scholarly journals First Report of Bud Soft Rot on Agave angustifolia Caused by Pantoea dispersa in Mexico

Plant Disease ◽  
2021 ◽  
Author(s):  
FRANCISCO PALEMON ◽  
Santo Angel Ortega-Acosta ◽  
Santiago Dominguez-Monge ◽  
Alvaro Castañeda-Vildozola ◽  
Guadalupe Reyes-Garcia ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Sterile Water ◽  
First Report ◽  
Agave Angustifolia ◽  
Pantoea Dispersa ◽  
Initial Symptoms

The agave (Agave spp.) is an important crop in México, with 120,897 ha grown mainly for alcoholic beverage production (SIAP, 2019). In September 2020, in the municipality of Huitzuco de los Figueroa (18.328692 N; 99.3998 W), Guerrero State, México, a serious disease was observed affecting Agave angustifolia. Disease incidence was 8% of 150 plants sampled over an approximate area of 2.5 ha. Initial symptoms of soft rot of the bud developed and produced an abundant exudate which appeared from the apical part to the base of the plant. In severe infections, the plants showed total maceration of the bud, and consequently death of the plants was observed. Symptomatic plant tissue was superficially disinfected with 1% NaOCl for 30 s, and rinsed in sterile water three times. The disinfected tissues were macerated and with a loop spread in Nutrient Agar. The plates were incubated at 28 ° C for 2 days. Yellowish bacterial colonies were isolated, and eight colonies were selected for characterization. The bacterial strains were gram negative and rod-shaped, negative for fluorescent pigment tests and Kovacs' oxidase. Two isolates designated AGA1 and AGA2 were identified by PCR amplification and sequencing of the partial 16S rRNA gene with the primer 27F / 1492R (Lane 1991), and partial fusA, rpoB, and gyrB genes (Delétoile et al. 2009). Sequences were deposited in GenBank, with the accession numbers for 16S rRNA, AGA1 as MW548406 and AGA2 as MW548407; for specific genes fusA (AGA1 = MW558445, AGA2 = MW558446), rpoB (AGA1 = MW558447, AGA2 = MW558448) and gyrB (AGA1 = MW558449, AGA2 = MW558450), and they were compared with the sequences available in GenBank using BLASTn. 16S rRNA gene sequences for AGA1 and AGA2 aligned with Pantoea dispersa (MT921704.1, 99.9% identity). Housekeeping genes also aligned 99 to 100% to P. dispersa (fusA = 100%, CP045216.1; rpoB = 99.8% MH015167.1 and gyrB = 99%, MK928270.1). Phylogenetic analysis of concatenated genes showed that strains AGA1 and AGA2 cluster with P. dispersa. To confirm pathogenicity, eight plants of six-month-old A. angustifolia were inoculated with strain AGA1 using sterile toothpicks dipped in 108 CFU/ml bacterial suspension. The toothpicks were inserted in the middle part of the bud. Four plants were inoculated with sterile water as control. The plants were covered with plastic bags and housed in a greenhouse (average temperature and relative humidity of 25 ° C and 85%, respectively). Pathogenicity tests were repeated two times. After seven days, all inoculated plants developed symptoms similar to those observed in the field. Control plants did not show symptoms. From the plants that showed symptoms, the pathogen was reisolated again and was identified by morphological and molecular characterization, following the method previously described, fulfilling Koch's postulates. In México, Erwinia cacticida and Pantoea ananatis has been previously reported on A. tequilana that as causing soft rot and red leaf ring, respectively (Jimenez-Hidalgo et al. 2004; Fucikovsky and Aranda 2006). To our knowledge, this is the first report of P. dispersa causing bud soft rot on A. angustifolia in México. More studies monitoring and control strategies of bud soft rot on A. angustifolia are required.

scholarly journals First Report of Bacterial Stalk Rot of Maize Caused by Dickeya zeae in Mexico

