First Report of Shallot virus X in Onion in Sudan

Onion (Alium cepa L.) is among the most important vegetable field crops in Sudan. During a disease survey in crops (cvs. Kamleen Yellow and Abu-freua) conducted in 2010, samples showing mild mottling symptoms were collected from Shambat Research Station Farm, Khartoum North, Sudan. A CF-11 cellulose chromatography dsRNA preparation (4) of a mixed onion leaf sample of five plants (20 g) resulted, apart from smaller dsRNAs up to 3 kbp, in a high molecular weight dsRNA of approximately 9 kbp. This dsRNA was used as a template for a random reverse transcriptase (RT)-PCR followed by cloning (4) and sequencing of two randomly selected clones by the ABI BigDye Terminator v3.1 Cycle Sequencing Kit. Comparison with sequences available at GenBank revealed high identities to Shallot virus X (ShVX). ShVX is the type member of the genus Allexivirus (Alphaflexiviridae). One sequence obtained showed 84% nt and 98% aa sequence identity (genome position 414 to 1,285 of Accession No. M97264) to the replicase, whereas the other sequence partially covered the ORF4 and coat protein (CP) coding region (7,127 to 7,998). This sequence showed 80% nt (entire sequence) and 80/89% aa sequence identity to the ORF4 encoded protein/coat protein of a Russian ShVX isolate, respectively. ShVX was first reported in shallot in Russia (2) and subsequently in the Netherlands, Germany, India (3), and New Zealand (1). To confirm the presence of ShVX in Sudan, 32 symptomatic leaf samples were collected in 2011 from different onion fields in Khartoum North, with a similar disease incidence compared to 2010. Thirty-one of these onion samples reacted positively in a double antibody sandwich-ELISA with a ShVX-specific antiserum (DSMZ AS-1042). Total RNA was extracted from five ShVX-ELISA positive onion samples using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Two primer pairs were also designed on the basis of sequences obtained in the random RT-PCR approach, targeting a 659-bp fragment of the coat protein region (ShVX-CPs 5′GTTGAATGTGGCGAGCGCAA3′ and ShVX-CPas 5′AGTGCAGAAGCCTTCCACA3′) or a 686-bp fragment of the replicase (ShVX-Rs 5′ATGTACTTCGGTACGGCATCA3′ and ShVX-R-as 5′TAATCGAATGAGGTCGGCCA3′). Fragments of the expected sizes were obtained for all positive samples. One RT-PCR product of each primer pair was directly sequenced, showing high sequence identities to those previously obtained (>98%). The random RT-PCR sequences obtained in this study were submitted to GenBank (JQ751056 and JQ751057). On the basis of the nucleotide sequences obtained with the dsRNA template, ShVX specific RT-PCR, and ELISA, the presence of ShVX in Sudan was confirmed in two consecutive years. To our knowledge, this is the first report of ShVX in Sudan and Africa, indicating this virus is more widespread than previously reported. The presence of ShVX also suggests the presence of its only known vector, the mite Aceria tulipae. The virus may have been introduced to Sudan by infected onion sets. Even if the impact of ShVX on onion production has not been determined, its identification and the availability of a diagnostic antiserum may be helpful to select virus-free propagation material in order to achieve sustainable onion production in Sudan. References: (1) Z. Egusquiza et al. New Disease Reports 18:29, 2008. (2) K. V. Kanyuka et al. J. Gen. Virol. 73:2553, 1992. (3) S. Majumder et al. New Disease Reports 15:52, 2007. (4) W. Menzel et al. Arch. Virol. 154:1343, 2009.

Download Full-text

First Report of Cucurbit yellow stunting disorder virus on Melon in China

Plant Disease ◽

10.1094/pdis-94-4-0485a ◽

2010 ◽

Vol 94 (4) ◽

pp. 485-485 ◽

Cited By ~ 6

Author(s):

L. Z. Liu ◽

Y. Y. Chen ◽

W. M. Zhu

Keyword(s):

