First Report of Post-Harvest Gray Mold on Hyacinth bean (Lablab purpureus) Caused by Botrytis cinerea in Korea

Hyacinth bean (Lablab purpureus L.) is a highly proteineous legume under the family Fabaceae. It is native to Africa, cultivated throughout the world, and recently introduced vegetable in Korea. In April 2020, approximately 10 to 15% of the total harvested pods showed gray mold rot symptoms after 3–5 days of storage at 4 °C in Jeonju, Jeonbuk province, Korea. The symptoms observed were irregular, water-soaked spots become brown or gray with white hyphae were appeared on the infected pods. Diseased tissue was excised, and surface sterilized by immersing in 1% sodium hypochlorite (NaOCl) for 1 min, rinsed three times with sterilized distilled water, placed on potato dextrose agar (PDA) plates, and incubated at 20 ± 2°C for 7 days. A total of five morphologically similar fungal isolates (HBGM001 to HBGM005) were obtained from diseased samples; isolate HBGM002 and HBGM005 were selected for identification. The fungus produced initially white colonies, after 7 days it changes to gray to dark colonies with dark mycelium that sporulated abundantly on PDA at 20ºC. The conidia (n = 50) were single-celled, ellipsoid or ovoid in shape, and 6.11 to 13.9 × 4.8 to 9.4 μm in size for HBGM001 isolate and 5.81 to 14.1× 4.5 to 9.6 μm in size for HBGM005. Conidiophores (n = 15) arose solitary or in groups, straight or flexuous, septate, with an inflated basal cell brown to light brown, and measured 103 to 420× 7 to 25 μm for HBGM001 isolate and 101 to 415 × 5 to 23 μm for HBGM005 isolate. After two weeks, the fungus formed several black sclerotia (n = 20) ranging from 0.5 to 4.2 × 0.5 to 3.4 mm for HBGM001 isolate and 0.4 to 4.4 × 0.3 to 3.3 mm for HBGM005 isolate near the edge of the Petri dish. Morphological characters were consistent with those of Botrytis cinerea Pers.: Fr. (Ellis 1971). As for molecular identification, the internal transcribed spacer (ITS) and three nuclear protein-coding genes (glyceraldehydes-3-phosphate dehydrogenase gene [G3PDH], heat-shock protein 60 gene [HSP60], and DNA-dependent RNA polymerase subunit gene [RPB2]) were amplified using primer pairs ITS1/ITS4 (White et al. 1990), G3PDH-F/G3PDH-R, HSP60-F/HSP60-R, and RPB2-F/RPB2-R (Staats et al. 2005), respectively. The ITS, G3PDH, HSP60, and RPB2 sequences of HBGM002 and HBGM005 isolates (GenBank accession number MT439648 and MT968495 for ITS; MT439649 and MT968496 for G3PDH; MT439650 and MT968497 for HSP60; MT439651 and MT968498 for RPB2 respectively) were 99% to 100% identical to those of B. cinerea (KY364366, KF015583, KJ018758, and KJ018756, respectively). To determine pathogenicity, five disinfected pods were pinpricked (3 sites per pod) with sterile needles and 50 µl of conidial suspension (1 × 105 conidia/ml) was inoculated by pipetting into the wounds. An analogous five pods, serving as controls, were inoculated with sterile distilled water. All the pods were placed in a growth chamber and maintained a temperature of 20±2ºC and a relative humidity >80%. After 5 days, gray mold symptoms developed on the inoculated pods, whereas no symptoms appeared on control pods. The pathogen was re-isolated from the inoculated pods, fulfilling Koch’s postulates. B. cinerea has been reported causing gray mold in Hyacinth bean in China, Taiwan and India (Farr and Rossman 2021). To our knowledge, this is the first report of B. cinerea causing post-harvest gray mold on hyacinth bean in Korea. The disease could represent a threat for hyacinth bean post-harvest and storage and management strategies should be investigated and applied.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Gray Mold of Blackberry Caused by Botrytis cinerea in South Carolina

