First Report of Spencermartinsia viticola, Neofusicoccum australe, and N. parvum Causing Branch Canker of Citrus in California

Dothiorella gummosis and canker on citrus is generally viewed as a minor disease but can result in serious decline of trees. Symptoms, mostly found on branches, include grayish-to-brown cast on cankered bark, which can extend into the xylem. Dothiorella gummosis was earlier believed to be caused by Dothiorella gregaria (2). In a continuing survey on citrus in six California counties (Fresno, Riverside, San Diego, San Luis Obispo, Tulare, and Ventura) in 2010, branch cankers were collected. Small pieces of symptomatic tissues were plated onto potato dextrose agar amended with 0.01% tetracycline (PDA-tet) and incubated at 25°C for 4 days. Fungi most frequently isolated were initially identified as Botryosphaeriaceae based on morphological characters (1,3). Total genomic DNA was PCR amplified with primers Bt2a/2b for the β-tubulin (BT); EF1-728F/986R for the elongation factor α-1 (EF); and ITS4/5 for the internal transcribed spacer ITS1-5.8S-ITS2 regions (3). Sequences were compared in a BLAST search. Spencermartinsia viticola UCP105 was isolated from cv. Parent Washington on Sour Orange rootstock in Tulare County, Neofusicoccum australe UCR1110 from cv. Satsuma in Riverside County, and N. parvum UCR1166 from cv. Meyer Lemon on Volkameriana rootstock in Ventura County. Sequences of UCP105, UCR1110, and UCR1166 have been deposited in GenBank under Accession Nos. JF271766, JF271776, and JF271780 for BT; JF271784, JF271793, and JF271796 for EF; and JF271748, JF271758, and JF271762 for the ITS regions. The sequences matched with isolates in GenBank as follows: ITS region of strain UCP105—98% match with Accession Nos. AY905556–8; BT of strain UCR1110—99% with GU251879–80; and EF of strain UCR1166—98% with GU251238. Pathogenicity tests were conducted by inoculating green shoots of healthy citrus trees similar to cultivar/rootstock from which each isolate was obtained. Fresh wounds were made on 1-year-old citrus shoots with a 3-mm cork borer, and the freshly wounded surfaces were inoculated with 3-mm mycelial plugs from 5-day-old cultures on PDA-tet. Control shoots were inoculated with sterile agar plugs and each treatment had 10 replicates. Inoculated wounds and shoot ends were covered with petroleum jelly and wrapped with Parafilm to prevent desiccation. Shoots were incubated at 25°C in moist chambers for 4 weeks. Lesions were observed on all inoculated shoots except for the control. Mean lesion lengths were 6.4, 7.0, and 6.9 cm for UCP105, UCR1110, and UCR1166, respectively, which were significantly (P = 0.05) different from the control (0.8 cm). The three isolates were reisolated from symptomatic tissues of inoculated shoots to confirm their pathogenicity. This test was repeated and similar results were obtained. Results indicate that there are multiple species in the Botryosphaeriaceae family causing symptoms on citrus that were previously believed to be caused by D. gregaria. To our knowledge, this is the first report of S. viticola, N. australe, and N. parvum on citrus in California. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) V. McDonald et al. Plant Dis. 93:967, 2009. (3) B. Slippers et al. Mycologia 96:83, 2004.

Download Full-text

First Report of Diplodia seriata as Causal Agent of Olive Dieback in Croatia

Plant Disease ◽

10.1094/pdis-08-11-0628 ◽

2012 ◽

Vol 96 (2) ◽

pp. 290-290 ◽

Cited By ~ 12

Author(s):

J. Kaliterna ◽

T. Milicevic ◽

D. Ivic ◽

D. Bencic ◽

A. Mesic

Keyword(s):