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1267-1267 ◽  
Author(s):  
B. A. Martinez-Cisneros ◽  
G. Juarez-Lopez ◽  
N. Valencia-Torres ◽  
E. Duran-Peralta ◽  
M. Mezzalama
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Pathogenic Bacteria ◽  
The State ◽  
Rrna Gene ◽  
Bacterial Disease ◽  
Sterile Water ◽  
First Report ◽  
Stalk Rot ◽  
Positive Controls

A bacterial disease of maize, bacterial stalk and top rot, was found in the state of Morelos in February 2011, and in the state of Puebla in July 2013, Mexico. In both cases, the incidence of diseased plants was lower than 0.5%. The typical symptoms were a soft rot and darkening of the tissues affecting the stalk and the top of the plant, causing breaking of the stalk. The lesions progressed from the top to below nodes, leaf sheaths and blades, and rotten tissues emitted an unpleasant odor. Eleven diseased plants were collected, and bacterial colonies were isolated from fragments detached from the edges of symptomatic tissues after sterilization with a 0.5% solution of NaClO for 30 s, rinsing three times in sterile water. The sterilized fragments were macerated in drops of distilled sterile water for 10 min and the extract was streaked on King's medium B (agar 15 g, distilled water 1,000 ml, proteose peptone 20 g, K2HPO4 1.5 g, MgSO4·7H2O 1.5 g, glycerol 10 ml). Eight representative strains from Morelos and five from Puebla were selected for identification. All strains were gram-negative, grew at 37°C, showed pectynolitic activity on potato tubers, were positive for indole production, utilized arabinose, galactose, glucose, glycerol, lactose, mannose, melibiose, rafinose, ribose, and sucrose but did not produce acid from arabitol, adonitol, and keto-methyl-glucoside (3,4). Pathogenicity tests were conducted with each strain by inoculating with a syringe four 25-day-old maize seedlings with 107 CFU ml–1 bacterial cells in the leaf collar. Plants were incubated in the greenhouse at 30°C during the day and 24°C during the night with a 12-h photoperiod, and relative humidity of 93%. The reference strains Erwinia chrysanthemi pv zeae ATTC29942 and Dickeya zeae CFBP 2052 were used as positive controls in laboratory and greenhouses tests. Sterile water was used as negative control. Two days after inoculation, soft stalk rot symptoms developed that were identical to those observed in the field. No symptoms were observed on the negative controls. Diagnostic amplification of DNA by conventional PCR was carried out and yielded the expected amplicon size of 420 bp of the Dickeya-specific pel gene with the ADE primers set (2). PCR was used to amplify the 16S rRNA gene with the universal primers 27f and 1495r (5) for molecular identification of the 13 strains (GenBank Accession Nos. KJ438941, KJ438942, KJ438943, KJ438944, KJ438945, KJ438946, KJ438947, KJ438948, KJ438949, KJ438950, KJ438951, KJ438952, and KJ438953). The strains D. zeae CFBP 2052 and E. chrysanthemi pv. zeae ATCC 29942 were sequenced as positive controls. A BLAST search with the 13 16S rRNA gene sequences of 1.4 kb were 99% identical to the sequence of D. zeae CFBP 2052 (NR_041923). D. zeae can be a major disease of maize in tropical and subtropical countries. It is particularly severe under conditions of high temperature and high humidity, but it occurs sporadically. Control of the vector, Chilo partellus, can aid disease management (1). To our knowledge, this is the first report of D. zeae causing maize stalk rot in Mexico. References: (1) CABI. Crop Prot. Compend. CAB International, Wallingford, UK, 2014. (2) A. Nassar et al. Appl. Environ. Microbiol. 62:2228, 1996. (3) R. Samson et al. Int. J. Syst. Evol. Microbiol. 55:1415, 2005. (4) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. APS Press, St. Paul, MN, 2001. (5) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals First Report of Pectobacterium punjabense Causing Blackleg and Soft Rot on Potato in Hebei and Fujian Province, China