Plant Disease ◽

10.1094/pdis-06-11-0530 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1592-1592 ◽

Cited By ~ 1

Author(s):

X. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Signs And Symptoms ◽

Gray Mold ◽

Fluorescent Light ◽

Its2 Region ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

First Report ◽

Control Fruit

Botrytis cinerea Pers.: Fr. is a causal agent of gray mold of blackberry but may also affect grapevine, tomato, bulb flowers, and ornamental crops (2). In August 2010, blackberries (Rubus fruticosus and other species) showing gray mold symptoms were found in Longcreek, Six Mile, and Cheddar, SC. Symptomatic blackberry fruit exhibited patterns of brown-to-gray mycelia and conidiophores. Upon isolation, the mycelium grew at a rate of 12.3 mm per day at 22°C on potato dextrose agar, forming pale white-to-gray colonies with concentric rings and conidiophores (less than 12 h of fluorescent light per day). Some isolates formed dark brown sclerotia in the dark after 18 days. The lemon-shaped spores averaged 12 × 9 μm and were consistent with descriptions of B. cinerea. (1) The ribosomal internal transcribed spacer (ITS) ITS1-5.8S-ITS2 region was amplified via PCR from genomic DNA obtained from mycelia using primers ITS1 and ITS4. A BLAST search in GenBank revealed highest similarity (99 to 100%) to sequences from various Botrytis spp. collected in China, Canada, and Spain (GenBank Accession Nos. FJ169666.1, GU934505.1, and EF207414.1). The ITS sequence amplified from the blackberry isolate was submitted to GenBank (Accession No. JN164269). The pathogen was further identified to the species level as B. cinerea using glyceraldehyde-3-phosphate dehydrogenase, heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) gene sequences (2) (GenBank Accession Nos. JN164270, JN164271, JN164272). Pathogenicity was confirmed by inoculating three surface-sterilized (soaked in 5% bleach for 15 min), mature blackberry fruit (R. fruticosus) with a conidial suspension (105 spores/ml) of the blackberry isolate. A 20-μl droplet was placed on the fruit; control fruit received sterile water without conidia. After 5 days of incubation at room temperature in an air-tight Magenta box, the inoculated fruit developed typical signs and symptoms of gray mold. The developing spores on inoculated fruit were confirmed to be B. cinerea. All control fruit remained healthy. To our knowledge, this is the first report of B. cinerea on blackberry in South Carolina. The disease must be managed with fungicides to obtain high quality fruit with market-requested shelf life. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , June 17, 2011. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Gray Mold on Amorphophallus muelleri Caused by Botrytis cinerea in China

Plant Disease ◽

10.1094/pdis-08-13-0855-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 692-692 ◽

Cited By ~ 2

Author(s):

L. Yu ◽

J. R. Zhao ◽

S. G. Xu ◽

Y. Su ◽

D. Gao ◽

...

Keyword(s):