Elongation Factor ◽

Its Region ◽

Morphological Characters ◽

Molecular Data ◽

Causal Agent ◽

Fruit Rot ◽

Morphological Identification ◽

Foeniculum Vulgare ◽

Diplodia Seriata ◽

First Report

In August 2010, a dieback of young olive (Olea europea L.) trees (cvs. Pendolino and Leccino) occurred in two orchards in Istria, Croatia. According to the producers, low temperatures during the winter severely damaged the plants and led to their decline. Distinctive symptoms, assumed fungal infection, were observed in internal tissue of stems and branches. Elongated brown necrosis, sometimes with black streaks, was visible under the bark, therefore Verticillium wilt was suspected. Of 1,086 trees in two orchards (4 ha), 165 (15%) showed symptoms. To isolate the causal agent, surface-sterilized wood chips of symptomatic tissue were placed on potato dextrose agar (PDA). Fungal colonies resembling Botryosphaeriaceae spp. grew from all wood fragments placed on PDA, and from these colonies, monohyphal isolates were obtained. For morphological identification, pycnidial formation was stimulated by growing the isolates on 2% water agar that included stems of plant species Foeniculum vulgare Mill. at room temperature under diffuse light. Pycnidia contained conidia that initially showed as hyaline, becoming light to dark brown as they matured, ovoid with truncated or rounded base and obtuse apex, aseptate, with wall moderately thick, externally smooth, roughened on the inner surface, and 22.8 to 23.5 × 9.6 to 10.5 μm. On the basis of these morphological characters, fungal species Diplodia seriata (teleomorph “Botryosphaeria” obtusa) was suspected (3). For molecular identification, four isolates (MN3, MN4, MN5, and MN6) were used for PCR to amplify the internal transcribed spacer (ITS) region and partial translation elongation factor 1-alpha (EF1-α) gene, using primers ITS4/ITS5 and EF1-728F/EF1-986R, respectively. Sequencing was performed with those amplified genes, then sequences were deposited in GenBank. Comparison of these sequences with GenBank sequences for referent D. seriata isolate CBS 112555 (AY259094 and AY573220) (3) showed 100% homology. On the basis of molecular data, the isolates were confirmed to be species D. seriata De Not. Pathogenicity tests were performed by inoculation of 2-year-old olive plants, six plants per tested cultivar (Pendolino and Leccino). For every cultivar, four plants were wounded and mycelium plugs from D. seriata cultures on PDA were placed on the wounds and sealed with Parafilm. Two control plants per tested cultivar were inoculated with sterile PDA plugs. After 2 months, six of eight inoculated plants wilted completely, and under the bark, brown necrosis was observed. D. seriata was constantly reisolated from the inoculated plants and fulfilled Koch's postulates and confirmed pathogenicity of D. seriata on olive as causal agent of olive dieback. Control plants showed no symptoms of the disease. This fungus has been recognized as the cause of fruit rot of olive (1) and branch canker or dieback in Spain (2). To our knowledge, this is the first report of D. seriata as a pathogen of olive in Croatia. Also, this is one of the first reports of D. seriata as the cause of olive dieback in the world, while Moral et al. (1,2) mostly reported it as the cause of olive fruit rot. Since the same symptoms of olive dieback were observed at other localities in Croatia, the disease could represent a serious threat, particularly for young olive orchards. References: (1) J. Moral et al. Plant Dis. 92:311, 2008. (2) J. Moral et al. Phytopathology 100:1340, 2010. (3) A. J. L. Phillips et al. Fungal Divers. 25:141, 2007.

Download Full-text

First Report of Fruit Rot of Melon Caused by Fusarium asiaticum in China

Plant Disease ◽

10.1094/pdis-08-20-1857-pdn ◽

2020 ◽

Author(s):

Fangmin Hao ◽

Quanyu Zang ◽

Weihong Ding ◽

Erlei Ma ◽

Yunping Huang ◽

...

Keyword(s):