Plant Disease ◽  
2022 ◽  
Author(s):  
Utpal Handique ◽  
Yaning Cao ◽  
Dekang Wang ◽  
Ruofang Zhang ◽  
Wensi Li ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Rrna Gene ◽  
Pectobacterium Carotovorum ◽  
Fujian Province ◽  
First Report ◽  
Potato Plants ◽  
Carotovorum Subsp

Pectobacterium spp. and Dickeya spp. cause blackleg and soft rot on potato worldwide (Charkowski, 2018). Potato plants (cv. Favorita or Jizhang 8#) with blackleg symptoms (vascular browning of crown stems, Fig. S1) were observed in the field in Zhangjiakou, Hebei province in 2018, and in Ningde, Fujian Province in 2019, in China. The disease incidence was around 50% and 10% in Zhangjiakou (5 ha) and Ningde (4 ha), respectively. Diseased plants (3 from each site) were collected to isolate the pathogen. Blackleg symptomatic stems were soaked in 75% ethanol for 2 min, rinsed and ground in sterile distilled water. Serial tenfold dilutions of the above solution were plated onto the crystal violet pectate agar (CVP) plate (Ge et al., 2018). Two to 3 days after incubation at 28°C, 4 bacterial colonies in total which digested pectin from the media and developed pit on CVP plates were purified and sequenced for identification using the universal 16S rRNA gene primer set 27F/1492R (Monciardini et al., 2002). Two colony sequences that showed more than 99% sequence identity to Pectobacterium punjabense type strain SS95 (MH249622) were submitted to the GenBank ( accession numbers: OK510280, MT242589). Additionally, six housekeeping genes proA (OK546205, OK546199), gyrA (OK546206, OK546200), icdA (OK546207, OK546201), mdh (OK546208, OK546202), gapA (OK546209, OK546203), and rpoS (OK546210, OK546204) of these two isolates were amplified and sequenced (Ma et al., 2007, Waleron et al., 2008). All strains show 99% to 100% identity with MH249622T . Phylogenetic trees based on 16S rRNA gene sequences (Fig. S2) and concatenated sequences of the housekeeping genes (Fig. S3) of the 2 isolates were constructed using MEGA 6.0 software (Tamura et al., 2013). Koch’s postulate was performed on potato seedlings and potato tubers (cv. Favorita) by injecting 100 μl bacterial suspension (105 CFU/ml) or sterile phosphate-buffered solution into the crown area of the stems or the tubers and kept at 100% humidity and 21°C for 1 day. Four days after inoculation, the infected area of the inoculated seedlings rotten and turned black, while the controls were symptomless (Fig. S4). Two days after inoculation, the infected tubers rotten and turned black, while the controls were symptomless (Fig. S4). Bacterial colonies were reisolated from these symptomatic tissues and identified using the same methods described above. Blackleg on potato plants or soft rot on potato has been reported to be caused by Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum, Pectobacterium carotovorum subsp. brasiliense, Pectobacterium parmentieri, Pectobacterium polaris in China (Zhao et al., 2018; Cao et al., 2021; Wang et al., 2021). To our knowledge, this is the first report of blackleg/soft rot of potato caused by Pectobacterium punjabense in China. We believe that this report will draw attention to the management of this pathogen in China.

scholarly journals First Report of Pseudomonas oryzihabitans Causing Stem and Leaf Rot on Muskmelon in China

Plant Disease ◽  
2021 ◽  
Author(s):  
JuFen Li ◽  
Ganghan Zhou ◽  
Tan Wang ◽  
Tao Lin ◽  
yiwen wang ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Distilled Water ◽  
Phylogenetic Tree Analysis ◽  
First Report ◽  
Rot Disease ◽  
The 16S Rrna Gene ◽  
Leaf Rot