Coat Protein ◽

Coat Protein Gene ◽

Fragment Length ◽

Protein Gene ◽

Disease Incidence ◽

Rt Pcr ◽

First Report ◽

Genes Encoding ◽

Pcr Products ◽

Symptomatic Leaf

Melon (Cucumis melo L.) plants in commercial fields in Shanghai, Jiangsu, and Zhejiang exhibited stunting, deformation, interveinal chlorosis, and leaf mottling in the spring of 2008. In addition, adult and immature whiteflies (Bemisia tabaci biotype B) were present in these melon fields. Thirty-two symptomatic leaf samples were collected from these fields for further analysis (9 from Nanhui County in Shanghai, 11 from Fengxian County in Shanghai, 6 from Kunshan County of Jiangsu, and 6 from Jiashan County of Zhejiang). Total RNA was extracted from these samples along with asymptomatic control plants and screened for the presence of Cucurbit yellow stunting disorder virus (CYSDV) by using primers specific to genes encoding coat protein (2) and HSP70h (1) of CYSDV through reverse transcription (RT)-PCR methods. RNA was successfully extracted from 31 of 32 symptomatic samples. All 31 symptomatic leaf samples tested with coat protein primers were positive for CYSDV and yielded the expected fragment length of 394 bp. The RT-PCR products of the coat protein gene from all 31 isolates were cloned and found to be identical in sequence. Thus, only one was deposited in GenBank (No. GU189240). The submitted sequence of the amplified part of the coat protein gene was 99% identical to the sequence of coat protein gene of CYSDV from Jordan, France, and Florida (GenBank Accession Nos. DQ903107, AY204220, and EU596528, respectively) and 98% identical to that of an isolate from Spain (GenBank Accession No. AJ243000). Similarly, all 31 samples were also positive for CYSDV with the primers specific to HSP70h and yielded the expected fragment length of 175 bp. The RT-PCR products of the HSP70h gene from these isolates were also cloned and found to be identical in sequence. The sequence of the amplified portion of the HSP70h gene was found to be identical to the sequence of HSP70h of CYSDV deposited in GenBank (No. AJ439690.2). CYSDV was noticed in all three surveyed regions and the percentage of disease incidence was approximately 68% in all these regions. The occurrence of CYSDV has been previously reported in Europe (Spain and France), southern Asia (Iran and Jordan), North America (United States and Mexico), and other countries (1). To our knowledge, this is first report of CYSDV in China. References: (1) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (2) J. E. Polston et al. Plant Dis. 92:1251, 2008.

Download Full-text

First Report of Garlic virus B infecting Garlic in India

Plant Disease ◽

10.1094/pdis-01-20-0156-pdn ◽

2020 ◽

Author(s):

Praveen Baliram Roylawar ◽

Kiran S Khandagale ◽

Pragati Randive ◽

Gorakshnath E. Atre ◽

Suresh Janardhan Gawande ◽

...

Keyword(s):