Botrytis Cinerea ◽

Its Region ◽

Gray Mold ◽

Gelling Agent ◽

Commonwealth Mycological Institute ◽

Distilled Water ◽

First Report ◽

Calla Lily ◽

Specialty Crop ◽

Important Cash Crop

Amorphophallus muelleri is a perennial tuberous plant in the family Araceae. The name konjac is commonly used for the species of genus Amorphophallus that produce a polysaccharide, glucomannan. The latter, called konjac glucomannan, is extracted from the tubers of these species. Glucomannan is an excellent gelling agent used in food, pharmaceutical and chemical industry, a specialty crop grown as a source of glucomannan for industrial use. It is an important cash crop and thus contributes to poverty alleviation in southwest China. Its planting area is about 150 million mu (10 million ha). In July 2012, symptoms of an unknown blight were observed on 5 to 10% of A. muelleri flowers and seeds being grown for commercial seed production. Greenhouses temperatures ranged from 20 to 34°C (avg. 26°C). A light grey mycelium was observed on symptomatic tissues, especially flowers. Severely infected flowers and stems eventually rotted, then dried out. Diseased tissue was excised from affected flowers and surfaces and disinfected with 1% sodium hypochlorite, followed by 70% alcohol. The tissue was then rinsed in sterile distilled water, plated on potato dextrose agar (PDA), and incubated at 26°C. Mycelial growth on PDA was initially whitish and turned gray with age. Dark appearing conidiophores bore botryose heads of hyaline, ellipsoid, unicellular conidia, grey in mass, measuring 7.2 (6.2 to 9.5) × 5.3 (4.5 to 6.0) μm. Black, irregular sclerotia formed at random in the culture. These morphological features were typical of those described for Botrytis cinerea (2). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced (1). BLAST analysis of a 557-bp segment had a 99% similarity with the sequence of Botryotinia fuckeliana (anamorph = B. cinerea). The representative nucleotide sequence has been assigned the GenBank Accession No. KC999986. On the basis of morphological and molecular results, the fungus isolated from diseased konjac flowers and flower tissue was confirmed to be B. cinerea. Pathogenicity tests: Inoculum was prepared from 7-day-old cultures on PDA. Six flowering A. muelleri in 1-liter pots were spray inoculated with a 1.0 × 106 conidia/ml suspension from 7-day-old PDA cultures. As a control, six healthy plants were sprayed with sterile distilled water. Each plant was covered with a transparent polyethylene bag for 3 days and maintained in a greenhouse at temperatures between 20 and 26°C. After 8 days, small, round to irregular brown spots developed on both flowers and stems, which finally blighted. Water-treated plants remained symptomless. Koch's postulates were fulfilled when the pathogen was re-isolated from the diseased organs. Blight on common calla lily (calla lily and Amorphophallus are in the same family, different genera) flower attributed to B. cinerea was previously reported in Argentina (3). To our knowledge, this is the first report of the presence of B. cinerea on A. muelleri in China. References: (1) D. E. L. Cooke and J. M. Duncan. Mycol. Res. 101:667, 1997. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, England, 1971. (3) M. C. Rivera and S. E. Lopez. Plant Dis. 90:970, 2006.

Download Full-text

First Report of Gray Mold Disease of Sponge Gourd (Luffa cylindrica) Caused by Botrytis cinerea in Taiwan

Plant Disease ◽

10.1094/pdis-91-9-1199a ◽

2007 ◽

Vol 91 (9) ◽

pp. 1199-1199 ◽

Cited By ~ 2

Author(s):