Disease Incidence ◽

Elongation Factor ◽

Morphological Characteristics ◽

Its Region ◽

Fruit Rot ◽

Post Inoculation ◽

Basal Cells ◽

First Report ◽

Fusarium Asiaticum ◽

Sterile Needle

Melon (Cucumis melo L.) is a member of the Cucurbitaceae family, an important economical and horticultural crop, which is widely grown in China. In May 2020, fruit rot disease with water-soaked lesions and pink molds on cantaloupe melons was observed in several greenhouses with 50% disease incidence in Ningbo, Zhejiang Province in China. In order to know the causal agent, diseased fruits were cut into pieces, surface sterilized for 1 min with 1% sodium hypochlorite (NaClO), 2 min with 75% ethyl alcohol, rinsed in sterile distilled water three times (Zhou et al. 2018), and then placed on potato dextrose agar (PDA) medium amended with streptomycin sulfate (100 μg/ml) plates at 25°C for 4 days. The growing hyphae were transferred to new PDA plates using the hyphal tip method, putative Fusarium colonies were purified by single-sporing. Twenty-five fungal isolates were obtained and formed red colonies with white aerial mycelia at 25°C for 7 days, which were identified as Fusarium isolates based on the morphological characteristics and microscopic examination. The average radial mycelial growth rate of Fusarium isolate Fa-25 was 11.44 mm/day at 25°C in the dark on PDA. Macroconidia were stout with curved apical and basal cells, usually with 4 to 6 septa, and 29.5 to 44.2 × 3.7 to 5.2 μm on Spezieller Nährstoffarmer agar (SNA) medium at 25°C for 10 days (Leslie and Summerell 2006). To identify the species, the internal transcribed spacer (ITS) region and translational elongation factor 1-alpha (TEF1-α) gene of the isolates were amplified and cloned. ITS and TEF1-α was amplified using primers ITS1/ITS4 and EF1/EF2 (O’Donnell et al. 1998), respectively. Sequences of ITS (545 bp, GenBank Accession No. MT811812) and TEF1-α (707 bp, GenBank Acc. No. MT856659) for isolate Fa-25 were 100% and 99.72% identical to those of F. asiaticum strains MSBL-4 (ITS, GenBank Acc. MT322117.1) and Daya350-3 (TEF1-α, GenBank Acc. KT380124.1) in GenBank, respectively. A phylogenetic tree was established based on the TEF1-α sequences of Fa-25 and other Fusarium spp., and Fa-25 was clustered with F. asiaticum. Thus, both morphological and molecular characterizations supported the isolate as F. asiaticum. To confirm the pathogenicity, mycelium agar plugs (6 mm in diameter) removed from the colony margin of a 2-day-old culture of strain Fa-25 were used to inoculate melon fruits. Before inoculation, healthy melon fruits were selected, soaked in 2% NaClO solution for 2 min, and washed in sterile water. After wounding the melon fruits with a sterile needle, the fruits were inoculated by placing mycelium agar plugs on the wounds, and mock inoculation with mycelium-free PDA plugs was used as control. Five fruits were used in each treatment. The inoculated and mock-inoculated fruits were incubated at 25°C with high relative humidity. Symptoms were observed on all inoculated melon fruits 10 days post inoculation, which were similar to those naturally infected fruits, whereas the mock-inoculated fruits remained symptomless. The fungus re-isolated from the diseased fruits resembled colony morphology of the original isolate. The experiment was conducted three times and produced the same results. To our knowledge, this is the first report of fruit rot of melon caused by F. asiaticum in China.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Euphorbia larica Dieback Caused by Fusarium brachygibbosum in Oman

Plant Disease ◽

10.1094/pdis-09-12-0828-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 687-687 ◽

Cited By ~ 9

Author(s):

I. H. Al-Mahmooli ◽

Y. S. Al-Bahri ◽

A. M. Al-Sadi ◽

M. L. Deadman

Keyword(s):