Consensus Sequence ◽

Sandwich Elisa ◽

Rna Extraction ◽

Enzyme Linked Immunosorbent Assay ◽

Experimental Plot ◽

Rt Pcr ◽

First Report ◽

The Impact ◽

Garlic Virus ◽

Germplasm Accessions

Garlic (Allium sativum L.) is an economically important spice and vegetable crop grown throughout the world. Garlic viral disease complex caused by multiple virus infections is an important constraint in exploiting the potential yield of garlic. Among these viral pathogens, allexivirus (family Alphaflexiviridae) is the genus of viruses known for their degenerative effect on garlic yield. Their coexistence with other viruses, particularly potyviruses, has an adverse effect on garlic yield and quality (Perotto et al. 2010). During Sept 2018, while screening garlic germplasm accessions for the presence of allexiviruses, symptoms like foliar mosaic and curling were observed on accession G-204, planted at an experimental plot of ICAR-DOGR, Pune, India. A total of five samples comprised of five randomly selected G-204 garlic plants were collected from the experimental plot. Each sample contained leaves from the top, middle, and bottom portion of the individual garlic plants. These samples were subjected to RNA extraction using the RNeasy Plant Mini Kit (Qiagen, Germany) followed by reverse transcription (RT) using the Transcriptor cDNA synthesis kit (Roche Diagnostics, GmbH, Germany). The extracted RNA was then tested for allexiviruses such as garlic virus A (GarV-A), garlic virus B (GarV-B), garlic virus C (GarV-C), garlic virus D (GarV-D), and garlic virus X (GarV-X) by polymerase chain reaction (PCR) (Gawande et al. 2015; Roylawar et al. 2019; Baranwal et al. 2011; Gieck et al. 2009). Leaf samples tested through RT-PCR were found positive for garlic viruses GarV-A, GarV-B, GarV-C, GarV-D, and GarV-X. Allexiviruses other than GarV-B had been previously reported in India and hence further tests were conducted to confirm GarV-B infection. RT-PCR using primers, CF 5’- ATGGGAGACAGGTCGCAA-3’ and CR5’- CTAAAATGTAAGCATGAGCGGT-3’ designed specific to the coat protein yielded a 735-bp amplicon from all five G-204 plants. The amplified product was purified using QIAquick PCR Purification Kit (Qiagen, Germany) and cloned in pJET1.2 vector (Thermo Scientific, Lithuania). Two clones containing the CP gene were bidirectionally sequenced, and a consensus sequence was submitted to GenBank (MN650206). BLASTn results indicated that this consensus sequence showed 97.96% nucleotide (KP657919.1) and 100% amino acid sequence (AKN19940.1) identity with the CP sequence of GarV-B isolate from Poland. The presence of GarV-B was confirmed by enzyme-linked immunosorbent assay (ELISA) using a double-antibody sandwich ELISA kit (Arsh Biotech, Delhi, India) as per the manufacturer’s protocol. An absorbance of reaction was read using a microplate reader at 405 nm. The mean OD values of negative and positive controls were 0.034 and 0.373, respectively. The OD values of five samples tested ranged from 0.210 to 0.296 indicating a positive reaction for GarV-B. To assess the presence of GarV-B in the available genetic stock, we tested 30 garlic germplasm accessions for GarV-B using RT-PCR. Out of these, 17 accessions were found positive for GarV-B. GarV-B has been reported from many countries (Gieck et al. 2009). This is the first report of GarV-B from India. Globally, allexiviruses are known for their adverse impact on garlic production (Oliveira et al. 2014). GarV-B together with other viruses can be a potential threat to garlic production in India. Further, detailed evaluations are needed to study the impact of GarV-B on garlic production in India.

Download Full-text

First Report of Cucumber green mottle mosaic virus Infecting Greenhouse Cucumber in Canada

Plant Disease ◽

10.1094/pdis-09-13-0996-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701 ◽

Cited By ~ 8

Author(s):

K.-S. Ling ◽

R. Li ◽

W. Zhang

Keyword(s):