Y. Ko ◽

K. S. Yao ◽

C. Y. Chen ◽

C. H. Lin

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

Spore Suspension ◽

Fluorescent Light ◽

Distilled Water ◽

Luffa Cylindrica ◽

First Report ◽

Sponge Gourd ◽

Plastic Bag ◽

Central Taiwan

A disease of sponge gourd (Luffa cylindrica (L.) Roem., family Cucurbitaceae) has become a serious threat to sponge gourd production since 2003 in central Taiwan. Initially, symptoms appear as small, brown spots on the flower petals that spread to the entire flower and cause blossom blight within 2 to 3 days. Subsequently, the pathogen develops abundant mycelium and moves from the petals onto the fruits causing blossom end rot and fruit stem rot. Severely infected fruits become completely rotten and desiccate. Tissues were excised from diseased sponge gourd fruits (sampled from Fongyuan, located at 24.25°N, 120.72°E in Taichung County), immersed in a solution containing 3% sodium hypochlorite and 70% ethanol for 1 min, washed three times with sterile water, and then cultured on potato dextrose agar (PDA) medium. A fungus, identified as Botrytis cinerea, produced abundant mycelium on PDA medium when incubated under constant fluorescent light 185 ± 35 μE·m–2·s–1 at 24°C. The conidia were smooth, hyaline, and globoid or slightly ellipsoid. The conidia measured 9.5 to 19.3 μm (average 13.8 μm) long and 6.0 to 17.8 μm (average 10.1 μm) wide, dimensions that are similar to the descriptions of B. cinerea (11 × 11 to 15 μm) that causes gray mold of strawberry (2). The identity of B. cinerea was also confirmed by the production of numerous black sclerotia on PDA plates incubated either in the dark or under light at 20 to 24°C for 9 to 10 days. Koch's postulates were fulfilled by using 3-day-old mycelial agar discs of the fungus or a spore suspension containing 105 conidia per milliliter of distilled water as inoculum. Shallow (2 × 2 × 2 mm) incisions were made on fresh sponge gourd fruits with a sterile scalpel and inoculated with either a 5-mm mycelial disc or 0.5 ml of the spore suspension. Inoculated areas were covered with moist sterile cotton, and the fruits were enclosed in a plastic bag and incubated at 20 to 24°C for 3 days. Wounded fruits inoculated with PDA discs or sterile distilled water alone served as controls. Pathogenicity tests were performed three times using five fruits in each trial. Symptoms and signs of the disease similar to those described above were observed in all (100%) the inoculated fruits, while no symptoms developed in the control fruits. Reisolation from the inoculated fruits consistently yielded B. cinerea. Reciprocal inoculations on sponge gourd, guava, and strawberry with mycelial discs or spore suspensions of a B. cinerea isolate obtained from sponge gourd, guava, and strawberry showed cross pathogenicity among isolates and hosts. Important groups of plants that are attacked by B. cinerea are vegetables, small berry fruits, ornamentals, and bulbs (1). Though 80 species of host plants, mostly shrubs and nursery plants, were reported to be the host of B. cinerea in Taiwan (3), to our knowledge, this is the first report of gray mold disease affecting sponge gourd in Taiwan. References: (1) G. N. Agrios. Plant Pathology. Academic Press. San Diego, 2005. (2) J. L. Mass, ed. Page 56 in: Compendium of Strawberry Diseases. The American Phytopathological Society. St. Paul, MN, 1984. (3). Y. Ko et al. Plant Prot. Bull. (Taiwan) 37:439, 1995.

Download Full-text

Pathogenic Capacity of Botrytis cinerea on Leaves of Pyrus mamorensis, an Endemic Tree of Mamora Forest in Morocco

Atlas Journal of Biology ◽

10.5147/ajb.v2i2.159 ◽

2017 ◽

Vol 2 (2) ◽

pp. 125-129

Author(s):

Zineb Sellal ◽

Jamila Dahmani ◽

Rachid Benkirane ◽

Amina Ouazzani Touhami ◽

Allal Douira

Keyword(s):

Botrytis Cinerea ◽

Disease Severity ◽

Filter Paper ◽

Pathogenic Fungus ◽

Gray Mold ◽

Conidial Suspension ◽

First Report ◽

Conidia Production

A survey in the Mamora forest was done in the spring of 2010 and revealed that 67% of buds and 27% of leaves of Pyrus mamorensis (Trabut) samples collected had lesions with a gray felting. The pathogenic fungus was identified as Botrytis cinerea by the filter – paper technic. Koch´s postulate was verified by inoculating healthy leaves. The estimated disease severity on P. mamorensis leaves was respectively 75.56% and 68.81% for inoculation by conidial suspension and the mycelial disks. Conidia production of Botrytis cinerea on inoculated leaves by conidial suspension was 1.03.105 conidia.cm-2 and by mycelial disks was 0.60.105 conidia.cm-2. This was the first report of gray mold disease of Mamora pear caused by Botrytis cinerea in Morocco.

Download Full-text

First Report of Gray Mold in Tomato Caused by Botrytis cinerea in Baja California, Mexico

Plant Disease ◽

10.1094/pd-89-0528b ◽

2005 ◽

Vol 89 (5) ◽

pp. 528-528 ◽

Cited By ~ 1

Author(s):

R. J. Holguín-Peña ◽

F. G. Arcos

Keyword(s):