Muskmelon (Cucumis melo L.) is an important economic crop in China, which is planted on more than 376, 000 hectares with over 13 million tons of annual fruit production. In February 2020, a serious bacterial stem and leaf rot disease on muskmelon plants was observed in greenhouses in Liguo Town, Ledong County, Hainan Province, China (18.54° N, 108.87° E), with disease incidences being approximately 10 to 12%. Initially, soft rot symptoms appeared on petioles and stems, showing yellow bacterial ooze signs, which was different from the milky white ooze produced by Erwinia tracheiphila infection. The infected tissues of petioles, stems, and leaves eventually developed into browning and withering symptoms. To isolate and identify the causal agent, the lesion tissues were sterilized by immersion in 75% ethanol for 30 s, washed three times with sterile water, and then cut and soaked in 1 ml of distilled water for 10 min. The suspension was serially diluted and spread on Luria-Bertani agar (LB) medium. After incubation at 28°C for 24 to 36 h, the resulted bacterial colonies were tiny and were streaked on LB plate for further culture. After purification, the colonies were yellow, circular, smooth-margined, and two independent representative isolates CM-11 and CM-12 were used for further validation experiments. The electron microscope analysis showed that the pathogen was rod-shaped, with a length of 1.34 ± 0.22 μm and a width of 0.54 ± 0.06 μm (N=50), and had a single terminal flagellum. The gram staining of the two isolates was negative. Moreover, the tested strains were positive for catalase but negative for oxidase and were able to utilize D-glucose, L-arabinose, and D-mannitol. Morphological, physiological, and biochemical characteristics of both isolates were consistent with those of Pseudomonas spp. To verify the species identity of the bacterial pathogens, genomic DNA of isolates CM-11 and CM-12 was extracted and several conserved genes were amplified and sequenced, including the 16S rRNA gene with primers 27F/1492R (GenBank MW187499 and MW187500), rpoB gene with primers V4/LAPS27 (MW201910 and MW446819), and gyrB gene with primers gyrBBAUP2/APrU (MW187501 and MW187502) (Mulet et al. 2010). In the BLAST analysis, the 16S rRNA sequences showed a 99% similarity to that of Pseudomonas oryzihabitans strains TH19 (LC026009), AA21 (MG571765). The rpoB and gyrB sequences showed high similarity (> 98%) to P. oryzihabitans strains FDAARGOS_657. The phylogenetic tree analysis of rpoB and gyrB genes further verified that the two isolates CM-11 and CM-12 were most closely related to P. oryzihabitans species. Consequently, the two pathogenic isolates CM-11 and CM-12 were identified as P. oryzihabitans. Both strains of CM-11 and CM-12 were tested to accomplish Koch's postulates. Young branches of muskmelons (cultivar Yugu, 10 days after pollination) were chosen as the material for inoculation. Ten healthy detached branches were placed in 15 ml tubes by submerging the cutting wound in 5 ml of the bacterial suspension (108 CFU/ml). Ten additional branches were implemented with sterilized distilled water as a negative control. The inoculated branches were placed in a plastic box containing moistened paper at 28°C. Rotting symptoms appeared within 5 days after infection, while the control samples remained healthy. Bacteria were re-isolated from diseased tissues, and the 16S rRNA gene sequences of the isolates showed the same as those from the original pathogen. Panicle blight and grain discoloration disease caused by P. oryzihabitans on rice has been described in China (Hou et al. 2020). It’s also recently found that P. oryzihabitans caused center blackening disease on muskmelon fruit in Korea (Choi et al. 2019). This study indicated that it was a causative agent of stem and leaf rot disease during the field growth period. To the best of our knowledge, this is the first report of P. oryzihabitans causing muskmelon stem rot in China.

scholarly journals First Report of Dickeya solani Causing Soft Rot in Imported Bulbs of Hyacinthus orientalis in China

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 155-155 ◽  
Author(s):  
X. F. Chen ◽  
H. L. Zhang ◽  
J. Chen
Keyword(s):  
16S Rrna ◽  
The Netherlands ◽  
Bacterial Pathogen ◽  
Soft Rot ◽  
Potato Production ◽  
Sterile Water ◽  
First Report ◽  
Hyacinthus Orientalis ◽  
Dickeya Solani ◽  
Negative Controls

