scholarly journals First Report of Xanthomonas campestris pv. campestris as the Causal Agent of Black Rot on Oilseed Rape (Brassica napus) in Serbia

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 418-418 ◽  
Author(s):  
T. Popović ◽  
J. Balaž ◽  
M. Starović ◽  
N. Trkulja ◽  
Ž. Ivanović ◽  
...  
Keyword(s):  
Oilseed Rape ◽  
Xanthomonas Campestris ◽  
Reference Strain ◽  
Positive Control ◽  
Control Treatment ◽  
Bacterial Suspension ◽  
Bacterial Strains ◽  
16S Rdna Sequence ◽  
Plastic Bags ◽  
Xanthomonas Campestris Pv Campestris

In September 2010, leaves of oilseed rape (Brassica napus L.) with v-shaped, necrotic lesions on the leaf margins surrounded by yellow halos were collected. Symptoms were observed on the domestic cultivar Slavica (IFVC, Novi Sad) located in the Bačka region, Vojvodina, Serbia, from a 3-ha field. Average disease incidence on 3-month-old plants was 45% (15 to 75%). Diseased leaves were rinsed in sterilized distilled water (SDW) and dried at room temperature for isolations. Leaf sections taken from the margin of necrotic leaf tissue were macerated in SDW and the extract was streaked onto yeast extract-dextrose-calcium carbonate (YDC) agar. Plates were incubated at 28°C for 3 days. Colonies were yellow, translucent, circular, and raised. Ten representative strains tested further were all gram-negative, catalase-positive, and oxidase-negative. The partial 16S rDNA sequence of a representative strain, TUr1, was amplified using primers fD1 and rD1 (2), and determined using the IMGGI SeqService facility in Belgrade. The 1,510-bp 16S rDNA sequence of TUr1 was compared to that of known strains in the NCBI GenBank database, and showed greatest similarity with that of Xanthomonas campestris pv. campestris (Xcc) strains ATCC 33913 and B100 (99% homology). Pathogenicity of 10 strains grown for 48 h on YDC at 28°C was completed using each of three methods: spraying a bacterial suspension (108 cfu/ml) onto the leaf surfaces of oilseed rape plants, stabbing the major veins of each of the first two true leaves with the tip of a sterile toothpick that had been dipped into a colony of the appropriate strain, and immersing cotyledons of the plants into a bacterial suspension (108 cfu/ml). All three tests were performed on 4-week-old oilseed rape plants of the cultivar Slavica. SDW was used for the negative control treatment for each method of inoculation. Reference strain Xcc NCPPB 1144 was used as a positive control treatment. Tests plants (two for each method of inoculation and each bacterial strain or control treatment) were maintained in a greenhouse at 25 ± 1°C and 80% relative humidity by keeping the plants in plastic bags. Two control plants for each of the negative and positive control treatments for each inoculation method were also enclosed in separate plastic bags. The bacterial strains and reference strain caused yellow lesions on inoculated plants that turned necrotic starting about 7 days after inoculation (DAI). The spots coalesced within 21 DAI to form necrotic areas. Plants inoculated with SDW remained symptomless. Reisolations were done onto YDC as described above. Reisolated strains showed the same colony morphology as described above. The bacterial strains grew at 35°C; produced levan from sucrose, hydrogen sulfide, and indole; did not reduce nitrate; hydrolyzed Tween 80; starch, gelatin, and aesculin; did not show tolerance to 0.10 and 0.02% triphenyl-tetrazolium chloride; and produced acid from d-arabinose, arginine, dulcitol, galactose, d-glucose, maltose, mannose, sorbitol, sucrose, and xylose (1). All strains tested by Plate Trapped Antigen-ELISAs (ADGEN Phytodiagnostics, Neogen Europe Ltd., Scotland) reacted with Xcc-specific polyclonal antibodies. Based on these tests, the strains were identified as Xcc. To our knowledge, this is the first report of this pathogen causing black rot of oilseed rape in Serbia. References: (1) T. B. Adhikariand and R. Basnyat. Eur. J. Plant Pathol. 105:303, 1999. (2) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Black Rot on Arugula Caused by Xanthomonas campestris pv. campestris in Argentina

