First Report of Garlic virus B infecting Garlic in India

Garlic (Allium sativum L.) is an economically important spice and vegetable crop grown throughout the world. Garlic viral disease complex caused by multiple virus infections is an important constraint in exploiting the potential yield of garlic. Among these viral pathogens, allexivirus (family Alphaflexiviridae) is the genus of viruses known for their degenerative effect on garlic yield. Their coexistence with other viruses, particularly potyviruses, has an adverse effect on garlic yield and quality (Perotto et al. 2010). During Sept 2018, while screening garlic germplasm accessions for the presence of allexiviruses, symptoms like foliar mosaic and curling were observed on accession G-204, planted at an experimental plot of ICAR-DOGR, Pune, India. A total of five samples comprised of five randomly selected G-204 garlic plants were collected from the experimental plot. Each sample contained leaves from the top, middle, and bottom portion of the individual garlic plants. These samples were subjected to RNA extraction using the RNeasy Plant Mini Kit (Qiagen, Germany) followed by reverse transcription (RT) using the Transcriptor cDNA synthesis kit (Roche Diagnostics, GmbH, Germany). The extracted RNA was then tested for allexiviruses such as garlic virus A (GarV-A), garlic virus B (GarV-B), garlic virus C (GarV-C), garlic virus D (GarV-D), and garlic virus X (GarV-X) by polymerase chain reaction (PCR) (Gawande et al. 2015; Roylawar et al. 2019; Baranwal et al. 2011; Gieck et al. 2009). Leaf samples tested through RT-PCR were found positive for garlic viruses GarV-A, GarV-B, GarV-C, GarV-D, and GarV-X. Allexiviruses other than GarV-B had been previously reported in India and hence further tests were conducted to confirm GarV-B infection. RT-PCR using primers, CF 5’- ATGGGAGACAGGTCGCAA-3’ and CR5’- CTAAAATGTAAGCATGAGCGGT-3’ designed specific to the coat protein yielded a 735-bp amplicon from all five G-204 plants. The amplified product was purified using QIAquick PCR Purification Kit (Qiagen, Germany) and cloned in pJET1.2 vector (Thermo Scientific, Lithuania). Two clones containing the CP gene were bidirectionally sequenced, and a consensus sequence was submitted to GenBank (MN650206). BLASTn results indicated that this consensus sequence showed 97.96% nucleotide (KP657919.1) and 100% amino acid sequence (AKN19940.1) identity with the CP sequence of GarV-B isolate from Poland. The presence of GarV-B was confirmed by enzyme-linked immunosorbent assay (ELISA) using a double-antibody sandwich ELISA kit (Arsh Biotech, Delhi, India) as per the manufacturer’s protocol. An absorbance of reaction was read using a microplate reader at 405 nm. The mean OD values of negative and positive controls were 0.034 and 0.373, respectively. The OD values of five samples tested ranged from 0.210 to 0.296 indicating a positive reaction for GarV-B. To assess the presence of GarV-B in the available genetic stock, we tested 30 garlic germplasm accessions for GarV-B using RT-PCR. Out of these, 17 accessions were found positive for GarV-B. GarV-B has been reported from many countries (Gieck et al. 2009). This is the first report of GarV-B from India. Globally, allexiviruses are known for their adverse impact on garlic production (Oliveira et al. 2014). GarV-B together with other viruses can be a potential threat to garlic production in India. Further, detailed evaluations are needed to study the impact of GarV-B on garlic production in India.