A bacterial pathogen, Dickeya solani, emerged as a major threat to potato (Solanum tuberosum) production in Europe in 2004 and has spread to many potato-growing regions via international trade. In December 2013, soft rot symptoms were observed in hyacinth (Hyacinthus orientalis) bulbs imported from the Netherlands into China at Ningbo Port. Diseased bulbs gave off an offensive odor. The base and internal parts of diseased bulbs rotted, and the margins of diseased tissues showed brown discoloration. Isolation on nutrient agar glucose (NAG) medium resulted in dominating colonies of characteristic “fried egg” morphology (1). One colony was chosen for further investigation and tentatively named “isolate 6165-3.” Under microscopic visualization after gram stain, the cells of isolate 6165-3 were gram-negative, motile, and rod shaped. The isolate was then identified as a member of genus Dickeya using the Biolog GN microplate. The 16S rRNA, recA, and dnaX sequences of isolate 6165-3 were subsequently determined and deposited in GenBank with accession numbers KM405240, KM405241, and KM405242, sharing 99% (16S rRNA), 100% (recA), and 100% (dnaX) nucleotide identity with those of known D. solani isolates, respectively. By this means, the isolate 6165-3 was identified as D. solani (1,2). To confirm the pathogenicity of the isolate, four plants each of 30-day-old hyacinth, 14-day-old potato, and 60-day-old moth orchid (Phalaenopsis amabilis) were inoculated with suspensions of the isolate with a concentration of 108 CFU/ml in sterile water by stabbing. Plants were incubated in a climate chamber at 28°C during the day and 24°C during the night with a relative humidity of 93% and a photoperiod of 12/12 h. Plants inoculated with sterile water were included as negative controls. After 2 or 3 days, typical symptoms such as water-soaked lesions and soft rot developed around the inoculation point, while the negative controls remained symptomless. Koch's postulates were fulfilled by re-isolating bacteria from lesions, which had identical sequence and morphology characters with the inoculated isolate. This is the first report of intercepted D. solani on hyacinth bulbs imported from the Netherlands into China, indicating that D. solani can spread via hyacinth. Further spread of the pathogen into potato production might lead to immeasurable economic consequences for China. References: (1) P. F. Sarris et al. New Dis. Rep. 24:21, 2011. (2) J. M. van der Wolf et al. Int. J. Syst. Evol. Microbiol. 64:768, 2014.

scholarly journals The First Report of Stolbur Phytoplasma Associated with Phyllody of Calendula officinalis in Serbia

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1152-1152 ◽  
Author(s):  
S. Pavlovic ◽  
M. Starovic ◽  
S. Stojanovic ◽  
G. Aleksic ◽  
S. Kojic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Natural Infection ◽  
Cytotoxic Activities ◽  
Rrna Gene ◽  
Calendula Officinalis ◽  
Aster Yellows ◽  
First Report ◽  
Pot Marigold ◽  
Stolbur Phytoplasma