Elongation Factor ◽

Aerial Mycelium ◽

Its Region ◽

Common Component ◽

First Report ◽

Ethnobotanical Uses ◽

Artificial Inoculations ◽

Stem Lesions ◽

Desert Flora

Euphorbia larica Boiss. (Arabic = Isbaq) is a dominant and common component of the native desert flora of northern Oman. Traditional ethnobotanical uses have included use of the latex for treating camels with parasites. In February 2011, E. larica plants showing stem lesions up to several cm long and in many cases with stem dieback were collected from Al-Khoudh 50 km west of Muscat. The disease appeared widespread within the location where several dead specimens were also recorded, although the cause was unclear. Sections (5 mm) of five diseased branches taken from different plants and placed on potato dextrose agar (PDA) in all cases yielded Fusarium-like colonies. Colonies recovered were initially white becoming rose to medium red in color with abundant aerial mycelium. Macroconidia were scarce and scattered (mean of 20 spores: 26.83 × 4.73 μm) with three to four septa per spore; microconidia were slightly curved, ovoid, and fusiform (mean of 20 spores: 11.64 × 4.03 μm) with zero to two septa per spore. Spherical chlamydospores (mean of 20 spores: 11.05 μm) were terminal and intercalary, single, and in chains. In vitro characters and spores measurements conformed to previously described features of Fusarium brachygibbosum Padwick (1). Mycelial plugs (5 mm) were taken from 7-day-old cultures of the fungus grown on 2.5% PDA and applied to a small incision (3 mm) on the stems of healthy E. larica grown in situ and protected with wet cotton and Parafilm. The residual agar, mycelium, cotton, and Parafilm were removed after 7 days and symptoms were recorded. Control stems were inoculated using PDA (5 mm) plugs alone and inoculations were repeated twice. Artificial inoculations resulted in dieback of all stems within 11 days and fungal colonies identical to initial isolations were recovered from artificially infected surface-sterilized stem pieces. Identification of F. brachygibbosum was confirmed by comparing sequences generated from the internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1 and ITS4 primers) and the intron region of translation elongation factor alpha (EF1-α) (EF-1-986 and EF-728 primers). The ITS and EF1-α sequences were found to share 100% and 99% nucleotide similarity to previously published sequences of the ITS (HQ443206) and EF1-α (JQ429370) regions of F. brachygibbosum in GenBank. The accession number of ITS sequence of one isolate assigned to EMBL-Bank was HF562936. The EF sequence was assigned to EMBL-Bank accession (submission number Hx2000027017; number will be sent later). This pathogen has previously been reported on date palm (2) in Oman but, to our knowledge, this is the first report of this pathogen on E. larica. References: (1) A. M. Al-Sadi et al. Crop Prot. 37:1, 2012. (2) G. W. Padwick. Mycol. Pap. 12:11, 1945.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First report of Nigrospora sphaerica causing fruit dried-shrink disease in Akebia trifoliata from China

Plant Disease ◽

10.1094/pdis-11-20-2471-pdn ◽

2021 ◽

Author(s):

Xiujing Hong ◽

Shijia Chen ◽

linchao Wang ◽

Bo Liu ◽

Yuruo Yang ◽

...

Keyword(s):

Elongation Factor ◽

Morphological Characteristics ◽

Its Region ◽

Average Diameter ◽

Ethanol Solution ◽

Likelihood Method ◽

Conidial Suspension ◽

Multiple Sequence ◽

First Report ◽

Pure Cultures

Akebia trifoliata, a recently domesticated horticultural crop, produces delicious fruits containing multiple nutritional metabolites and has been widely used as medicinal herb in China. In June 2020, symptoms of dried-shrink disease were first observed on fruits of A. trifoliata grown in Zhangjiajie, China (110.2°E, 29.4°N) with an incidence about 10%. The infected fruits were shrunken, colored in dark brown, and withered to death (Figure S1A, B). The symptomatic fruits tissues (6 × 6 mm) were excised from three individual plants, surface-disinfested in 1% NaOCl for 30s and 70% ethanol solution for 45s, washed, dried, and plated on potato dextrose agar (PDA) containing 50 mg/L streptomycin sulfate in the dark, and incubated at 25℃ for 3 days. Subsequently, hyphal tips were transferred to PDA to obtain pure cultures. After 7 days, five pure cultures were obtained, including two identical to previously reported Colletotrichum gloeosporioides causing leaf anthracnose in A. trifoliata (Pan et al. 2020) and three unknown isolates (ZJJ-C1-1, ZJJ-C1-2, and ZJJ-C1-3). The mycelia of ZJJ-C1-1, ZJJ-C1-2 and ZJJ-C1-3 were white, and formed colonies of approximate 70 mm (diameter) in size at 25℃ after 7 days on potato sucrose agar (PSA) plates (Figure S1C). After 25 days, conidia were formed, solitary, globose, black, shiny, smooth, and 16-21 μm in size (average diameter = 18.22 ± 1.00 μm, n = 20) (Figure S1D). These morphological characteristics were similar to those of N. sphaerica previously reported (Li et al. 2018). To identify species of ZJJ-C1-1, ZJJ-C1-2 and ZJJ-C1-3, the internal transcribed spacer (ITS) region, β-tubulin (TUB2), and the translation elongation factor 1-alpha (TEF1-α) were amplified using primer pairs including ITS1/ITS4 (Vilgalys and Hester 1990), Bt-2a/Bt-2b (Glass and Donaldson 1995), and EF1-728F/EF-2 (Zhou et al. 2015), respectively. Multiple sequence analyses showed no nucleotide difference was detected among genes tested except ITS that placed three isolates into two groups (Figure S2). BLAST analyses determined that ZJJ-C1-1, ZJJ-C1-2 and ZJJ-C1-3 had 99.73% to N. sphaerica strains LC2705 (KY019479), 100% to LC7294 (KY019397), and 99.79-100% to LC7294 (KX985932) or LC7294 (KX985932) based on sequences of TUB2 (MW252168, MW269660, MW269661), TEF-1α (MW252169, MW269662, MW269663), and ITS (MW250235, MW250236, MW192897), respectively. These indicated three isolates belong to the same species of N. sphaerica. Based on a combined dataset of ITS, TUB2 and TEF-1α sequences, a phylogenetic tree was constructed using Maximum likelihood method through IQ-TREE (Minh et al. 2020) and confirmed that three isolates were N. sphaerica (Figure S2). Further, pathogenicity tests were performed. Briefly, healthy unwounded fruits were surface-disinfected in 0.1% NaOCl for 30s, washed, dried and needling-wounded. Then, three fruits were inoculated with 10 μl of conidial suspension (1 × 106 conidia/ml) derived from three individual isolates, with another three fruits sprayed with 10 μl sterilized water as control. The treated fruits were incubated at 25℃ in 90% humidity. After 15 days, all the three fruits inoculated with conidia displayed typical dried-shrink symptoms as those observed in the farm field (Figure S1E). The decayed tissues with mycelium and spores could be observed on the skin or vertical split of the infected fruits after 15 days’ inoculation (Figure S1F-H). Comparably, in the three control fruits, there were no dried-shrink-related symptoms displayed. The experiment was repeated twice. The re-isolated pathogens were identical to N. sphaerica determined by sequencing the ITS, TUB2 and TEF-1α. Previous reports showed N. sphaerica could cause postharvest rot disease in kiwifruits (Li et al. 2018). To our knowledge, this is the first report of N. sphaerica causing fruits dried-shrink disease in A. trifoliata in China.