Plant Disease ◽  
2008 ◽  
Vol 92 (6) ◽  
pp. 980-980 ◽  
Author(s):  
A. M. Romero ◽  
R. Zapata ◽  
M. S. Montecchia
Keyword(s):  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Biochemical Characterization ◽  
Bacterial Suspension ◽  
Black Rot ◽  
Strictly Aerobic ◽  
First Report ◽  
Plastic Bags ◽  
Water Plants ◽  
Xanthomonas Campestris Pv Campestris

During the fall of 2005, arugula (Eruca sativa Mill.) plants grown in experimental field plots in Buenos Aires, Argentina presented V-shaped necrotic lesions on leaf margins and blackened veins with broad yellow halos, followed by leaf necrosis. At flowering, 96% of the plants were affected with 27% of the leaves with symptoms. Yellow, round, mucoid, convex, bacterial colonies were isolated from several leaves on yeast dextrose chalk agar. Two strains were further studied. Xanthomonas campestris pv. campestris Xcc8004 was used as a control. Strains were gram negative, rod shaped, strictly aerobic, catalase-positive, oxidase and urease-negative, hydrolyzed starch, gelatine and aesculin, and did not reduce nitrate (2). Pathogenicity was tested by spraying 10 3-week-old arugula plants with either a bacterial suspension (107 CFU/ml) or sterile water. Plants were placed in plastic bags for 72 h after inoculation. All inoculated plants showed necrotic lesions enlarging from the margin of the leaves 7 days after inoculation. No lesions were observed on control plants. On the basis of biochemical characterization (2) and genomic fingerprints generated by BOX-PCR (1), the pathogen was identified as X. campestris pv. campestris. To our knowledge, this is the first report of X. campestris pv. campestris causing black rot on arugula in Argentina. References: (1) J. L. Rademaker et al. Int. J. Syst. Evol. Microbiol. 50:665, 2000. (2) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001.

scholarly journals First Report of Dickeya dianthicola Causing Blackleg on Potato (Solanum tuberosum) in Bulgaria

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 275-275 ◽  
Author(s):  
S. G. Bobev ◽  
J. Van Vaerenbergh ◽  
M. Maes
Keyword(s):  
Solanum Tuberosum ◽  
Phosphate Buffer ◽  
Reference Strain ◽  
Pectate Lyase ◽  
Positive Control ◽  
Negative Control ◽  
Tuber Initiation ◽  
Bacterial Suspension ◽  
Bacterial Strains ◽  
First Report

Potato (Solanum tuberosum) is an important and widespread crop in Bulgaria. A new disease was observed on a single potato plot (Plovdiv region) without a history of potato cultivation in the spring of 2011. Initially, single lower leaves wilted on recently emerged plants (approx. 15% incidence) with subsequent desiccation of the leaf margins. The wilting progressed over time and eventually the whole stem became desiccated. A blackleg-like necrosis was noticed at the stem base when symptomatic plants were uprooted. Most diseased stems remained green above ground but pith tissue was heavily macerated and some of the stems became hollow as the pith dried out. Mother tubers were partially or entirely macerated. In most cases, the decay was initiated from the stolon end. Bacterial strains were obtained from symptomatic stems and tubers by dilution plating on King's B medium. The strains produced indigoidin pigment and induced a hypersensitive response 24 h after infiltration into tobacco and Sedum hybridum leaves (2). The strains were identified as Dickeya spp. by the production of the PCR amplicon of the pectate lyase ADE gene cluster (3) and of the pectate lyase I gene (4). The partial sequence of the fliC PCR amplicon (1) of strain SB2589 (GenBank Accession No. KF442436) displayed 100% homology with four whole genome shotgun sequences of Dickeya dianthicola in GenBank. Pectinolytic activity was demonstrated by inoculation of surface disinfested potato tubers of cv. Kondor. Conical core tissue was removed at the apical end and 100 μl bacterial suspension (107 CFU in sterile 10 mM phosphate buffer) was deposited in the cavity. The cap was reattached to the tuber and immobilized by Parafilm. Positive control tubers were inoculated with D. dianthicola reference strain GBBC 2039 (LMG 25864) and negative control tubers were inoculated with sterile 10 mM phosphate buffer. All tubers were incubated for 48 h at 28°C under micro-aerobic conditions reducing the air pressure to 90 mb in a vacuum incubator. The D. dianthicola reference strain and Bulgarian strains produced maceration of tuber tissue. Maceration was not observed in the negative control tubers. Potato plants cv. Kondor were grown from minitubers in sandy soil in plastic nursery containers. The plants were inoculated by root drenching (one application of cell suspension at 109 CFU/liter) when the stems were 15 to 20 cm high (tuber initiation stage). Plants were incubated at 25 to 28°C with regular watering. Wilting symptoms developed within 10 days of inoculation, followed by necrosis of the pith. Strains obtained from the inoculated stems were confirmed as D. dianthicola as described above. Based on the disease symptoms, the cultural, molecular, and pathological features of the strains, we conclude that the disease was caused by D. dianthicola and to our knowledge this is the first report of the pathogen on potato in Bulgaria. Furthermore, this incident warrants further surveys of pectinolytic bacteria causing blackleg-like symptoms in potato crops in Bulgaria. References: (1) S. Diallo et al. Eur. J. Plant Pathol. 125:349, 2009. (2) Y-.A. Lee and C-.P. Yu. J. Microbiol. Methods 64:200, 2006. (3) A. Nassar et al. Appl. Environ. Microbiol. 62:2228, 1996. (4) J. Van Vaerenbergh et al. PLoS ONE 7(5):e35738, 2012.