Pot marigold (Calendula officinalis L.) is native to southern Europe. Compounds of marigold flowers exhibit anti-inflammatory, anti-tumor-promoting, and cytotoxic activities (4). In Serbia, pot marigold is cultivated as an important medicinal and ornamental plant. Typical phyllody, virescence, proliferation of axillary buds, and witches' broom symptoms were sporadically observed in 2011 in Pancevo plantation, Serbia (44°51′49″ N, 20°39′33″ E, 80 m above sea level). Until 2013, the number of uniformly distributed affected pot marigold plants reached 20% in the field. Due to the lack of seed production, profitability of the cultivation was seriously affected. Leaf samples from 10 symptomatic and 4 symptomless marigold plants were collected and total nucleic acid was extracted from midrib tissue (3). Direct PCR and nested PCR were carried out with primer pairs P1/16S-SR and R16F2n/R16R2n, respectively (3). Amplicons 1.5 and 1.2 kb in length, specific for the 16S rRNA gene, were amplified in all symptomatic plants. No PCR products were obtained when DNA isolated from symptomless plants was used. Restriction fragment length polymorphism (RFLP) patterns of the 1.2-kb fragments of 16S rDNA were determined by digestion with four endonucleases separately (TruI1, AluI, HpaII, and HhaI) and compared with those of Stolbur (Stol), Aster Yellows (AY), Flavescence dorée-C (FD-C), Poinsettia Branch-Inducing (PoiBI), and Clover Yellow Edge (CYE) phytoplasmas (2). RFLP patterns from all symptomatic pot marigold plants were identical to the Stol pattern, indicating Stolbur phytoplasma presence in affected plants. The 1.2-kb amplicon of representative Nv8 strain was sequenced and the data were submitted to GenBank (accession no. KJ174507). BLASTn analysis of the sequence was compared with sequences available in GenBank, showing 100% identity with 16S rRNA gene of strains from Paeonia tenuifolia (KF614623) and corn (JQ730750) from Serbia, and peach (KF263684) from Iran. All of these are members of the 16SrXII ‘Candidatus Phytoplasma solani’ group, subgroup A (Stolbur). Phytoplasmas belonging to aster yellows (16SrI) (Italy and Canada) and peanut witches' broom related phytoplasma (16SrII) group (Iran) have been identified in diseased pot marigold plants (1). To our knowledge, this is the first report of natural infection of pot marigold by Stolbur phytoplasma in Serbia. References: (1) S. A. Esmailzadeh-Hosseini et al. Bull. Insectol. 64:S109, 2011. (2) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (3) J. P. Prince. Phytopathology 83:1130, 1993. (4) M. Ukiya et al. J. Nat. Prod. 69:1692, 2006.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals First Report of Pectobacterium carotovorum subsp. carotovorum Causing Soft Rot of Orostachys japonica in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 989-989 ◽  
Author(s):  
W. Cheon ◽  
Y. H. Jeon
Keyword(s):  
16S Rrna ◽  
Pathogenic Bacteria ◽  
Sequence Similarity ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Pectobacterium Carotovorum ◽  
First Report ◽  
Biolog System ◽  
Carotovorum Subsp ◽  
Physiological Tests

Orostachys japonica (Maxim) A. Berger is an important traditional medicine in Korea. The extract of this plant has antioxidant activity and suppresses cancer cell proliferation (1). From summer through fall of 2012 and 2013, a high incidence (~10% to 30%) of disease outbreaks of all plants characterized by water-soaked lesions and soft rot with a stinky odor was observed in cultivated O. japonica around Uljin (36°59′35.04″N, 126°24′1.51″E), Korea. Water-soaked lesions were first observed on the stem base of plants. Subsequently, the plants collapsed, although the upper portion remained asymptomatic. Thereafter, the lesions expanded rapidly over the entire plant. To isolate potential pathogens from infected leaves, small sections (5 to 10 mm2) were excised from the margins of lesions. Ten bacteria were isolated from ten symptomatic plants. Three representative isolates from different symptomatic plants were used for identification and pathogenicity tests. Isolated bacteria were gram negative, pectolytic on crystal violet pectate agar, nonfluorescent on King's medium B, and elicited a hypersensitive response in tobacco plants. All isolates caused soft rot of potato tubers. These isolates also differed from isolates of Erwinia chrysanthemi (Ech) that they were insensitive to erythromycin and did not produce phosphatase. These isolates differed from known strains of E. carotovora subsp. atroseptica in that they did not produce reducing substances from sucrose (2). Use of the Biolog GN microplate and the Release 4.0 system identified the isolate as Pectobacterium carotovorum subsp. carotovorum with 81.2% similarity. The 16S rRNA of the isolated bacteria was amplified by PCR and sequenced as described by Weisburg et al. (3). A BLAST analysis for sequence similarity of the 16S rRNA region revealed 99% similarity with nucleotide sequences for P. carotovorum subsp. carotovorum isolates (KC790305, KC790280, JF926758, JX196705, and AB680074). The pathogenicity of three bacterial isolates was examined on three 2-year-old O. japonica plants by adding 50 μl of a bacterial suspension containing 108 CFU/ml when wounding the leaves with sterile needles. Ten control plants were inoculated with sterilized water. After inoculation, plants were maintained in a growth chamber at 25°C with relative humidity ranging from 80 to 90%. After 2 to 3 days, tissue discoloration, water-soaked lesions, and soft rot developed around the inoculation point. Severe symptoms of soft rot and darkening developed on leaves of inoculated plants within 3 to 5 days after inoculation. All controls remained healthy during these experiments. The bacterial strains re-isolated from the parts of the leaf showing the symptoms and identified as P. carotovorum subsp. carotovorum on the basis of the biochemical and physiological tests, as well as Biolog system. The results obtained for pathogenicity, Biolog analysis, and molecular data corresponded with those for P. carotovorum subsp. carotovorum. To our knowledge, this is the first report of the presence of P. carotovorum on O. japonica in Korea. References: (1) C.-H. Kim et al. Kor. J. Med. Crop Sci. 11:31, 2003. (2) N. W. Schaad et al. Erwinia Soft Rot Group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al. eds. American Phytopathological Society, St. Paul. MN, 2001. (3) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Strawberry Crown Rot Caused by Xanthomonas fragariae in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Zhiwei Song ◽  
Chen Yang ◽  
Rong Zeng ◽  
Shi-gang Gao ◽  
Wei Cheng ◽  
...  
Keyword(s):  
16S Rrna ◽  
Crown Rot ◽  
Universal Primers ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Species Identity ◽  
Specific Primers ◽  
16S Rrna Sequence ◽  
First Report ◽  
Xanthomonas Fragariae