Download Full-text

First Report of Wilt on Alfalfa in China Caused by Verticillium nigrescens

Plant Disease ◽

10.1094/pdis-07-11-0580 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1591-1591 ◽

Cited By ~ 3

Author(s):

X. P. Hu ◽

M. X. Wang ◽

D. F. Hu ◽

J. R. Yang

Keyword(s):

Vascular Tissue ◽

Its Region ◽

Morphological Characters ◽

Deionized Water ◽

Nuclear Ribosomal Dna ◽

Cow Dung ◽

Its Sequence ◽

Its Sequencing ◽

First Report

Alfalfa (Medicago sativa Linn.), widely grown throughout the world, is an important perennial forage crop. It is high in protein and digestible fiber and is an excellent source of several vitamins (A, D, E, and K) and minerals for beef cattle, horses, sheep, goats, and even humans (2). Wilt symptoms on alfalfa were observed during a disease survey in Yangling, Shaanxi, China in 2009. Symptoms included discoloration, shortened internode, and plant death. However, the vascular tissue of diseased alfalfa plants did not exhibit discoloration and typical “V” symptoms of Verticillium albo-atrum infection. Eleven fungal isolates were obtained from diseased alfalfa plants in Yangling by a tissue isolation method (1). Isolates were cultured on Czapek Dox Agar (CDA; pH 7.2) slants at 22 ± 1°C in darkness. Colonies on CDA plates were whitish and cream-white when viewed from the underside, later becoming dark gray due to the formation of gray or dark brown chlamydospores in single or in short chains. DNA was extracted from each isolate and the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA (rDNA) was amplified and sequenced using primers ITS-1F and ITS4. The 11 isolates were divided into five groups based on their in vitro morphological characters. A single isolate from each of the five groups was chosen for ITS sequencing. All five isolates had the same ITS sequence (GenBank Accession No. AB551216). On the basis of the ITS sequence and morphology (4), these isolates were identified as V. nigrescens Pethyhr. (recently renamed as Gibellulopsis nigrescens). Five representative isolates were used to fulfill Koch's postulates. Alfalfa seeds (cv. Cossack) were surface sterilized with 75% ethanol for 5 min, allowed to dry, and planted into cow dung compost that had been autoclaved at 160°C for 2 h. Plants were cultivated under controlled greenhouse conditions at 23 to 25°C with a photoperiod of 14 h. Inoculum was prepared by comminuting 15-day-old cultures and sterile deionized water into a suspension of mycelial fragments and conidia (105 to 106 CFU/ml) in a blender. Seedlings (four-leaf stage) were inoculated by immersing roots in the inoculum suspension for 60 min (3). Each isolate was inoculated onto 30 seedlings, six in each pot; another 30 seedlings were soaked with sterile deionized water for 60 min as a control. After 20 days in the greenhouse, all inoculated plants exhibited wilt symptoms similar to the original wilt symptoms observed on diseased alfalfa plants. In contrast, none of the control plants showed wilt symptoms. The pathogen was reisolated from all diseased plants and confirmed to the original ones. To our knowledge, this is the first report of V. nigrescens infecting M. sativa in China, indicating V. nigrescens as one possible important pathogen of alfalfa. References: (1) O. D. Dhingra and J. B. Sinclair. Basic Plant Pathology Methods. CRC Press, Boca Raton, FL, 1995. (2) D. Jasjeet et al. J. Adv. Sci. Res. 2:50, 2011. (3) H. A. Melouk and C. E. Horner. Phytopathology 64:1267, 1974. (4) R. Zare et al. Nova Hedwigia 85:463, 2007.