Mosaic Virus ◽

Real Time ◽

Cucumis Sativus ◽

Disease Incidence ◽

The United States ◽

Rt Pcr ◽

First Report ◽

Sequence Identity ◽

Two Samples ◽

Greenhouse Cucumber

In early 2013, greenhouse cucumber growers in Alberta, Canada, observed virus-like disease symptoms on mini-cucumber (Cucumis sativus) crops (e.g., ‘Picowell’). Two types of symptoms were commonly observed, green mottle mosaic and necrotic spots. In the early infection, young leaves of infected cucumber plants displayed light green mottle and blisters. The infected plants were stunted in growth, with darker green blisters and green mottle mosaic symptoms on mature leaves. Disease incidence varied from one greenhouse to another. In some severe cases, diseased plants were widely distributed inside the greenhouse, resulting in 10 to 15% yield losses based on grower's estimation. Nine symptomatic samples were collected and subjected to total RNA isolation using the TRIzol reagent (Invitrogen, Carlsbad, CA). Laboratory analyses were conducted using real-time RT-PCR systems for Cucumber green mottle mosaic virus (CGMMV) (1), Melon necrotic spot virus (MNSV, Ling, unpublished), and Squash mosaic virus (SqMV) (3). All nine samples were positive for CGMMV and seven of them were in mixed infections with MNSV. Two samples were selected for validation for the presence of CGMMV using conventional RT-PCR (2) with a new primer set (CGMMVMP F1: 5′-ATGTCTCTAAGTAAGGTGTC-3′ and CGMMV3′UTR R1: 5′-TGGGCCCCTACCCGGGG-3′) and two previous online published primer sets, one for CGMMV MP (5′ TAAGTTTGCTAGGTGTGATC-3′, GenBank Accession No. AJ250104 and 5′ ACATAGATGTCTCTAAGTAAG-3′, AJ250105), and another for CGMMV CP (5′ ACCCTCGAAACTAAGCTTTC-3′, AJ243351 and 5′ GAAGAGTCCAGTTCTGTTTC-3′, AJ243352). The expected sizes of RT-PCR products were obtained and sequenced directly. Sequences from these three products overlapped and generated a 1,282-bp contig (KF683202). BLASTn analysis to the NCBI database showed 99% sequence identity to CGMMV isolates identified in Asia, including China (GQ277655, KC852074), India (DQ767631), Korea (AF417243), Myanmar (AB510355), and Taiwan (HQ692886), but only 92% sequence identity to other CGMMV isolates identified in Europe, including Spain (GQ411361) and Russia (GQ495274), and 95% to CGMMV isolate from Israel (KF155231). The strong sequence identity to the CGMMV Asian isolates suggests that the Canadian CGMMV isolate identified in Alberta was likely of Asian origin. In two bioassay experiments using one sample prepared in 0.01 M phosphate buffer, the similar green mottle mosaic symptoms were observed on systemic leaves in the mechanically inoculated plants and the presence of CGMMV, but not MNSV, was confirmed through real-time RT-PCR on four different cucurbits, including three Cucumis sativus cultivars (six plants in ‘Marketer,’ five plants in ‘Poinsett 76,’ six plants in ‘Straight 8’), seven plants of C. melo ‘Athena,’ six plants of C. metulifer (PI201681), and two plants of Citrullus lanatus ‘Charleston Gray.’ To our knowledge, CGMMV has only been reported in Asia, Europe, and the Middle East, and this is the first report of CGMMV in the American continents. CGMMV is highly contagious and is seed borne on cucurbits. With the increasing trend in growing grafted watermelon and other cucurbits in the United States and elsewhere, it is even more important now that a vigilant seed health test program for CGMMV should be implemented. References: (1) H. Chen et al. J. Virol. Methods 149:326, 2008. (2) K.-S. Ling et al. Plant Dis. 92:1683, 2008. (3) K.-S. Ling et al. J. Phytopathol. 159:649, 2011.

Download Full-text

First Report of Tomato torrado virus Infecting Tomato in Hungary

Plant Disease ◽

10.1094/pdis-93-5-0554c ◽

2009 ◽

Vol 93 (5) ◽

pp. 554-554 ◽

Cited By ~ 18

Author(s):

A. Alfaro-Fernández ◽

G. Bese ◽

C. Córdoba-Sellés ◽

M. C. Cebrián ◽

J. A. Herrera-Vásquez ◽

...

Keyword(s):

Coat Protein ◽

Mosaic Virus ◽

Polyclonal Antibodies ◽

Blot Hybridization ◽

Sandwich Elisa ◽

World Intellectual Property Organization ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Dot Blot ◽

First Report

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

Download Full-text

Prevalence and Molecular Characterization Coat Protein Gene of Tobacco streak virus Causing Peanut Stem Necrosis Disease in Coastal and Rayalaseema Districts of Andhra Pradesh, South-India

Legume Research - An International Journal ◽

10.18805/lr-4515 ◽

2021 ◽

Author(s):

K. Saratbabu ◽

K. Vemana ◽

A.K. Patibanda ◽

B. Sreekanth ◽

V. Srinivasa Rao

Keyword(s):

Coat Protein ◽

Molecular Characterization ◽

Andhra Pradesh ◽

Disease Incidence ◽

Tobacco Streak Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Streak Virus ◽