Download Full-text

First Report of Plum pox virus (Sharka Disease) in Prunus persica in the United States

Plant Disease ◽

10.1094/pdis.2000.84.2.202b ◽

2000 ◽

Vol 84 (2) ◽

pp. 202-202 ◽

Cited By ~ 65

Author(s):

L. Levy ◽

V. Damsteegt ◽

R. Welliver

Keyword(s):

Prunus Persica ◽

Virus Disease ◽

Sandwich Elisa ◽

Pcr Amplification ◽

The United States ◽

Enzyme Linked Immunosorbent Assay ◽

Plum Pox Virus ◽

Rt Pcr ◽

Peach Fruit ◽

First Report

Plum pox (Sharka) is the most important virus disease of Prunus in Europe and the Mediterranean region and is caused by Plum pox potyvirus (PPV). In September 1999, PPV-like symptoms were observed in peach fruit culls in a packinghouse in Pennsylvania. All symptomatic fruit originated from a single block of peach (P. persica cv. Encore) in Adams County. Trees in the block exhibited ring pattern symptoms on their leaves. A potyvirus was detected in symptomatic fruit using the Poty-Group enzyme-linked immunosorbent assay (ELISA) test from Agdia (Elkhart, IN). Reactions for symptomatic peach fruit and leaves also were positive using triple-antibody sandwich ELISA with the PPV polyclonal antibody from Bioreba (Carrboro, NC) for coating, the Poty-Group monoclonal antibody (MAb; Agdia) as the intermediate antibody, and double-antibody sandwich ELISA with PPV detection kits from Sanofi (Sanofi Diagnostics Pasteur, Marnes-La-Coquette, France) and Agdia and the REAL PPV kit (Durviz, Valencia, Spain) containing universal (5B) and strain typing (4DG5 and AL) PPV MAbs (1). PPV also was identified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) amplification and subsequent sequencing of the 220-bp 3′ noncoding region (2) (>99% sequence homology to PPV) and by IC-RT-PCR amplification of a 243-bp product in the coat protein (CP) gene (1). The virus was identified as PPV strain D based on serological typing with strainspecific MAbs and on PCR-restriction fragment length polymorphism of the CP IC-RT-PCR product with Rsa1 and Alu1 (1). This is the first report of PPV in North America. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) L. Levy and A. Hadidi. EPPO Bull. 24:595, 1994.

Download Full-text

First Report of Orchid fleck virus in Costa Rica

Plant Disease ◽

10.1094/pdis.2002.86.12.1402d ◽

2002 ◽

Vol 86 (12) ◽

pp. 1402-1402 ◽

Cited By ~ 10

Author(s):

Juliana Freitas-Astúa ◽

Lisela Moreira ◽

Carmen Rivera ◽

Carlos M. Rodríguez ◽

Elliot W. Kitajima

Keyword(s):

Costa Rica ◽

Consensus Sequence ◽

Pcr Amplification ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Thin Sections ◽

Orchid Fleck Virus ◽

First Report ◽

Nucleocapsid Gene ◽

Pcr Product

Orchid fleck virus (OFV), a tentative member of the family Rhabdoviridae, infects orchids in several countries. The virus is vectored worldwide by the mite Brevipalpus californicus (Banks) (Acari: Tenuipalpidae). Eleven plants of Oncidium spp. and one plant each of the genera Cymbidium and Maxillaria exhibiting numerous yellow flecks and necrotic ringspot lesions on leaves were collected in two private orchid collections in Costa Rica. Presence of OFV was assessed by plate-trapped antigen enzyme-linked immunosorbent assay (PTA-ELISA) using an antiserum developed against an OFV isolate in Japan (2), analyses of ultrathin sections of the host cell with transmission electron microscopy (TEM), and reverse transcription-polymerase chain reaction (RT-PCR) amplification using specific primers for the viral nucleocapsid gene (1). Eight of eleven Oncidium samples, and both Cymbidium and Maxillaria samples tested positive for OFV with PTA-ELISA having A405 values ranging from 3.9 to 14.6 times higher than negative controls. Thin sections from individual samples of Cymbidium, Oncidium, and Maxillaria revealed electron-lucent intranuclear viroplasm and short, rodlike particles (40 to 50 × 100 nm) in the nucleus or cytoplasm typical of OFV-infected cells. RT-PCR amplifications from one sample of each genera resulted in PCR-product bands of approximately 800 bp. The Cymbidium RT-PCR product was cloned into a pGEM-T-Easy expression vector and sequenced using an ABI 3700 sequencer. The 619-bp nucleocapsid gene consensus sequence had 98% homology with the OFV isolate 0023 identified in Germany (GenBank Accession No. AF343870) (1). However, it had only approximately 85% nucleocapsid gene homology with other OFV isolates available through GenBank, including those from countries geographically closer to Costa Rica, such as Brazil (1). To our knowledge, this is the first report of OFV infecting orchids in Costa Rica. References: (1) A. L. Blanchfield et al. J. Phytopathol. 149:713, 2001. (2) H. Kondo et al. Bull. Res. Inst. Bioresour. Okayama Univ. 4:149, 1996.