scholarly journals Phenotypic and genotypic characterization of Xanthomonas campestris strains isolated from cabbage, kale and broccoli

2013 ◽  
Vol 65 (2) ◽  
pp. 585-593 ◽  
Author(s):  
Tatjana Popovic ◽  
Dragana Josic ◽  
Mira Starovic ◽  
P. Milovanovic ◽  
N. Dolovac ◽  
...  
Keyword(s):  
16S Rdna ◽  
Xanthomonas Campestris ◽  
Reference Strain ◽  
Tween 80 ◽  
Genotypic Characterization ◽  
Hypodermic Syringe ◽  
Xanthomonas Campestris Pv Campestris ◽  
Reference Strains ◽  
Phenotypic And Genotypic Characterization

Thirty-six strains of Xanthomonas campestris pv. campestris (Xcc) isolated from cabbage, kale and broccoli were identified according to their pathogenicity, phenotypic and genotypic characterization. Pathogenicity was confirmed by the injection method with a hypodermic syringe into the mesophilic tissue of cabbage leaves. All strains were Gramnegative, aerobic, catalase-positive, oxidase-negative, grew at 35?C, produced levan, H2S and indole, did not reduce nitrate, hydrolyzed Tween 80, starch, gelatin and esculin and did not show tolerance to 0.1 and 0.02% TTC. The strains produced acid from d-arabinose, arginine, dulcitol, galactose, d-glucose, maltose, mannose, sorbitol, sucrose and xylose. The genetic characterization was based on the sequence analyses of 16S rDNA and ERIC and BOX PCR. Strains of different pathovars were also used to compare PCR resulting patterns. BOX-PCR of the strains from kale and broccoli, obtained using (GTG)5 primer, yielded patterns with a high similarity level to pathovar reference strain Xcc. The strains from cabbage yielded BOX and ERIC product patterns, distinguishing them from the other tested strains and reference strains. 16S rDNA of the representative strains was closely related to Xcc strain ATCC 33913. ERIC PCR and BOX using (GTG)5 primer generated different Xcc patterns and were effective in distinguishing strains from different plant hosts.

New insights into the genetic diversity of Xanthomonas campestris pv. campestris isolates from winter oilseed rape in Serbia

2020 ◽  
Vol 70 (1) ◽  
pp. 35-49
Author(s):  
Aleksandra Jelušić ◽  
Tanja Berić ◽  
Petar Mitrović ◽  
Ivica Dimkić ◽  
Slaviša Stanković ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Oilseed Rape ◽  
Xanthomonas Campestris ◽  
Winter Oilseed Rape ◽  
Xanthomonas Campestris Pv Campestris

scholarly journals Entry of Xanthomonas campestris pv. campestris into Hydathodes of Arabidopsis thaliana Leaves: A System for Studying Early Infection Events in Bacterial Pathogenesis

1998 ◽  
Vol 11 (6) ◽  
pp. 537-543 ◽  
Author(s):  
Véronique Hugouvieux ◽  
Christine E. Barber ◽  
Michael J. Daniels
Keyword(s):  
Arabidopsis Thaliana ◽  
Xanthomonas Campestris ◽  
Histochemical Staining ◽  
Bacterial Suspension ◽  
Surface Sterilization ◽  
Rapid Induction ◽  
Detached Leaves ◽  
Viable Bacteria ◽  
Portal Of Entry ◽  
Xanthomonas Campestris Pv Campestris