Rt Pcr ◽

Cp Gene ◽

Stem Necrosis

Background: Peanut stem necrosis disease (PSND) caused by Tobacco streak virus (TSV) is a major constraint for groundnut production in Andhra Pradesh (A.P.). However, studies on prevalence and spread of the disease confined to only few districts of A.P. with this background current study focused on incidence and spread of the disease in entire state of A.P. Further an isolate of TSV occurring in A.P. characterized on the basis of genetic features by comparing with other TSV isolates originated from different hosts and locations from world.Methods: Roving survey was conducted during kharif 2017-18 in groundnut growing districts of Andhra Pradesh (A.P.) for peanut stem necrosis disease incidence. Groundnut plants showing PSND symptoms were collected and tested with direct antigen coating enzyme linked immunosorbent assay (DAC-ELISA). Groundnut samples found positive by ELISA once again tested by reverse transcription polymerase chain reaction (RT-PCR). The representative TSV-GN-INDVP groundnut isolate from Prakasham district was maintained on cowpea seedlings by standard sap inoculation method in glasshouse for further molecular characterization. The Phylogenetic tree for coat protein (CP) gene was constructed using aligned sequences with 1000 bootstrap replicates following neighbor-joining phylogeny.Result: Thirty-eight (52.7%) of seventy-two groundnut samples collected from different locations in A.P were given positive reaction to TSV by DAC-ELISA. For the first time, PSND incidence observed in coastal districts (Krishna, Guntur, Sri Pottisriramulu Nellore, Prakasham) of A.P. Maximum PSND incidence recorded from Bathalapalli (22.2%) and the minimum incidence in Mulakalacheruvu (4.1%). The coat protein (CP) gene of TSV-GN-INDVP groundnut isolate was amplified by RT-PCR and it shared maximum per cent nucleotide identity (97.51-98.62%) with TSV isolates from groundnut and other different crops reported in India. All Indian isolates cluster together irrespective of crop and location based on the phylogenetic analysis.

Download Full-text

First Report of Plum pox virus (Sharka Disease) in Prunus persica in the United States

Plant Disease ◽

10.1094/pdis.2000.84.2.202b ◽

2000 ◽

Vol 84 (2) ◽

pp. 202-202 ◽

Cited By ~ 65

Author(s):

L. Levy ◽

V. Damsteegt ◽

R. Welliver

Keyword(s):

Prunus Persica ◽

Virus Disease ◽

Sandwich Elisa ◽

Pcr Amplification ◽

The United States ◽

Enzyme Linked Immunosorbent Assay ◽

Plum Pox Virus ◽

Rt Pcr ◽

Peach Fruit ◽

First Report

Plum pox (Sharka) is the most important virus disease of Prunus in Europe and the Mediterranean region and is caused by Plum pox potyvirus (PPV). In September 1999, PPV-like symptoms were observed in peach fruit culls in a packinghouse in Pennsylvania. All symptomatic fruit originated from a single block of peach (P. persica cv. Encore) in Adams County. Trees in the block exhibited ring pattern symptoms on their leaves. A potyvirus was detected in symptomatic fruit using the Poty-Group enzyme-linked immunosorbent assay (ELISA) test from Agdia (Elkhart, IN). Reactions for symptomatic peach fruit and leaves also were positive using triple-antibody sandwich ELISA with the PPV polyclonal antibody from Bioreba (Carrboro, NC) for coating, the Poty-Group monoclonal antibody (MAb; Agdia) as the intermediate antibody, and double-antibody sandwich ELISA with PPV detection kits from Sanofi (Sanofi Diagnostics Pasteur, Marnes-La-Coquette, France) and Agdia and the REAL PPV kit (Durviz, Valencia, Spain) containing universal (5B) and strain typing (4DG5 and AL) PPV MAbs (1). PPV also was identified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) amplification and subsequent sequencing of the 220-bp 3′ noncoding region (2) (>99% sequence homology to PPV) and by IC-RT-PCR amplification of a 243-bp product in the coat protein (CP) gene (1). The virus was identified as PPV strain D based on serological typing with strainspecific MAbs and on PCR-restriction fragment length polymorphism of the CP IC-RT-PCR product with Rsa1 and Alu1 (1). This is the first report of PPV in North America. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) L. Levy and A. Hadidi. EPPO Bull. 24:595, 1994.

Download Full-text

First Report of Garlic common latent virus Infecting Garlic in Sudan

Plant Disease ◽

10.1094/pdis-11-12-1018-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 562-562 ◽

Cited By ~ 1

Author(s):

K. Hamed ◽

W. Menzel ◽

M. E. Mohamed ◽

K. A. Bakheet ◽

S. Winter

Keyword(s):