Download Full-text

First Report of Garlic virus B and Garlic virus D in Garlic in the Pacific Northwest

Plant Disease ◽

10.1094/pdis-93-4-0431a ◽

2009 ◽

Vol 93 (4) ◽

pp. 431-431 ◽

Cited By ~ 6

Author(s):

S. L. Gieck ◽

P. B. Hamm ◽

N. L. David ◽

H. R. Pappu

Keyword(s):

Pacific Northwest ◽

Seed Production ◽

The Other ◽

Rt Pcr ◽

Specific Primers ◽

Sequence Comparisons ◽

First Report ◽

The Pacific ◽

The Impact ◽

Garlic Virus

With the recent report of several viruses infecting garlic (Allium sativum L.) grown in the Pacific Northwest (1–3), studies were initiated on cloves planted in the fall of 2006 to determine the presence of additional viruses infecting plants exhibiting mosaic and/or chlorotic leaves. Cloves from symptomatic plants of the cultivar ‘Early’ from two seed production fields in Benton County, WA and two seed production fields in Morrow County, OR were tested by two-step reverse transcription (RT)-PCR using primers specific to the coat protein (CP) of the allexiviruses (4), since garlic infected with this group had similar symptoms in Asia and South America (4). Of the 87 cloves tested, 84 were positive, and four representative samples of the RT-PCR amplicons from each location were cloned and sequenced. Sequence comparisons indicated that the cloves from both locations were infected with Garlic virus D (GarV-D), also known as Japanese garlic virus (JGV), since they shared 98% identity with known isolates (GenBank Accession Nos. L388922.1, AF519572.1, and AB010303.1). In addition, sequences of isolates from the Oregon cloves shared a 96% identity with a known isolate of Garlic virus B (GarV-B; GenBank Accession No. AF543829.1). Because no antiserum specific to these viruses was available, primers specific to the CP genes of GarV-D (JGV-F2/JGV-R2 5′-GCTCACTCRGATGTGTTAGC-3′ and 5′-CGCGTGGACATAAGTTGTTG-3′) and GarV-B (GVB-F1/GVB-R2 5′-GAGGAGAACTAACGCCACAC-3′ and 5′-ACGACCTAGCTTCCTACTTG-3′) were designed and the cloves were retested by RT-PCR using these virus-specific primers. With the GarV-D specific primers, 98 and 63% of the cloves were positive from Washington and Oregon, respectively, and 52% of the cloves from Oregon were positive using the GarV-B specific primers. None of the cloves tested from Washington were positive for GarV-B. The identity of the amplicons was verified by cloning and sequencing (GarV-D, GenBank Accession No. FJ643476; GarV-B, GenBank Accession No. FJ643475). Incidence of the two viruses differed between Oregon and Washington was likely due to the expansion of the seed lots in two different locations (California and Nevada) prior to planting in 2006. With such high infection rates, studies should be conducted to determine the impact of these viruses on yield when plants are singly infected as well as in combination with the other viruses known to infect garlic in this region. These and the other viruses (1) are likely to impact yield. To our knowledge, this is the first report of GarV-D (JGV) and GarV-B in garlic in the Pacific Northwest. References: (1) S. L. Gieck et al. Plant Dis. 91:461, 2007. (2) H. R. Pappu et al. Plant Dis. 89:205, 2005 (3) H. R. Pappu et al. Online publication. doi:10.1094/PHP-2008-0919-01-RS. Plant Health Progress, 2008. (4) T. Tsuneyoshi et al. Phytopathology 86:253, 1996.

