Santo Angel Ortega-Acosta ◽  
Santiago Dominguez-Monge ◽  
Alvaro Castañeda-Vildozola ◽  
Guadalupe Reyes-Garcia ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Sterile Water ◽  
First Report ◽  
Agave Angustifolia ◽  
Pantoea Dispersa ◽  
Initial Symptoms

The agave (Agave spp.) is an important crop in México, with 120,897 ha grown mainly for alcoholic beverage production (SIAP, 2019). In September 2020, in the municipality of Huitzuco de los Figueroa (18.328692 N; 99.3998 W), Guerrero State, México, a serious disease was observed affecting Agave angustifolia. Disease incidence was 8% of 150 plants sampled over an approximate area of 2.5 ha. Initial symptoms of soft rot of the bud developed and produced an abundant exudate which appeared from the apical part to the base of the plant. In severe infections, the plants showed total maceration of the bud, and consequently death of the plants was observed. Symptomatic plant tissue was superficially disinfected with 1% NaOCl for 30 s, and rinsed in sterile water three times. The disinfected tissues were macerated and with a loop spread in Nutrient Agar. The plates were incubated at 28 ° C for 2 days. Yellowish bacterial colonies were isolated, and eight colonies were selected for characterization. The bacterial strains were gram negative and rod-shaped, negative for fluorescent pigment tests and Kovacs' oxidase. Two isolates designated AGA1 and AGA2 were identified by PCR amplification and sequencing of the partial 16S rRNA gene with the primer 27F / 1492R (Lane 1991), and partial fusA, rpoB, and gyrB genes (Delétoile et al. 2009). Sequences were deposited in GenBank, with the accession numbers for 16S rRNA, AGA1 as MW548406 and AGA2 as MW548407; for specific genes fusA (AGA1 = MW558445, AGA2 = MW558446), rpoB (AGA1 = MW558447, AGA2 = MW558448) and gyrB (AGA1 = MW558449, AGA2 = MW558450), and they were compared with the sequences available in GenBank using BLASTn. 16S rRNA gene sequences for AGA1 and AGA2 aligned with Pantoea dispersa (MT921704.1, 99.9% identity). Housekeeping genes also aligned 99 to 100% to P. dispersa (fusA = 100%, CP045216.1; rpoB = 99.8% MH015167.1 and gyrB = 99%, MK928270.1). Phylogenetic analysis of concatenated genes showed that strains AGA1 and AGA2 cluster with P. dispersa. To confirm pathogenicity, eight plants of six-month-old A. angustifolia were inoculated with strain AGA1 using sterile toothpicks dipped in 108 CFU/ml bacterial suspension. The toothpicks were inserted in the middle part of the bud. Four plants were inoculated with sterile water as control. The plants were covered with plastic bags and housed in a greenhouse (average temperature and relative humidity of 25 ° C and 85%, respectively). Pathogenicity tests were repeated two times. After seven days, all inoculated plants developed symptoms similar to those observed in the field. Control plants did not show symptoms. From the plants that showed symptoms, the pathogen was reisolated again and was identified by morphological and molecular characterization, following the method previously described, fulfilling Koch's postulates. In México, Erwinia cacticida and Pantoea ananatis has been previously reported on A. tequilana that as causing soft rot and red leaf ring, respectively (Jimenez-Hidalgo et al. 2004; Fucikovsky and Aranda 2006). To our knowledge, this is the first report of P. dispersa causing bud soft rot on A. angustifolia in México. More studies monitoring and control strategies of bud soft rot on A. angustifolia are required.

scholarly journals First Report of Pantoea agglomerans Causing Brown Apical Necrosis of Walnut in China

Plant Disease ◽  
2011 ◽  
Vol 95 (6) ◽  
pp. 773-773 ◽  
Author(s):  
K. Q. Yang ◽  
W. W. Qu ◽  
X. Liu ◽  
H. X. Liu ◽  
L. Q. Hou
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Juglans Regia ◽  
Shandong Province ◽  
Pantoea Agglomerans ◽  
The Body ◽  
Rrna Gene ◽  
First Report ◽  
Apical Necrosis ◽  
The 16S Rrna Gene