Strawberry (Fragaria × ananassa Duch.) is a kind of fruit with great economic importance and widely cultivated in the world. From 2019 to 2020, a serious crown rot disease was sporadically observed in several strawberry cultivars including ‘Zhang Ji’, ‘Hong Yan’ and ‘Yue Xiu’ in Shanghai, China. Initially, water-soaked rot appeared in inner tissue of strawberry crown, then progressed into browning and hollowing symptoms accompanied with yellow discolorations of young leaves. To isolate and identify the causal agent, small pieces of tissue taken from ten diseased crowns were sterilized by 70% alcohol. The cut-up pieces were macerated and serially diluted. The dilutions were placed on nutrient agar (NA) medium. After incubation at 25°C for 4-5 days, the yellow bacterial colonies were tiny and were streaked on NA plate for purification. The colonies were yellow, mucoid, smooth-margined, and five independent representative colonies were used for further confirmation. To confirm the species identity of the bacterial, genomic DNA was extracted from the five representative isolates, and 16S rRNA gene was amplified and sequenced using universal primers 27F/1492R. The 16S rRNA sequence was deposited in GenBank (MW725235) and showed 99% nucleotide similarity with Xanthomonas fragariae strain LMG 708 (NR_026318). The isolate’s identity was further confirmed by X. fragariae-specific primers XF9/XF12 (Roberts et al. 1996). All five isolates could be detected by XF9/XF12 primer. To confirm Koch’s postulates, five healthy strawberry plants were placed in 1000 ml glass beakers by submerging the cutting wound in 50 ml the bacterial suspension of 108 CFU/ml. Five additional strawberry plants treated with sterilized water served as a control. The beakers containing inoculated plants were sealed with plastic film at 25°C. Water-soaked rot appeared on internal tissue of crown similar to those observed in the field within 10-12 days after inoculation, while the control samples remained healthy. The bacteria were re-isolated from rot of inoculated crowns, and confirmed by X. fragariae-specific primers XF9/XF12. X. fragariae has been reported to cause angular leaf spot on strawberry in China (Wang et al. 2017; Wu et al., 2020). It’s also found that X. fragariae could systematically infect crown tissue (Milholland et al. 1996; Mahuku and Goodwin, 1997). To our knowledge, this is the first report of X. fragariae causing strawberry crown rot in China. This report increased our understanding of X. fragariae, and showed that the spread of this disease might seriously threaten the development of strawberry industry in the future

Sign in / Sign up

Export Citation Format

Share Document