Download Full-text

First Report of Shallot virus X in Onion in Sudan

Plant Disease ◽

10.1094/pdis-03-12-0253-pdn ◽

2012 ◽

Vol 96 (7) ◽

pp. 1075-1075 ◽

Cited By ~ 2

Author(s):

K. Hamed ◽

W. Menzel ◽

M. E. Mohamed ◽

G. Dafallah ◽

A. M. A. Gadelseed ◽

...

Keyword(s):

Coat Protein ◽

Disease Incidence ◽

Sandwich Elisa ◽

Research Station ◽

New Disease ◽

Rt Pcr ◽

Cycle Sequencing ◽

First Report ◽

Sequence Identity ◽

The Impact

Onion (Alium cepa L.) is among the most important vegetable field crops in Sudan. During a disease survey in crops (cvs. Kamleen Yellow and Abu-freua) conducted in 2010, samples showing mild mottling symptoms were collected from Shambat Research Station Farm, Khartoum North, Sudan. A CF-11 cellulose chromatography dsRNA preparation (4) of a mixed onion leaf sample of five plants (20 g) resulted, apart from smaller dsRNAs up to 3 kbp, in a high molecular weight dsRNA of approximately 9 kbp. This dsRNA was used as a template for a random reverse transcriptase (RT)-PCR followed by cloning (4) and sequencing of two randomly selected clones by the ABI BigDye Terminator v3.1 Cycle Sequencing Kit. Comparison with sequences available at GenBank revealed high identities to Shallot virus X (ShVX). ShVX is the type member of the genus Allexivirus (Alphaflexiviridae). One sequence obtained showed 84% nt and 98% aa sequence identity (genome position 414 to 1,285 of Accession No. M97264) to the replicase, whereas the other sequence partially covered the ORF4 and coat protein (CP) coding region (7,127 to 7,998). This sequence showed 80% nt (entire sequence) and 80/89% aa sequence identity to the ORF4 encoded protein/coat protein of a Russian ShVX isolate, respectively. ShVX was first reported in shallot in Russia (2) and subsequently in the Netherlands, Germany, India (3), and New Zealand (1). To confirm the presence of ShVX in Sudan, 32 symptomatic leaf samples were collected in 2011 from different onion fields in Khartoum North, with a similar disease incidence compared to 2010. Thirty-one of these onion samples reacted positively in a double antibody sandwich-ELISA with a ShVX-specific antiserum (DSMZ AS-1042). Total RNA was extracted from five ShVX-ELISA positive onion samples using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Two primer pairs were also designed on the basis of sequences obtained in the random RT-PCR approach, targeting a 659-bp fragment of the coat protein region (ShVX-CPs 5′GTTGAATGTGGCGAGCGCAA3′ and ShVX-CPas 5′AGTGCAGAAGCCTTCCACA3′) or a 686-bp fragment of the replicase (ShVX-Rs 5′ATGTACTTCGGTACGGCATCA3′ and ShVX-R-as 5′TAATCGAATGAGGTCGGCCA3′). Fragments of the expected sizes were obtained for all positive samples. One RT-PCR product of each primer pair was directly sequenced, showing high sequence identities to those previously obtained (>98%). The random RT-PCR sequences obtained in this study were submitted to GenBank (JQ751056 and JQ751057). On the basis of the nucleotide sequences obtained with the dsRNA template, ShVX specific RT-PCR, and ELISA, the presence of ShVX in Sudan was confirmed in two consecutive years. To our knowledge, this is the first report of ShVX in Sudan and Africa, indicating this virus is more widespread than previously reported. The presence of ShVX also suggests the presence of its only known vector, the mite Aceria tulipae. The virus may have been introduced to Sudan by infected onion sets. Even if the impact of ShVX on onion production has not been determined, its identification and the availability of a diagnostic antiserum may be helpful to select virus-free propagation material in order to achieve sustainable onion production in Sudan. References: (1) Z. Egusquiza et al. New Disease Reports 18:29, 2008. (2) K. V. Kanyuka et al. J. Gen. Virol. 73:2553, 1992. (3) S. Majumder et al. New Disease Reports 15:52, 2007. (4) W. Menzel et al. Arch. Virol. 154:1343, 2009.