Sequence Similarity ◽

Total Yield ◽

Latent Virus ◽

Nucleic Acid Binding ◽

Rt Pcr ◽

Terminal Part ◽

Leaf Sample ◽

First Report ◽

Garlic Common Latent Virus ◽

The Impact

Garlic (Allium sativum L.) is one of the most important vegetable field crops in Sudan, cultivated on an area of more than 6,000 ha with a total yield of 27,000 t in 2010 (faostat.fao.org). As part of a project which started in 2010 to improve the garlic production in Sudan, samples from local varieties showing severe mosaic and/or mottling were collected in winter 2011 from the main production areas in River Nile State, Northern State, and Darfur State. The plant material used for garlic production came from Sudan and was not imported. Because no reliable data were available on which viruses occur in garlic in Sudan, specific tests were initially omitted. In order to get an overview of the viruses present, dsRNA was prepared of a mixed leaf sample (12 leaves of different samples). This resulted in a high molecular weight dsRNA of approximately 9 kbp that served as template for a random RT-PCR followed by cloning and sequencing (3). Three identical clones originating from one PCR product covering the C-terminal part of the coat protein to the N-terminal part of the nucleic acid binding protein showed the highest sequence similarity to Garlic common latent virus (GarCLV). The nucleotide sequence identities of the 554-bp insert range from 85% to an isolate from India (Accession No. FJ154841) up to 97% to a GarCLV isolate from The Netherlands (AB004804), identifying the virus as a Sudanese isolate of GarCLV, one of the most common garlic infecting viruses. GarCLV belongs to the genus Carlavirus (1) and has previously been reported from Asia, Europe, and South America ( http://sdb.im.ac.cn/vide/descr352.htm ). In order to confirm these results, a double antibody sandwich (DAS)-ELISA was performed with six individual garlic samples in which five samples showed a clear reaction with a GarCLV specific antiserum (AS-0230, DSMZ, Germany). The occurrence of GarCLV could be further confirmed for the ELISA positive samples by a specific RT-PCR using the primers published by Majumder and Baranwal (2). Fragments of the expected size were obtained for all five samples. In addition, one of the positive samples was examined by electron microscopy (Dr. K. Richert-Pöggeler, JKI Braunschweig); filamentous flexous particles typical for carlaviruses could be observed. The random RT-PCR sequence obtained in this study has been submitted to GenBank (KC013030). To our knowledge, this is the first report of GarCLV in garlic in Sudan and Africa. The impact of GarCLV on garlic production in Sudan needs to be evaluated, but the awareness of the occurrence of the virus and the availability of a reliable diagnostic tool will help to select virus-free propagation material. This will form the basis for a sustainable garlic production. References: (1) A. M. Q. King et al. Virus Taxonomy 924, 2012. (2) S. Majumder and V. K. Baranwal. Plant Dis. 93:106, 2009. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009.

Download Full-text

First Report of a Carlavirus in Fuchsia spp. in New Zealand

Plant Disease ◽

10.1094/pdis-05-11-0443 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1484-1484 ◽

Cited By ~ 2

Author(s):

Z. Perez-Egusquiza ◽

L. W. Liefting ◽

S. Veerakone ◽

G. R. G. Clover ◽

M. Ciuffo

Keyword(s):