Botrytis Cinerea ◽

Baja California ◽

Polymerase Chain Reaction Amplification ◽

Random Amplified Polymorphic Dna ◽

Gray Mold ◽

Malt Extract ◽

Conidial Suspension ◽

Sterile Water ◽

Tomato Production ◽

First Report

San Quintin Valley, a 60-mile-long coastal plain (30°30′N, 116°W) in the Baja California Peninsula, is one of the major fresh tomato (Lycopersicon esculentum Mill.) production areas in Mexico with more than 8,000 ha. During the last 10 years, the valley's tomato production has declined because of gray mold and stem canker diseases. Flower rot, reddish brown margins on the leaves and stems, and fruit with a gray mold were observed on field-grown tomato plants (Roma type cv. Tequila) in the autumn of 2003. Severity ranging from 55 to 60% was observed at harvest. Infected tissues were sampled and disinfested by immersion in 1% NaOCl for 1 min, rinsed in sterile water, and placed on malt extract agar at 22°C. Fungal conidia were then transferred to 2% potato dextrose agar (PDA). The resulting fungal colonies were definitively identified as Botrytis cinerea Pers.:Fr. The colonies of B. cinerea were first hyaline and white and became dark gray after 96 h. Mycelia were septate with dark branched conidiophores. Conidia were unicellular, ellipsoid, and ranged from 5 to 8 × 8 to 14 μm. Profuse black sclerotia developed in 7-day-old cultures. Infection site analyses in diseased flowers at different stages during the bloom were done with scanning electron microscopy. Fungal hyphae were located predominantly on the receptacle areas, whereas conidia were located in the ovaries as described previously (3). The identity of B. cinerea was confirmed by a restriction digest with ApoI of the 413-kb polymerase chain reaction amplification product obtained with BA2f/BA1r primers (1) and random amplified polymorphic DNA banding patterns (2). Pathogenicity tests were done by spray inoculation of 1-ml aqueous conidial suspension (106 CFU/ml) on 20 healthy plants during the blossom stage. An equal number of plants sprayed with sterile water was used as the control. Plants were incubated at 20 ± 2°C for 5 days. The fungus was reisolated from diseased flowers and peduncles after surface disinfestation (2.5% NaOCl) and plating on PDA. No symptoms were observed in the noninoculated controls. To our knowledge, this is the first report of B. cinerea causing gray mold disease on tomato in Baja California. References: (1) K. Nielsen et al. Plant Dis. 86:682, 2002. (2) S. Rigotti et al. FEMS Microbiol. Lett. 209:169, 2002. (3) O. Viret et al. Phytopathology 94:850, 2004.

Download Full-text

First Report of Gray Mold of Rhizoma paridis Caused by Botrytis cinerea in China

Plant Disease ◽

10.1094/pdis-03-14-0336-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1434-1434 ◽

Cited By ~ 2

Author(s):

J. M. You ◽

Q. H. Wang ◽

X. M. Lin ◽

J. Guo ◽

L. Q. Ai ◽

...

Keyword(s):