Download Full-text

First Report of Tomato spotted wilt virus in Blackberry Lily in North America

Plant Disease ◽

10.1094/pdis.2003.87.1.102c ◽

2003 ◽

Vol 87 (1) ◽

pp. 102-102 ◽

Cited By ~ 3

Author(s):

S. Adkins ◽

L. Breman ◽

C. A. Baker ◽

S. Wilson

Keyword(s):

North America ◽

Tomato Spotted Wilt Virus ◽

Amino Acid Sequences ◽

South Florida ◽

N Gene ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Tomato Spotted Wilt ◽

Wilt Virus

Blackberry lily (Belamcanda chinensis (L.) DC.) is an herbaceous perennial in the Iridaceae characterized by purple-spotted orange flowers followed by persistent clusters of black fruit. In July 2002, virus-like symptoms including chlorotic ringspots and ring patterns were observed on blackberry lily leaves on 2 of 10 plants in a south Florida ornamental demonstration garden. Inclusion body morphology suggested the presence of a Tospovirus. Tomato spotted wilt virus (TSWV) was specifically identified by serological testing using enzyme-linked immunosorbent assay (Agdia, Elkhart, IN). Sequence analysis of a nucleocapsid (N) protein gene fragment amplified by reverse transcription-polymerase chain reaction (RT-PCR) with primers TSWV723 and TSWV722 (1) from total RNA confirmed the diagnosis. Nucleotide and deduced amino acid sequences of a 579 base pair region of the RT-PCR product were 95 to 99% and 95 to 100% identical, respectively, to TSWV N-gene sequences in GenBank. Since these 2-year-old plants were grown on-site from seed, they were likely inoculated by thrips from a nearby source. Together with a previous observation of TSWV in north Florida nursery stock (L. Breman, unpublished), this represents, to our knowledge, the first report of TSWV infection of blackberry lily in North America although TSWV was observed in plants of this species in Japan 25 years ago (2). References: (1) S. Adkins, and E. N. Rosskopf. Plant Dis. 86:1310, 2002. (2) T. Yamamoto and K.-I. Ohata. Bull. Shikoku Agric. Exp. Stn. 30:39, 1977.

Download Full-text

First Report of Grapevine leafroll associated virus-3 in American Vitis spp. Grapevines in Washington State

Plant Disease ◽

10.1094/pd-90-1461a ◽

2006 ◽

Vol 90 (11) ◽

pp. 1461-1461 ◽

Cited By ~ 8

Author(s):

M. J. Soule ◽

K. C. Eastwell ◽

R. A. Naidu

Keyword(s):