Electron Microscopy ◽

New Zealand ◽

Coat Protein ◽

Chenopodium Quinoa ◽

Plant Diseases ◽

Nucleotide Identity ◽

Impatiens Necrotic Spot Virus ◽

Rt Pcr ◽

First Report ◽

Genome Region

The genus Fuchsia has 110 known species and numerous hybrids. These ornamental plants with brightly colored flowers originate from Central and South America, New Zealand, and Tahiti, but a wider variety are now grown all over the world. Few viruses have been reported in Fuchsia spp.: a carlavirus, Fuchsia latent virus (FLV) (1–3), a cucumovirus, Cucumber mosaic virus (CMV) (3), and two tospoviruses, Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) (4). In August 2009, five plants, each representing a different cultivar of Fuchsia hybrid, from home gardens in the Auckland and Southland regions of New Zealand, displayed variable symptoms including mild chlorosis, mild mottle, or purple spots on leaves. Plants tested negative for CMV, INSV, and TSWV using commercial ImmunoStrips (Agdia Inc., Elkhart, IN); however, flexuous particles of ~650 to 700 nm were found by electron microscopy in all samples. Local lesions were also observed on Chenopodium quinoa plants 4 weeks after sap inoculation. Total RNA was extracted from all plants with a RNeasy Plant Mini Kit (Qiagen Inc., Doncaster, Australia) and tested by reverse transcription (RT)-PCR using two generic sets of primers (R. van der Vlugt, personal communication) designed to amplify fragments of ~730 and 550 bp of the replicase and coat protein genes of carlaviruses, respectively. Amplicons of the expected size were obtained for all samples, cloned, and at least three clones per sample were sequenced. No differences within clones from the same samples were observed (GenBank Accession Nos. HQ197672 to HQ197681). A BLASTn search of the viral replicase fragment showed the highest nucleotide identity (76%) to Potato rough dwarf virus (PRDV) (EU020009), whereas the coat protein fragment had maximum nucleotide identity (70 to 72%) to PRDV (EU020009 and DQ640311) and Potato virus P (DQ516055). Sequences obtained were also pairwise aligned using the MegAlign program (DNASTAR, Inc., Madison, WI) and results showed that the isolates had 83 to 97% identity to each other within each genome region. Further sequences (HQ197925 and HQ197926) were obtained from a Fuchsia plant originating from Belgium, a BLASTn analysis showed high nucleotide identity (84 to 99%) to the New Zealand isolates. The low genetic identity to other Carlavirus members suggests that these isolates belong to a different species from those previously sequenced. On the basis of electron microscopy and herbaceous indexing, the isolates had similar characteristics to a carlavirus reported from Fuchsia in Italy (1) and FLV reported in Canada (2). The Italian carlavirus isolate was obtained and tested with the same primers by RT-PCR. Pairwise analysis of the Italian sequences (HQ197927 and HQ197928) with the New Zealand and Belgian sequences showed between 84 and 95% similarity within each genome region. These results suggest that the carlavirus infecting these plants is the same virus, possibly FLV. To our knowledge, this is the first report of this carlavirus infecting Fuchsia spp. in New Zealand, but the virus has probably been present for some time in this country and is likely to be distributed worldwide. References: (1) G. Dellavalle et al. Acta Hortic. 432:332, 1996. (2) L. J. John et al. Acta Hortic. 110:195, 1980. (3) P. Roggero et al. Plant Pathol. 49:802, 2000. (4) R. Wick and B. Dicklow. Diseases in Fuchsia. Common Names of Plant Diseases. Online publication. The American Phytopathological Society, St. Paul, MN, 1999.

Download Full-text

First Report of Beet necrotic yellow vein virus Infecting Spinach in California

Plant Disease ◽

10.1094/pdis-94-5-0640a ◽

2010 ◽

Vol 94 (5) ◽

pp. 640-640 ◽

Cited By ~ 4

Author(s):

H.-Y. Liu ◽

B. Mou ◽

K. Richardson ◽

S. T. Koike

Keyword(s):

Spinacia Oleracea ◽

Sandwich Elisa ◽

Chenopodium Quinoa ◽

Yellow Vein ◽

Mechanical Transmission ◽

Polymyxa Betae ◽

Rt Pcr ◽

First Report ◽

Vein Clearing ◽

Rigid Rod

In 2009, plants from two spinach (Spinacia oleracea) experimental fields in Monterey County and one commercial spinach field in Ventura County of California exhibited vein-clearing, mottling, interveinal yellowing, and stunting symptoms. For experimental fields, up to 44% of spinach plants have symptoms. With a transmission electron microscope, rigid rod-shaped particles with central canals were observed from plant sap of the symptomatic spinach. Analysis with a double-antibody sandwich-ELISA assay for Beet necrotic yellow vein virus (BNYVV) showed that all 10 symptomatic plants we tested were positive and 5 asymptomatic plants were negative. Symptomatic spinach from both counties was used for mechanical transmission experiments. Chenopodium quinoa, Tetragonia expansa, and Beta vulgaris (sugar beet) showed chlorotic local lesions and B. macrocarpa and spinach showed vein-clearing, mottling, and systemic infections. To further confirm the presence of BNYVV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from field- and mechanically inoculated symptomatic spinach plants using an RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR. Forward and reverse primers specific to the BNYVV RNA-3 P25 protein gene from the beet isolate were used (2). Amplicons of the expected size (approximately 860 bp) were obtained. Four RT-PCR products were sequenced and the sequences were identical (GenBank Accession No. GU135626). Sequences from the spinach plants had 97 to 99% nucleotide and 94 to 100% amino acid identity with BNYVV RNA-3 P25 protein sequences available in the GenBank. On the basis of the data from electron microscopy, indicator plants, serology, and cDNA sequencing, the virus was identified as BNYVV. BNYVV has been reported from spinach fields in Italy (1). To our knowledge, this is the first report of BNYVV occurring naturally on spinach in California. Since BNYVV is transmitted by the zoospores of the soil-inhabiting plasmodiophorid Polymyxa betae, it could be a new threat to spinach production in the state. References: (1) C. R. Autonell et al. Inf. Fitopatol. 45:43, 1995. (2) H.-Y. Liu and R. T. Lewellen, Plant Dis. 91:847, 2007.