Xanthomonas campestris pv. campestris (Xcc) is a vascular pathogen of cruciferous plants that normally gains entry to plants via hydathodes. In order to study the basis of the preference for this portal of entry we have developed an Arabidopsis thaliana model with attached or detached leaves partially immersed in a bacterial suspension. Entry of bacteria into leaves, assessed by resistance to surface sterilization, could be detected after 1 h. Dissection of leaves and histochemical staining for β-glucuronidase produced by the bacteria indicated that they were located in hydathodes. In contrast, similar experiments with the leaf-spotting pathogen X. campestris pv. armoraciae gave patterns of localized staining dispersed over the leaf area, indicative of entry through stomata. A survey of 41 A. thaliana accessions showed that they fell into three classes distinguishable by total numbers of Xcc that entered under standard conditions and by preference for hydathode colonization. Previously isolated Xcc mutants affected in pathogenicity were tested for hydathode colonization: an hrp mutant behaved indistinguishably from the wild type, and rpf regulatory mutants gave 10-fold reduced colonization, whereas with rfaX mutants with altered lipopolysaccharide, few if any viable bacteria were recoverable from hydathodes. This fact, together with the rapid induction of superoxide dismutase in the bacteria located in hydathodes, suggests that an early defense reaction is mounted in the hydathode.

scholarly journals First Report of Xanthomonas campestris pv. campestris Causing Marginal Leaf Necrosis of Arugula (Eruca vesicaria subsp. sativa) in Serbia

Plant Disease ◽  
2021 ◽  
Author(s):  
Andjelka Prokić ◽  
Tamara Marković ◽  
Jelena Menković ◽  
Milan Ivanovic ◽  
Aleksa Obradoviċ
Keyword(s):  
Xanthomonas Campestris ◽  
Disease Incidence ◽  
Positive Control ◽  
Negative Control ◽  
Accurate Information ◽  
Strictly Aerobic ◽  
Distilled Water ◽  
Tetrazolium Chloride ◽  
First Report ◽  
Xanthomonas Campestris Pv Campestris

Arugula (Eruca vesicaria subsp. sativa (Miller) Thell., syn. Brassica eruca L.), is an annual cruciferous crop that is increasingly grown for fresh consumption in Serbia. In November 2018, a few detached leaves of cultivated arugula originating from a local producer, showing necrotic lesions, were observed in a fresh vegetable market in Belgrade, Serbia. Information about the disease incidence and severity was not available. Intensity of the observed symptoms was low, but it could be a consequence of the produce quality selection for the market. The leaves developed irregular chlorotic lesions starting from the leaf edge, and tissue within some of them turned dark brown and necrotic (Fig. 1a). From the lesions on different leaves, smooth, bright yellow pigmented, round and opalescent bacterial colonies were isolated on nutrient agar (NA) medium after 72 h of incubation at 26°C. Six bacterial isolates, obtained from three leaf subsamples which induced hypersensitive reaction in tobacco leaves (Nicotiana tabacum L. cv. Samsun), were selected for further studies. On yeast - dextrose – CaCO3 medium, the strains formed characteristic creamy yellow, mucoid, opaque and convex colonies. All isolates were Gram-negative, strictly aerobic, non-fluorescent and catalase positive, did not produce oxidase nor arginine dehydrolase, and did not show pectynolitic activity on potato tuber slices. They hydrolyzed starch, gelatine and esculin, used glucose and sucrose, but not arabinose as a carbon source, and did not reduce nitrates. They grew at 36°C, and tolerated 5% NaCl and 0.02% triphenyl-tetrazolium chloride (Lelliott and Stead, 1987). These growth characteristics were similar as for the reference Xanthomonas campestris pv. campestris (Xcc) strain KFB 105, used in all tests as a positive control (Obradović et al., 2000). The isolates were further characterized by polymerase chain reaction (PCR) using primers DLH120/DLH125, specific for the hrpF gene region of X. campestris according to Berg et al. (2005). Specific DNA fragment of 619 bp was amplified for all tested isolates. Amplification and partial sequencing of the gyrB gene of four isolates was performed using set of primers described by Parkinson et al. (2007). All obtained partial gyrB sequences were identical to each other. According to BLAST analysis (GenBank Acc. Nos. MW508894 - MW508897) they shared 100% of sequence identity with different Xcc strains and 99.5 % with the X.c. pv. raphani pathotype strain, deposited in the NCBI GenBank database. Pathogenicity of the isolates was tested by spraying leaves of 3-week old E. sativa seedlings grown in a commercial potting mix in a greenhouse, with a 24 h-old bacterial culture suspended in sterile distilled water (107 CFU/ml). Xcc strain KFB 105 was used as positive and sterile distilled water as negative control. Inoculated plants were incubated under plastic bags for 48 h and further maintained in a greenhouse at approx. 28°C. On inoculated plants, chlorotic lesions, spreading from the leaf margins, further coalescing into irregular, V-shaped tissue necrosis associated with blackening of veins, developed up to two weeks after inoculation (Fig. 1b, c). The colonies reisolated from symptomatic leaves were identified using PCR, as described above. Based on studied characteristics, all six isolates associated with arugula leaf lesions in Serbia belong to a clonal population. They were identified as X. campestris pv. campestris, the causal agent of black rot, a major disease affecting crucifers, including arugula worldwide (Romero et al., 2008; Rosenthal, et al., 2018). So far, it has been described on Brassica oleracea and B. napus in Serbia (Obradović et al., 2001; Popović et al., 2019). This is the first report of Xcc infecting arugula in this country. The severity of the symptoms developed on artificially inoculated plants indicated significant potential of the pathogen to affect arugula crop in conditions favoring infection. Being a minor crop, accurate information about severity of arugula diseases in Serbia is not available. Lack of crop rotation and close proximity of other Xcc host species on a farm could contribute to further spreading of this problem. Follow up of this arugula disease should reveal the distribution, population structure and genetic diversity of Xcc strains affecting this crop in Serbia.