Download Full-text

First Report of Lasiodiplodia theobromae Associated with Decline of Grapevine Rootstock Mother Plants in Spain

Plant Disease ◽

10.1094/pdis-92-5-0832b ◽

2008 ◽

Vol 92 (5) ◽

pp. 832-832 ◽

Cited By ~ 13

Author(s):

A. Aroca ◽

R. Raposo ◽

D. Gramaje ◽

J. Armengol ◽

S. Martos ◽

...

Keyword(s):

Elongation Factor ◽

Aerial Mycelium ◽

Its Region ◽

Pathogenic Fungi ◽

Vascular Lesions ◽

Malt Extract ◽

Pathogenicity Test ◽

Lasiodiplodia Theobromae ◽

First Report ◽

Mother Plants

A field of Richter 110 rootstock mother plants in Valencia Province (eastern Spain) was surveyed during November 2006 to study the mycoflora of declining plants. Two canes with stunted leaves were collected from a plant with a reduced number of shoots. No cankers or vascular lesions were observed in the collected canes. Six wood chips (1 to 2 mm thick) were taken from one basal fragment (3 to 4 cm long) of each cane, surface sterilized in 70% ethanol for 1 min, and plated on malt extract agar supplemented with 0.5 g L–1 of streptomycin sulfate. Petri dishes were incubated for 7 days at 25°C. A fungus was consistently isolated from all samples that showed the following characteristics: colonies grown on potato dextrose agar (PDA) at 25°C developed a white, aerial mycelium that turned gray after 4 to 6 days and produced pycnidia after 1 month on sterile grapevine slivers of twigs placed on the PDA surface; conidia from culture were ellipsoidal, thick walled, initially hyaline, nonseptate, and measuring 20 to 25 (22.5) × 12 to 14 (13) μm; aged conidia were brown, 1-septate with longitudinal striations in the wall; and pseudoparaphyses variable in form and length were interspersed within the fertile tissue. The fungus was identified as Lasiodiplodia theobromae (Pat.) Griffon & Maubl. from the above characteristics (2). Identity was confirmed by analysis of the nucleotide sequences of the internal transcribed spacer (ITS) region from the rRNA repeat and part of the translation elongation factor 1-alpha (EF1-α) and the β-tubulin (B-tub) genes, as done elsewhere (1,3). BLAST searches at GenBank showed a high identity with reference sequences (ITS: 100%, EF1-α: 97%; B-tub: 99%). Representative sequences of the studied DNA regions were deposited at GenBank (Accession Nos.: ITS: EU254718; EF1-α: EU254719; and B-tub: EU254720). A pathogenicity test was conducted on 1-year-old grapevine plants cv. Macabeo grafted onto Richter 110 rootstocks maintained in a greenhouse. A superficial wound was made on the bark of 10 plants with a sterilized scalpel, ≈10 cm above the graft union. A mycelial plug obtained from the margin of an actively growing fungal colony (isolate JL664) was placed in the wound and the wound was wrapped with Parafilm. Ten additional control plants were inoculated with sterile PDA plugs. All control plants grew normally, and the inoculation wound healed 3 months after inoculation. Plants inoculated with L. theobromae showed no foliar symptoms in the same period, but developed cankers variable in size surrounding the inoculation sites. Vascular necroses measuring 8.4 ± 1.5 cm (mean ± standard error) developed in the inoculated plants that were significantly longer than the controls (0.3 ± 0.2 cm). The pathogen was reisolated from all inoculated plants and no fungus was reisolated from the controls. These results confirmed the pathogenicity of L. theobromae to grapevine and points to a possible involvement of L. theobromae in the aetiology of grapevine decline as previously reported (3,4). To our knowledge, this is the first report of L. theobromae isolated from grapevine in Spain. References: (1) J. Luque et al. Mycologia 97:1111, 2005. (2) E. Punithalingam. No. 519 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1976. (3) J. R. Úrbez-Torres et al. Plant Dis. 90:1490, 2006. (4) J. M. van Niekerk et al. Phytopathol. Mediterr. 45(suppl.):S43, 2006.