Download Full-text

First Report of Tomato torrado virus Infecting Tomato in Colombia

Plant Disease ◽

10.1094/pdis-11-11-1000 ◽

2012 ◽

Vol 96 (4) ◽

pp. 592-592 ◽

Cited By ~ 9

Author(s):

M. Verbeek ◽

A. M. Dullemans

Keyword(s):

Mosaic Virus ◽

Potato Virus ◽

Polyclonal Antibodies ◽

Sandwich Elisa ◽

Potato Virus X ◽

Rt Pcr ◽

Leaf Extracts ◽

Serological Tests ◽

First Report ◽

Initial Symptoms

Tomato (Solanum lycopersicum L.) plants grown in plastic greenhouses near Villa de Leyva, northeast of Bogota, Colombia showed necrotic spots on the leaves in September 2008. Initial symptoms were necrosis beginning at the base of leaflets that were surrounded by yellow areas. These symptoms resembled those described for Tomato torrado virus (ToTV; family Secoviridae, genus Torradovirus), which was first found in Spain (2). Other (tentative) members of the genus Torradovirus, Tomato marchitez virus (ToMarV), Tomato chocolate spot virus (ToChSV), and Tomato chocolàte virus (ToChV) (3) induce similar symptoms on tomato plants. One sample, coded T418, was stored in the freezer and brought to our lab in 2011. Serological tests (double-antibody sandwich-ELISA) using polyclonal antibodies (Prime Diagnostics, Wageningen, The Netherlands) on leaf extracts showed the absence of Pepino mosaic virus (PepMV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Cucumber mosaic virus (CMV), Potato virus X (PVX), and Potato virus Y (PVY). Leaf extracts were mechanically inoculated onto the indicator plants Physalis floridana, Nicotiana hesperis ‘67A’, and N. occidentalis ‘P1’ (six plants in total) and were kept in a greenhouse at 20°C with 16 h of light. Necrotic symptoms appeared 4 to 5 days postinoculation and resembled those described for ToTV (2). Two dip preparations of systemically infected P. floridana and N. occidentalis leaves were examined by electron microscopy, which revealed the presence of spherical virus particles of approximately 30 nm. To confirm the presence of ToTV, total RNA was extracted from the original leaf material and an inoculated P. floridana and N. occidentalis plant using the Qiagen Plant Mini Kit (Qiagen, Hilden, Germany) following manufacturer's instructions. ToTV-specific primer sets ToTV-Dp33F/ToTV-Dp20R (5′-TGCTCAATGTTGGAAACCCC-3′/5′-AGCCCTTCATAGGCTAGCC-3′, amplifying a fragment of the RNA1 polyprotein with an expected size of 751 bp) and ToTV-Dp1F/ToTV-Dp2R (5′-ACAAGAGGAGCTTGACGAGG-3′/5′-AAAGGTAGTGTAATGGTCGG-3′, amplifying a fragment on the RNA2 movement protein region with an expected size of 568 bp) were used to amplify the indicated regions in a reverse transcription (RT)-PCR using the One-Step Access RT-PCR system (Promega, Madison, WI). Amplicons of the predicted size were obtained in all tested materials. The PCR products were purified with the Qiaquick PCR Purification Kit (Qiagen) and sequenced directly. BLAST analyses of the obtained sequences (GenBank Accession Nos. JQ314230 and JQ314229) confirmed the identity of isolate T418 as ToTV, with 99% identity to isolate PRI-ToTV0301 in both fragments (GenBank Accession Nos. DQ388879 and DQ388880 for RNA1 and RNA 2, respectively). To our knowledge, this is the first report of ToTV in Colombia, and interestingly, since ToTV has been found only in Europe and Australia (1) so far, this is the first report of ToTV on the American continent. References: (1) C. F. Gambley et al. Plant Dis. 94:486, 2010. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007. (3) M. Verbeek et al. Arch. Virol. 155:751, 2010.

Download Full-text