New York ◽

Economic Impact ◽

Virus Disease ◽

The United States ◽

Washington State ◽

The State ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Table Grapes

Washington State is the largest producer of juice grapes (Vitis labruscana ‘Concord’ and Vitis labrusca ‘Niagara’) and ranks second in wine grape production in the United States. Grapevine leafroll disease (GLD) is the most wide spread and economically significant virus disease in wine grapes in the state. Previous studies (2) have shown that Grapevine leafroll associated virus-3 (GLRaV-3) is the predominant virus associated with GLD. However, little is known about the incidence and economic impact of GLD on juice and table grapes. Because typical GLD symptoms may not be obvious among these cultivars, the prevalence and economic impact of GLD in Concord and Niagara, the most widely planted cultivars in Washington State, has received little attention from the grape and nursery industries. During the 2005 growing season, 32 samples from three vineyards and one nursery of ‘Concord’ and three samples from one nursery of ‘Niagara’ were collected randomly. Petiole extracts were tested by single-tube reverse transcription-polymerase chain reaction (RT-PCR; 3) with primers LC 1 (5′-CGC TAG GGC TGT GGA AGT ATT-3′) and LC 2 (5′-GTT GTC CCG GGT ACC AGA TAT-3′), specific for the heat shock protein 70 homologue (Hsp70h gene) of GLRaV-3 (GenBank Accession No. AF037268). One ‘Niagara’ nursery sample and eleven ‘Concord’ samples from the three vineyards tested positive for GLRaV-3, producing a single band of the expected size of 546 bp. The ‘Niagara’ and six of the ‘Concord’ RT-PCR products were cloned in pCR2.1 (Invitrogen Corp, Carlsbad, CA) and the sequences (GenBank Accession Nos. DQ780885, DQ780886, DQ780887, DQ780888, DQ780889, DQ780890, and DQ780891) compared with the respective sequence of a New York isolate of GLRaV-3 (GenBank Accession No. AF037268). The analysis revealed that GLRaV-3 isolates from ‘Concord’ and ‘Niagara’ share nucleotide identities of 94 to 98% and amino acid identities and similarities of 97 to 98% with the Hsp70h gene homologue of the New York isolate of GLRaV-3. Additional testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antibodies specific to GLRaV-3 (BIOREBA AG, Reinach, Switzerland) further confirmed these results in the ‘Niagara’ and two of the ‘Concord’ isolates. GLRaV-3 has previously been reported in labrusca cvs. Concord and Niagara in western New York (4) and Canada (1), but to our knowledge, this is the first report of GLRaV-3 in American grapevine species in the Pacific Northwest. Because wine and juice grapes are widely grown in proximity to each other in Washington State and grape mealybug (Pseudococcus maritimus), the putative vector of GLRaV-3, is present in the state vineyards, further studies will focus on the role of American grapevine species in the epidemiology of GLD. References: (1) D. J. MacKenzie et al. Plant Dis. 80:955, 1996. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Rowhani et al. ICGV, Extended Abstracts, 13:148, 2000. (4) W. F. Wilcox et al. Plant Dis. 82:1062, 1998.

Download Full-text

First Report of Garlic common latent virus Infecting Garlic in Sudan

Plant Disease ◽

10.1094/pdis-11-12-1018-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 562-562 ◽

Cited By ~ 1

Author(s):

K. Hamed ◽

W. Menzel ◽

M. E. Mohamed ◽

K. A. Bakheet ◽

S. Winter

Keyword(s):