Download Full-text

First Report of Diaporthe amygdali Associated with Twig Canker and Shoot Blight of Nectarine in Spain

Plant Disease ◽

10.1094/pdis-10-20-2283-pdn ◽

2021 ◽

Author(s):

Francisco Beluzán ◽

Diego Olmo ◽

Maela León ◽

Paloma Abad-Campos ◽

Josep Armengol

Keyword(s):

Prunus Persica ◽

Tap Water ◽

Elongation Factor ◽

Its Region ◽

Sodium Hypochlorite Solution ◽

First Report ◽

Potted Plants ◽

Randomized Design ◽

Shoot Blight ◽

One Year

Nectarine (Prunus persica (L.) Batsch var. nucipersica (Suckow) C. K. Schneid.) is a fruit crop widely cultivated throughout the Mediterranean basin. In Spain, it is mainly grown in eastern regions of the country. In March 2018, 5-year-old nectarine trees showing twig canker symptoms were observed after a rainy spring period in a 0.5 ha orchard located at Alaior, Menorca island (Spain). Cankers were frequent on affected trees (approximately, 80% of the total trees), thus leading to shoot blight. Ten twig segments of one-year old wood with cankers were cut, washed under running tap water, surface disinfected for 1 min in a 1.5% sodium hypochlorite solution and rinsed twice in sterile distilled water. Small pieces (2 mm) of affected tissues were taken from the margin of the cankers and plated on potato dextrose agar (PDA) supplemented with 0.5 g/L of streptomycin sulphate (PDAS). The plates were then incubated at 25 ºC in the dark for 7 to 10 d. Actively growing colonies were first hyphal-tipped and then transferred to PDA and 2% water agar supplemented with sterile pine needles and incubated at 21-22ºC under a 12h/12h near UV / darkness cycle during 21 d (León et al. 2020). Colonies were white at first, becoming light cream, with visible solitary and aggregate pycnidia at maturity. Alpha conidia were aseptate, fusiform, hyaline, multi-guttulated (mean ± SD = 7.4 ± 0.7 × 2.8 ± 0.4 µm, n = 100). Beta and gamma conidia were not observed. The morphological and cultural characteristics of the isolates were congruent with those of Diaporthe spp. (Gomes et al. 2013). The ITS1-5.8S-ITS2 (ITS) region and fragments of β-tubulin (tub2), the translation elongation factor 1-alpha (tef1-α) gene regions, histone H3 (his3) and calmodulin (cal) genes of representative isolate DAL-59 were amplified and sequenced (Santos et al. 2017). The BLASTn analysis revealed 100% similarity with sequences of D. mediterranea (Synonym D. amygdali) (Hilário et al. 2021) isolate DAL-34 from almond (ITS: MT007489, tub2: MT006686, tef1-α: MT006989, his3: MT007095 and cal: MT006761). Sequences of isolate DAL-59 were deposited in GenBank Database (ITS: MT007491, tub2: MT006688, tef1-α: MT006991, his3: MT007097 and cal: MT006763). Pathogenicity tests were conducted using one-year-old potted plants of nectarine cv. Boreal, which were inoculated with isolate DAL-59. In each plant, a 3 mm wound was made in the center of the main branch (about 30 cm length) with a scalpel. Colonized agar plugs with 3 mm diameter, which were obtained from active 10-day-old colonies growing on PDA, were inserted underneath the epidermis and the wounds sealed with Parafilm. Inoculated plants were incubated in a growth chamber at 23 ºC with 12 h of light per day. Controls were inoculated with uncolonized PDA plugs. There were twelve plants per treatment, which were arranged in a completely randomized design. Five days after inoculation necrosis development was observed in the area of inoculation. Wilting and twig blight symptoms over the lesion occurred 3-wk after inoculation and pycnidia were detected, while the controls remained asymptomatic. Diaporthe amygdali was re-isolated from symptomatic tissues and identified as described above to satisfy Koch’s postulates. To our knowledge, this is the first report of D. amygdali causing twig canker and shoot blight disease on nectarine in Spain.