Brown apical necrosis (BAN) of walnut (Juglans regia L.) causes premature fruit drop and yield losses and has been reported to be an important walnut production problem in Spain, Italy, France, and Turkey (1,2). A number of organisms have been associated with BAN on walnut: Xanthomonas arboricola pv. juglandis, Fusarium spp., and Alternaria spp. (3). Since the spring of 2007, BAN was observed in 50 to 60% of the trees in walnut orchards in Taian City and Laiwu City, Shandong Province, China. Surface-disinfested tissue from premature walnut fruits was placed onto potato dextrose agar. Alternaria spp., X. arboricola pv. juglandis, and Pantoea agglomerans (formerly Enterobacter agglomerans) were isolated 76, 35, and 45% of the time, respectively. The P. agglomerans cultures formed a yellow lawn and were rod shaped with the body length of 1.5 to 3.0 μm, width of 0.5 to 1.0 μm, and four to six flagella. In biochemical tests, these bacteria were gram negative, lactose positive, and indole negative. Genomic DNA was extracted from one HXJ isolate and the 16S rRNA gene sequence (GenBank Accession No. HM016799) was obtained using universal primers 27F and 1492R. HM016799 had 99% sequence identity with P. agglomerans accessions in GenBank (GU477762, GQ494018, FJ756355, and AB004757). To confirm pathogenicity, HXJ isolate (108 CFU·ml–1) was inoculated at the bottom of the stigma within 5 days after florescence (DAF) and in premature fruit wounded with a needle within 30 DAF in 2008 to 2010. Stigmas injected with only sterile water served as controls. The bacteria were inoculated into three replicate 9-year-old plants of the walnut cv. Xiangling. Forty nuts on each plant were inoculated. The plants were grown in Shandong Province, China (36°09′59″N, 117°13′30″E). Ten days after inoculation, typical internal BAN symptoms were observed on all treated nuts and the controls were still healthy. In the inoculated stigmas, necrosis of stigma and style spread to internal tissues and reached the kernel. In treated premature fruit, internal tissues became necrotic and blackish and eventually led to nut drop. The same bacterium was reisolated from the inoculated tissue. On the basis of morphological, physiological, and biochemical characteristics and sequencing of the 16S rRNA gene, the bacterium was identified as P. agglomerans. To our knowledge, this is the first report of P. agglomerans causing internal type BAN of walnut in China or worldwide. References: (1) A. Belisario et al. Plant Dis. 6:599, 2002. (2) G. Bouvet. Acta Hortic. 705:447, 2005. (3) C. Moragrega and H. Özaktan. J. Plant Pathol. 92:S1.67, 2010.

scholarly journals First report of a ‘Candidatus Phytoplasma aurantifolia’-related strain (16SrII-V) associated with phyllody, virescence, and shoot proliferation of sweet William (Dianthus barbatus) in Taiwan

Plant Disease ◽  
2021 ◽  
Author(s):  
Shin Lee ◽  
Yi-Jin Lee ◽  
Ching-Yu Chang ◽  
Chia-Ching Chu
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Vector System ◽  
Rrna Gene ◽  
Similarity Coefficients ◽  
Diagnostic Pcr ◽  
First Report ◽  
Dianthus Barbatus ◽  
Pcr Targeting ◽  
The 16S Rrna Gene

The sweet William (Dianthus barbatus) is an ornamental belonging to the Caryophyllaceae family; the species produces clusters of flowers that comes in various colors and is grown commonly as garden plants (Lim 2014). In February 2021, sweet Williams showing symptoms typical of phytoplasma diseases were found in a garden located in Wufeng District, Taichung, Taiwan (24°04'37.6"N 120°43'20.4"E). Infected plants exhibited virescence and phyllody symptoms and produced an abnormal number of new shoots from the base of the flowers/flower-like structures (Figure S1) as well as the base of the plants. Among the fifteen plants grown in the area, two exhibited such symptoms. The two symptomatic plants, along with five symptomless plants were sampled. Two flower-like structures were collected from each of the symptomatic plants, and two flower samples were collected for each symptomless plant (Figure S2). Total DNA were extracted from each sample using the Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics) and subjected to diagnostic PCR using primers P1/P7 (Schneider et al. 1995). All four symptomatic samples produced a 1.8-kb amplicon and the ten symptomless samples did not. The amplification products were diluted fifty-fold and used in a second round of PCR using primers R16F2n/R16R2 (Gundersen and Lee 1996). Again, only the symptomatic samples produced an expected 1.25-kb amplicon. A sample was selected for each plant and the PCR products from the first round of PCR were cloned using the pGEM-T Easy Vector System (Promega Inc.) and sequenced (three clones per sample). Fragments of the 16S rRNA gene (1,248 bp; GenBank accession: MW788688) were analyzed using iPhyClassifier (https://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi). Sequences obtained from the two infected plants were identical, and were classified to the 16SrII-V subgroup with similarity coefficients of 1.0; they also shared 98.6% similarity with the sequence of a 'Candidatus Phytoplasma aurantifolia' reference strain (accession: U15442). BLASTn results indicated that the 16S rRNA gene sequences detected were identical to those of 16SrII-V phytoplasmas affecting mungbean (accession: MW319764), lilac tasselflower (accession: MT420682), peanut (accession: JX403944) and green manure soybean (accession: MW393690) found in Taiwan. To corroborate the above results, 16SrII group-specific primers were used to conduct nested and semi-nested PCR targeting the pathogen’s 16S rRNA gene (outer primers: rpF1C/rp(I)R1A; inner primers: rp(II)F1/rp(II)R1; Martini et al. 2007) and immunodominant membrane protein gene (imp; outer primers: IMP-II-F1/IMP-II-R1; inner primers: IMP-II-F2/IMP-II-R1; Al-Subhi et al. 2017). In both assays, the symptomatic samples produced the expected amplicons and the symptomless samples did not. The coding sequence of the imp gene (519 bp; accession: MW755353) was the same among all symptomatic samples, and shared 100% identity with that of the peanut witches'-broom phytoplasma (16SrII; accession: GU214176). To our knowledge, this is the first report of a 16SrII-V phytoplasma infecting sweet Williams in Taiwan. Since 16SrII-V phytoplasmas have also been found infecting mungbeans and peanuts in Taiwan (Liu et al. 2015), the findings here suggest that by serving as a natural host in the field, the sweet William may potentially contribute to the spread of 16SrII-V phytoplasmas to food crops.

Sign in / Sign up

Export Citation Format

Share Document