Botrytis Cinerea ◽

Leading Edge ◽

Its Region ◽

Gray Mold ◽

Pathogenicity Test ◽

Heat Shock Protein 60 ◽

Chinese Medicinal Herb ◽

First Report ◽

Potted Plants ◽

Plastic Bags

Rhizoma paridis is a perennial, traditional Chinese medicinal herb. In May 2013, a disease was observed in an approximately 10 ha cultivated field in Enshi, Hubei Province, China. Approximately 80% of plants in the field were affected. Symptoms were visible on the basal leaves of affected plants. Chlorosis followed by necrosis started at the leaf tips and margins and gradually spread inward until the entire leaf was necrotic. Thick, gray mycelium and conidia were visible on both sides surface of leaves under wet, humid conditions. The leading edge of the chlorotic leaves was excised from 20 plant samples surface disinfested with 1% NaOCl solution for 1 min, rinsed in sterile water, air dried, and placed on potato dextrose agar (PDA). Plates were incubated at 22°C in the dark. Mycelia were initially hyaline and white, and became dark gray after 72 h. Mycelia were septate with dark branched conidiophores. Conidia were smooth, hyaline, ovoid, aseptate, and ranged from 8 to 14.5 × 7 to 8.5 μm. Numerous hard, small, irregular, and black sclerotia that were 1 to 3 × 2 to 5 mm were visible on PDA plates after 12 days. The fungus was identified as Botrytis cinerea on the basis of these characters (1). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1 and ITS4 primer and sequenced (GenBank Accession No. KF265499). BLAST analysis of the PCR product showed 99% identity to Botryotinia fuckeliana (perfect stage of B. cinerea) (EF207415.1, EF207414.1). The pathogen was further identified to the species level as B. cinerea using gene sequences from glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) (2) (KJ638600, KJ638602, and KJ638601). Pathogenicity was tested by spraying the foliage of 40 two-year-old plants with a suspension of 106 conidia per ml of sterile distilled water. Each plant received 30 ml of the inoculum. Ten healthy potted plants were inoculated with sterilized water as control. All plants were covered with plastic bags for 5 days after inoculation to maintain high relative humidity and were placed in a growth chamber at 22°C. The first foliar lesions developed on leaves 7 days after inoculation and were similar to those observed in the field. No symptoms developed on the control plants. B. cinerea was consistently re-isolated from all artificially inoculated plants. The pathogenicity test was completed twice. To our knowledge, this is the first report of gray mold of R. paridis caused by B. cinerea in China. The root of R. paridis is the most commonly used Chinese herbal medicine to treat viper bites. In recent years, cultivation of this herb has increased in China because of its high value. Consequently, the economic importance of this disease is likely to increase with the greater prevalence of this host species. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

Download Full-text

First Report of Pyrimethanil Resistance in Botrytis cinerea from Stored Apples in Pennsylvania

Plant Disease ◽

10.1094/pdis-11-13-1120-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 999-999 ◽

Cited By ~ 2

Author(s):

H. J. Yan ◽

W. M. Jurick ◽

Y. G. Lou ◽

V. L. Gaskins ◽

Y.-K. Kim

Keyword(s):

Botrytis Cinerea ◽

Defined Medium ◽

Gray Mold ◽

Apple Fruit ◽

Resistant Isolate ◽

Morphological Identification ◽

Conidial Suspension ◽

Technical Grade ◽

First Report ◽

Moderately Resistant

Botrytis cinerea Pers.: Fr. (teleomorph Botryotinia fuckeliana [de Bary] Whetzel) causes gray mold on apple fruit. A survey of commercial packinghouses in Washington State revealed that it accounted for 28% of the decay in storage (1). Fungicide application coupled with cultural practices are the primary method of control as all commercial apple cultivars are susceptible to gray mold. In February 2013, gray mold was observed at ~5% incidence for commercially packed ‘Gala’ apple fruit that had been treated with Penbotec (active ingredient: pyrimethanil, Shield-Bright, Pace International) prior to controlled atmosphere storage in Pennsylvania. Eight infected apple fruit were collected, placed in 80 count boxes on cardboard trays, and stored at 4°C. One isolate was obtained from each decayed apple, placed on potato dextrose agar (PDA) petri plates, and incubated at 20°C with natural light. Eight single-spore isolates were identified as B. cinerea based on cultural characteristics. Species level identification was executed by obtaining mycelial genomic DNA, amplifying the ITS rDNA, and sequencing the ~550-bp amplicon directly (2). MegaBLAST analysis of the 2X consensus for the 8 isolates revealed 100% identity to B. cinerea ITS sequences in GenBank (KF156296.1 and JX867227.1) with E values of 0.0, thus confirming the morphological identification. Minimum inhibitory concentration (MIC) was determined using conidial suspensions obtained from ~14-day-old plates (104 spores/ml) and a range (0 to 500 μg/ml) of technical grade pyrimethanil on three replicated 96-well microtiter plates containing a defined medium for each experiment. Conidial proliferation was inhibited at 250 μg/ml for all eight isolates and the experiment was conducted four times. To further define the resistance levels between the isolates, mycelial growth analysis using a plug of actively growing mycelium from the margin of ~3-day-old plates was conducted with a defined medium three times with technical grade pyrimethanil with three plates per experiment. Five isolates grew at 250 μg/ml (highly resistant), while three did not (moderately resistant). To assess resistance in vivo, organic ‘Gala’ apples were rinsed with soap and water, sprayed with 70% ethanol, placed on trays, and allowed to air dry. Apples were wounded with a sterile finishing nail, inoculated with 20 μl of a conidial suspension (104 spores/ml) of either a moderately or a highly resistant isolate, and dipped in the labeled application rate of Penbotec at 500 μg/ml or sterile water for 30 s. Fruit were stored in 100 count boxes at 22°C for 5 days and decay incidence and severity were recorded. Ten fruit composed a replicate per treatment and the experiment was repeated. Water inoculated controls were symptomless and water-dipped inoculated fruit had 100% decay. Penbotec-treated fruit had 100% decay incidence and mean lesion diameters of 37.6 (±13.1 mm) for the highly, and 35.7 (±9.0 mm) for the moderately resistant isolate. This is the first report of pyrimethanil resistance in B. cinerea from decayed apples collected from a commercial packinghouse in Pennsylvania. The results indicate that pyrimethanil resistance has developed in B. cinerea, which can result in control failures on Penbotec-treated fruit during storage. Furthermore, it emphasizes the need for additional tools to manage gray mold on apple fruit and may pose issues for export concerning the spread of fungicide-resistant inoculum. References: (1) Y.-K. Kim and C. L. Xiao. Plant Dis. 92:940, 2008. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