Download Full-text

First Report of Neofusicoccum mangiferae Causing Rachis Necrosis and Inflorescence Blight of Mango (Mangifera indica) in Puerto Rico

Plant Disease ◽

10.1094/pdis-08-13-0878-pdn ◽

2014 ◽

Vol 98 (4) ◽

pp. 570-570 ◽

Cited By ~ 2

Author(s):

L. M. Serrato-Diaz ◽

L. I. Rivera-Vargas ◽

R. D. French-Monar

Keyword(s):

Puerto Rico ◽

Mycelial Growth ◽

Mangifera Indica ◽

Elongation Factor ◽

Germplasm Collection ◽

Its Region ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Reference Isolate ◽

Β Tubulin

Inflorescence blight is a major disease in mango production (2,3). During a disease survey of mango in Puerto Rico conducted from February to April in 2009, 20% of the inflorescences were affected with inflorescence blight showing rachis and flower necrosis. Symptoms were observed in 70% of samples at the Mango Germplasm Collection of the University of Puerto Rico's Experiment Station in Juana Diaz. Blighted inflorescence tissue (necrotic and the interface between necrotic and healthy tissue) from mango cultivars ‘Haden’ and ‘Irwin’ were disinfested with 70% ethanol, rinsed with sterile water and transferred to acidified potato dextrose agar (APDA). Isolations (40%) produced fungi in the Botryosphaeriaceae. Isolates 90LY, 94LY, and 89LY were purified and identified morphologically using taxonomic keys (1,4) and by DNA sequence analyses as Neofusicoccum mangiferae (Syd. & P. Syd.) Crous, Slippers & A.J.L. Phillips. On APDA, colonies were gray with aerial mycelia that turned dark gray with age. Pycnidia were globose to pyriform and dark brown to black. Conidia (n = 50) were hyaline, ovoid, one-celled, and averaged 13.2 × 6.3 μm in size. PCR amplifications of the internal transcribed spacer region of rDNA using ITS5-ITS4 primers, and fragments of both β-tubulin and translation elongation factor 1-alpha (EF1-α) genes using Bt2a-Bt2b and EF1728F-EF1986R primers, respectively, were sequenced and analyzed using BLASTn query. Accession numbers of gene sequences submitted to GenBank were KF479465 to 67 for ITS region; KF479468 to 70 for β-tubulin; and KF479471 to 73 for EF1-α. All sequences were 99 to 100% identical to reference isolate CMW7024 (4) of N. mangiferae (GenBank Accession Nos. AY615185, AY615172, and DQ093221). For each fungal isolate, pathogenicity tests were conducted on mango trees using six randomly selected, healthy mango inflorescences at full bloom using two trees per cultivar. Both needle-wounded and unwounded inflorescences were inoculated with 5-mm diameter mycelial disks from 8-day-old cultures grown on APDA. Inflorescences were incubated in clear plastic bags for 8 days under field conditions. Controls were treated with APDA disks only. Inflorescences on ‘Irwin’ turned brown with necrosis extending from the rachis to flowers. Mycelial growth and inflorescence blight was observed with lesions ranging from 2 to 5 cm in length. On ‘Haden,’ the rachis tissues turned brown and necrotic with lesions ranging from 1.5 to 2 cm long and without mycelial growth. N. mangiferae was re-isolated from all diseased inflorescences, and no symptoms developed on controls, which fulfilled Koch's postulates. The test was repeated once. N. mangiferae was associated with blossom blight in Australia and South Africa (2,3). This is the first report of N. mangiferae causing rachis necrosis and inflorescence blight on mango in Puerto Rico. N. mangiferae belongs to a complex of pathogens causing inflorescence blight and rachis necrosis and, therefore, effective management of this important disease complex must involve control of this pathogen. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) G. I. Johnson et al. Ann. Appl. Biol. 119:465, 1991. (3) J. H. Lonsdale and J. M. Kotzé. Acta Hortic. 341:345, 1993. (4) A. J. L. Phillips. Key to the various lineages in “Botryosphaeria” Version 01 2007. Last retrieved 5 February 2014 from http://www.crem.fct.unl.pt/botryosphaeria_site/key.htm .

Download Full-text