Sequence Similarity ◽

Total Yield ◽

Latent Virus ◽

Nucleic Acid Binding ◽

Rt Pcr ◽

Terminal Part ◽

Leaf Sample ◽

First Report ◽

Garlic Common Latent Virus ◽

The Impact

Garlic (Allium sativum L.) is one of the most important vegetable field crops in Sudan, cultivated on an area of more than 6,000 ha with a total yield of 27,000 t in 2010 (faostat.fao.org). As part of a project which started in 2010 to improve the garlic production in Sudan, samples from local varieties showing severe mosaic and/or mottling were collected in winter 2011 from the main production areas in River Nile State, Northern State, and Darfur State. The plant material used for garlic production came from Sudan and was not imported. Because no reliable data were available on which viruses occur in garlic in Sudan, specific tests were initially omitted. In order to get an overview of the viruses present, dsRNA was prepared of a mixed leaf sample (12 leaves of different samples). This resulted in a high molecular weight dsRNA of approximately 9 kbp that served as template for a random RT-PCR followed by cloning and sequencing (3). Three identical clones originating from one PCR product covering the C-terminal part of the coat protein to the N-terminal part of the nucleic acid binding protein showed the highest sequence similarity to Garlic common latent virus (GarCLV). The nucleotide sequence identities of the 554-bp insert range from 85% to an isolate from India (Accession No. FJ154841) up to 97% to a GarCLV isolate from The Netherlands (AB004804), identifying the virus as a Sudanese isolate of GarCLV, one of the most common garlic infecting viruses. GarCLV belongs to the genus Carlavirus (1) and has previously been reported from Asia, Europe, and South America ( http://sdb.im.ac.cn/vide/descr352.htm ). In order to confirm these results, a double antibody sandwich (DAS)-ELISA was performed with six individual garlic samples in which five samples showed a clear reaction with a GarCLV specific antiserum (AS-0230, DSMZ, Germany). The occurrence of GarCLV could be further confirmed for the ELISA positive samples by a specific RT-PCR using the primers published by Majumder and Baranwal (2). Fragments of the expected size were obtained for all five samples. In addition, one of the positive samples was examined by electron microscopy (Dr. K. Richert-Pöggeler, JKI Braunschweig); filamentous flexous particles typical for carlaviruses could be observed. The random RT-PCR sequence obtained in this study has been submitted to GenBank (KC013030). To our knowledge, this is the first report of GarCLV in garlic in Sudan and Africa. The impact of GarCLV on garlic production in Sudan needs to be evaluated, but the awareness of the occurrence of the virus and the availability of a reliable diagnostic tool will help to select virus-free propagation material. This will form the basis for a sustainable garlic production. References: (1) A. M. Q. King et al. Virus Taxonomy 924, 2012. (2) S. Majumder and V. K. Baranwal. Plant Dis. 93:106, 2009. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009.

Download Full-text

First Report of Cucurbit aphid-borne yellows virus in Iran Causing Yellows on Four Cucurbit Crops

Plant Disease ◽

10.1094/pd-90-0526a ◽

2006 ◽

Vol 90 (4) ◽

pp. 526-526 ◽

Cited By ~ 7

Author(s):

K. Bananej ◽

C. Desbiez ◽

C. Wipf-Scheibel ◽

I. Vahdat ◽

A. Kheyr-Pour ◽

...

Keyword(s):

Citrullus Lanatus ◽

Healthy Plant ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Chain Reactions ◽

Reference Isolate ◽

Sigma Chemical ◽

International Mycological Institute ◽

Das Elisa

A survey was conducted from 2001 to 2004 in the major cucurbit-growing areas in Iran to reassess the relative incidence of cucurbit viruses. Severe yellowing symptoms were observed frequently on older leaves of cucurbit plants in various regions in outdoor crops, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae) (1,2). Leaf samples (n = 1019) were collected from plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita sp.), and watermelon (Citrullus lanatus L.) showing various virus-like symptoms (mosaic, leaf deformation, yellowing). All samples, collected from 15 provinces, were screened for the presence of CABYV by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with IgGs and alkaline phosphatase-conjugated IgGs against a CABYV reference isolate (1). Of the 1,019 samples tested, 471 were positive for CABYV using DAS-ELISA. Some of the positive samples had typical severe yellowing symptoms while symptoms in other samples were masked by mosaic or leaf deformations caused by other viruses frequently found in mixed infections (data not shown). During the entire survey, CABYV was detected by DAS-ELISA in 201 of 503 melon samples, 72 of 129 cucumber samples, 158 of 249 squash samples, and 40 of 138 watermelon samples. These results indicate that CABYV is widely distributed on four cucurbit species in the major growing areas of Iran. In order to confirm CABYV identification, total RNA extracts (TRI-Reagent, Sigma Chemical, St Louis, MO) were obtained from 25 samples that were positive using DAS-ELISA originating from Khorasan (n = 4), Esfahan (n = 6), Teheran (n = 3), Hormozgan (n = 4), Azerbaiejan-E-Sharqi (n = 4), and Kerman (n = 4). Reverse transcription-polymerase chain reactions (RT-PCR) were carried out using forward (5′-CGCGTGGTTGTGG-TCAACCC-3′) and reverse (5′-CCYGCAACCGAGGAAGATCC-3′) primers designed in conserved regions of the coat protein gene according to the sequence of a CABYV reference isolate (3) and three other unpublished CABYV sequences. RT-PCR experiments yielded an expected 479-bp product similar to the fragment amplified with extracts from the reference isolate. No amplification of the product occurred from healthy plant extracts. To our knowledge, this is the first report of the occurrence of CABYV in Iran on various cucurbit species. The high frequency (46.2%) with which CABYV was detected in the samples assayed indicates that this virus is one of the most common virus infecting cucurbits in Iran. References: (1) H. Lecoq et al. Plant Pathol. 41:749, 1992 (2) M. A. Mayo and C. J. D'Arcy. Page 15 in: The Luteoviridae. H. G. Smith and H. Barker, eds. CAB International Mycological Institute, Wallingford, UK, 1999. (3) H. Guilley et al. Virology 202:1012, 1994.