scholarly journals Outbreak of Bacterial Spot (Xanthomonas cucurbitae) in Pumpkin Fields in Illinois

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1222-1222 ◽  
Author(s):  
M. Babadoost ◽  
A. Ravanlou
Keyword(s):  
Luria Broth ◽  
Positive Control ◽  
Negative Control ◽  
Control Treatment ◽  
Bacterial Suspension ◽  
Bacterial Spot ◽  
Pcr Assay ◽  
Species Identity ◽  
Koch’S Postulates ◽  
Koch's Postulates

About 10,000 ha of pumpkins [Cucurbita pepo L. and Cucurbita moschata (Duchesne) Duchesne ex Poir] are produced annually in Illinois. In 2010 and 2011, severe leaf and fruit symptoms typical of bacterial spot caused by Xanthomonas cucurbitae (ex Bryan) Vauterin et al. were observed in pumpkin fields in Illinois, resulting in estimated yield losses of 3 to 90%. Leaf infection was observed from the time of spreading vines until harvest, and infection of fruit occurred from when fruit weights were 0.25 kg until harvest. Leaves had small (2 to 4 mm), angular, yellow spots (1). Fruit had small (1 to 3 mm in diameter), slightly sunken, circular spots, each with a beige center and dark brown halo (1). A survey in 2010 showed that bacterial spot occurred in 40 of 50 pumpkin fields with symptoms on 3 to 94% of fruit in a field (average 34%). A survey in 2011 showed fruit with bacterial spot symptoms in 57 of 65 pumpkin fields, with lesions on 3 to 87% of the fruit in a field (average 24%). Six to twelve symptomatic pumpkins were collected from each field, and X. cucurbitae was isolated from the fruit by surface-disinfesting an area of the fruit with lesions with paper tissue soaked in 95% ethanol. One or two lesions/fruit were cut out with a sterile blade, inserted into an eppendorf tube containing 1 ml of sterile distilled water (SDW), the tubes shaken manually, and a loopful of the bacterial suspension from each tube streaked onto nutrient agar (NA). The plates were incubated at 24°C for 3 to 4 days. Single colonies of each of the isolated bacterium were prepared by streaking isolated colonies onto additional plates of NA and selecting well-separated colonies. The colonies were identified as X. cucurbitae by culturing on yeast extract-dextrose–CaCO3 (YDC) agar, on which xanthomonas-like yellow colonies with mucoid growth developed. The isolates were gram-negative, O+ and F– in the oxidative and fermentative test, oxidase negative, and motile. The isolates hydrolyzed starch and esculin, but did not hydrolyze nitrate, and grew on YDC agar at 33°C. Confirmation of the species identity was achieved using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay (2), which produced a 1,500-bp band. Koch's postulates were carried out for 40 isolates of X. cucurbitae from 40 different fields on pumpkin cv. Howden in a greenhouse. Koch's postulates for five of the isolates were also conducted in a field. Bacterial inoculum was cultured on Luria Broth agar medium and a suspension of 108 cfu/ml prepared in SDW. Pumpkin leaves and fruit were spray-inoculated. In the greenhouse test, each isolate was inoculated onto five leaves of each of four plants. In the field, each isolate was inoculated onto 10 leaves and one fruit of each of 10 plants. A positive control treatment consisted of inoculating pumpkin leaves and fruit with a known X. cucurbitae isolate. A negative control treatment entailed using SDW for inoculation. Lesions developed on leaves and fruit of plants inoculated with the positive control and suspected X. cucurbitae isolates. X. cucurbitae was reisolated from symptomatic leaves and fruit and identified by culturing on YDC agar, and using the PCR assay. No symptoms developed on leaves or fruit sprayed with SDW, and attempts to isolate X. cucurbitae from these plants did not result in development of any bacterial colonies. References: (1) Babadoost et al. Univ. of Illinois Extension C1392, 2004. (2) Leite et al. Appl. Environ. Microbiol. 60:1068, 1994.