Characterization of Botrytis cinerea and B. prunorum from Healthy Floral Structures and Decayed ‘Hayward’ Kiwifruit During Post-Harvest Storage

Plant Disease ◽

10.1094/pdis-04-20-0878-re ◽

2020 ◽

Author(s):

Danae Riquelme ◽

Zdenka Aravena ◽

Hector Valdes ◽

Bernardo Antonio Latorre ◽

Gonzalo A Díaz ◽

...

Keyword(s):

Botrytis Cinerea ◽

Central Valley ◽

Gray Mold ◽

Heat Shock Protein 60 ◽

Post Harvest ◽

Diseased Fruit ◽

Apparently Healthy

Gray mold is the primary post-harvest disease of ‘Hayward’ kiwifruit (Actinidia deliciosa) in Chile, with a prevalence of 33.1% in 2016 and 7.1% in 2017. Gray mold develops during postharvest storage, which is characterized by a soft, light to brown watery decay that is caused by Botrytis cinerea and B. prunorum. However, there is no information related to the role of B. prunorum during the development and storage of kiwifruit in Chile. For this purpose, asymptomatic flowers and receptacles were collected throughout fruit development and harvest from five orchards over two seasons in the Central Valley of Chile. Additionally, diseased kiwifruits were selected after storage for 100 days at 0°C plus 2 days at 20° C. High (HCP) and low conidial production (LCP) colonies of Botrytis sp. were consistently obtained from apparently healthy petals, sepals, receptacles, styles, and diseased kiwifruit. Morphological and phylogenetic analysis using three partial gene sequences encoding glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) were able to identify and separate B. cinerea and B. prunorum species. Consistently, B. cinerea was predominantly isolated from all floral parts and fruit in apparently healthy tissue and diseased kiwifruit. During full bloom, the highest colonization by B. cinerea and B. prunorum was obtained from petals followed by sepals. In storage, both Botrytis species were isolated from the diseased fruit (n=644), of which 6.8% (n=44) were identified as B. prunorum. All Botrytis isolates grew from 0°C to 30°C in vitro and were pathogenic on kiwifruit leaves and fruit. Notably, B. cinerea isolates were always more virulent than B. prunorum isolates. This study confirms the presence of B. cinerea and B. prunorum colonizing apparently healthy flowers and floral parts in fruit and causing gray mold during kiwifruit storage in Chile. Therefore, B. prunorum plays a secondary role in the epidemiology of gray mold developing in kiwifruit during cold storage.

Download Full-text