Download Full-text

First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-21-1065-pdn ◽

2021 ◽

Author(s):

Ahmed Sabra ◽

Mohammed Ali Al Saleh ◽

I. M. Alshahwan ◽

Mahmoud A. Amer

Keyword(s):

Saudi Arabia ◽

Mosaic Virus ◽

Solanum Lycopersicum ◽

Tomato Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Pcr Products ◽

Dark Green ◽

Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Download Full-text

First Report of Beet necrotic yellow vein virus Infecting Spinach in California

Plant Disease ◽

10.1094/pdis-94-5-0640a ◽

2010 ◽

Vol 94 (5) ◽

pp. 640-640 ◽

Cited By ~ 4

Author(s):

H.-Y. Liu ◽

B. Mou ◽

K. Richardson ◽

S. T. Koike

Keyword(s):

Spinacia Oleracea ◽

Sandwich Elisa ◽

Chenopodium Quinoa ◽

Yellow Vein ◽

Mechanical Transmission ◽

Polymyxa Betae ◽

Rt Pcr ◽

First Report ◽

Vein Clearing ◽

Rigid Rod

In 2009, plants from two spinach (Spinacia oleracea) experimental fields in Monterey County and one commercial spinach field in Ventura County of California exhibited vein-clearing, mottling, interveinal yellowing, and stunting symptoms. For experimental fields, up to 44% of spinach plants have symptoms. With a transmission electron microscope, rigid rod-shaped particles with central canals were observed from plant sap of the symptomatic spinach. Analysis with a double-antibody sandwich-ELISA assay for Beet necrotic yellow vein virus (BNYVV) showed that all 10 symptomatic plants we tested were positive and 5 asymptomatic plants were negative. Symptomatic spinach from both counties was used for mechanical transmission experiments. Chenopodium quinoa, Tetragonia expansa, and Beta vulgaris (sugar beet) showed chlorotic local lesions and B. macrocarpa and spinach showed vein-clearing, mottling, and systemic infections. To further confirm the presence of BNYVV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from field- and mechanically inoculated symptomatic spinach plants using an RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR. Forward and reverse primers specific to the BNYVV RNA-3 P25 protein gene from the beet isolate were used (2). Amplicons of the expected size (approximately 860 bp) were obtained. Four RT-PCR products were sequenced and the sequences were identical (GenBank Accession No. GU135626). Sequences from the spinach plants had 97 to 99% nucleotide and 94 to 100% amino acid identity with BNYVV RNA-3 P25 protein sequences available in the GenBank. On the basis of the data from electron microscopy, indicator plants, serology, and cDNA sequencing, the virus was identified as BNYVV. BNYVV has been reported from spinach fields in Italy (1). To our knowledge, this is the first report of BNYVV occurring naturally on spinach in California. Since BNYVV is transmitted by the zoospores of the soil-inhabiting plasmodiophorid Polymyxa betae, it could be a new threat to spinach production in the state. References: (1) C. R. Autonell et al. Inf. Fitopatol. 45:43, 1995. (2) H.-Y. Liu and R. T. Lewellen, Plant Dis. 91:847, 2007.

Download Full-text