scholarly journals Influence of Xanthomonas campestris pv. campestris on the growth of etiolated and photosynthetic seedlings of Brassica oleracea

2019 ◽  
pp. 133-140
Author(s):  
A. A. Ushakov ◽  
E. G. Kozar ◽  
I. A. Engalycheva
Keyword(s):  
Xanthomonas Campestris ◽  
Plant Protection ◽  
Biological Effects ◽  
Federal State ◽  
Bacterial Suspension ◽  
Hypocotyl Growth ◽  
F1 Hybrid ◽  
White Cabbage ◽  
Etiolated Seedlings ◽  
Xanthomonas Campestris Pv Campestris

Relevance. In recent years, physiologists are very interested in studying the characteristics of the growth and development of seedlings under conditions of etiolation. Etiolated seedlings, as a model object, are interesting in studying the responses of a plant organism to the effects of various biotic environmental factors. In this regard, a comprehensive study of the characteristics of the influence of Xanthomonas campestris pv. campestris (Хсс) on growth processes in the early stages of development of white cabbage plants, depending on the racial composition of the pathogen, is very important.Material and method. The study was carried out on the basis of the immunity and plant protection laboratory of the Federal State Budgetary Scientific Institution of the Federal Scientific Vegetable Center (FSVC). The material of research were seeds of two varieties of white cabbage with different resistance to vascular bacteriosis and four races of Xanthomonas campestris pv. campestris (Хсс1, Хсс3, Хсс4 и Хсс6). Sterile seeds of each variety were laid out in Petri cups. Infection with different races of Xcc was carried out by introducing into each Petri cup 1 ml of a bacterial suspension of a two-day culture at a concentration of 106 cells/ml. Half of the Petri cups were placed in a thermostat without illumination, the other was exposed to light under a 16- hour regime of illumination with diffused light. The magnitude and orientation of biological effects of studied factors on biometric parameters of seedlings were evaluated by the relative deviation of the difference between parameters of the experimental and control variants.Results. A different degree of influence of the resistance of the variety and the aggressiveness of the pathogen race on the growth of individual parts of the seedling has been established, and the response of etiolated and photosynthetic seedlings to infection is often the opposite. In the susceptible cultivar Slava 1305, acceleration of root and hypocotyl growth in the dark (Хсс3, Хсс4 and Хсс1) and inhibition of these processes in the light (Хсс1, Хсс4 and Хсс6) were noted. Relatively stable SB-3 F1 hybrid has more pronounced raspecificity of the effect of Xcc on root growth and stimulation of hypocotyl growth in all variants, which was 2-8 times lower in etiolated seedlings when infected with Xcc6 and Xcc1 races than in light ones, and when infected by the races Xcc1 and Xcc4, the effect was comparable. 

Sign in / Sign up

Export Citation Format

Share Document