First Report of Gray Mold Disease of Sponge Gourd (Luffa cylindrica) Caused by Botrytis cinerea in Taiwan

A disease of sponge gourd (Luffa cylindrica (L.) Roem., family Cucurbitaceae) has become a serious threat to sponge gourd production since 2003 in central Taiwan. Initially, symptoms appear as small, brown spots on the flower petals that spread to the entire flower and cause blossom blight within 2 to 3 days. Subsequently, the pathogen develops abundant mycelium and moves from the petals onto the fruits causing blossom end rot and fruit stem rot. Severely infected fruits become completely rotten and desiccate. Tissues were excised from diseased sponge gourd fruits (sampled from Fongyuan, located at 24.25°N, 120.72°E in Taichung County), immersed in a solution containing 3% sodium hypochlorite and 70% ethanol for 1 min, washed three times with sterile water, and then cultured on potato dextrose agar (PDA) medium. A fungus, identified as Botrytis cinerea, produced abundant mycelium on PDA medium when incubated under constant fluorescent light 185 ± 35 μE·m–2·s–1 at 24°C. The conidia were smooth, hyaline, and globoid or slightly ellipsoid. The conidia measured 9.5 to 19.3 μm (average 13.8 μm) long and 6.0 to 17.8 μm (average 10.1 μm) wide, dimensions that are similar to the descriptions of B. cinerea (11 × 11 to 15 μm) that causes gray mold of strawberry (2). The identity of B. cinerea was also confirmed by the production of numerous black sclerotia on PDA plates incubated either in the dark or under light at 20 to 24°C for 9 to 10 days. Koch's postulates were fulfilled by using 3-day-old mycelial agar discs of the fungus or a spore suspension containing 105 conidia per milliliter of distilled water as inoculum. Shallow (2 × 2 × 2 mm) incisions were made on fresh sponge gourd fruits with a sterile scalpel and inoculated with either a 5-mm mycelial disc or 0.5 ml of the spore suspension. Inoculated areas were covered with moist sterile cotton, and the fruits were enclosed in a plastic bag and incubated at 20 to 24°C for 3 days. Wounded fruits inoculated with PDA discs or sterile distilled water alone served as controls. Pathogenicity tests were performed three times using five fruits in each trial. Symptoms and signs of the disease similar to those described above were observed in all (100%) the inoculated fruits, while no symptoms developed in the control fruits. Reisolation from the inoculated fruits consistently yielded B. cinerea. Reciprocal inoculations on sponge gourd, guava, and strawberry with mycelial discs or spore suspensions of a B. cinerea isolate obtained from sponge gourd, guava, and strawberry showed cross pathogenicity among isolates and hosts. Important groups of plants that are attacked by B. cinerea are vegetables, small berry fruits, ornamentals, and bulbs (1). Though 80 species of host plants, mostly shrubs and nursery plants, were reported to be the host of B. cinerea in Taiwan (3), to our knowledge, this is the first report of gray mold disease affecting sponge gourd in Taiwan. References: (1) G. N. Agrios. Plant Pathology. Academic Press. San Diego, 2005. (2) J. L. Mass, ed. Page 56 in: Compendium of Strawberry Diseases. The American Phytopathological Society. St. Paul, MN, 1984. (3). Y. Ko et al. Plant Prot. Bull. (Taiwan) 37:439, 1995.

Download Full-text

First Report of Gray Mold Disease of Sponge Gourd (Luffa cylindrica) Caused by Botrytis cinerea in Korea

Research in Plant Disease ◽

10.5423/rpd.2016.22.2.107 ◽

2016 ◽

Vol 22 (2) ◽

pp. 107-110

Author(s):

Md. Aktaruzzaman ◽

Tania Afroz ◽

Byung-Sup Kim ◽

Hyeon-Dong Shin

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

Luffa Cylindrica ◽

First Report ◽

Sponge Gourd

Download Full-text

First Report of Gray Mold on Amorphophallus muelleri Caused by Botrytis cinerea in China

Plant Disease ◽

10.1094/pdis-08-13-0855-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 692-692 ◽

Cited By ~ 2

Author(s):

L. Yu ◽

J. R. Zhao ◽

S. G. Xu ◽

Y. Su ◽

D. Gao ◽

...

Keyword(s):

Botrytis Cinerea ◽

Its Region ◽

Gray Mold ◽

Gelling Agent ◽

Commonwealth Mycological Institute ◽

Distilled Water ◽

First Report ◽

Calla Lily ◽

Specialty Crop ◽

Important Cash Crop

Amorphophallus muelleri is a perennial tuberous plant in the family Araceae. The name konjac is commonly used for the species of genus Amorphophallus that produce a polysaccharide, glucomannan. The latter, called konjac glucomannan, is extracted from the tubers of these species. Glucomannan is an excellent gelling agent used in food, pharmaceutical and chemical industry, a specialty crop grown as a source of glucomannan for industrial use. It is an important cash crop and thus contributes to poverty alleviation in southwest China. Its planting area is about 150 million mu (10 million ha). In July 2012, symptoms of an unknown blight were observed on 5 to 10% of A. muelleri flowers and seeds being grown for commercial seed production. Greenhouses temperatures ranged from 20 to 34°C (avg. 26°C). A light grey mycelium was observed on symptomatic tissues, especially flowers. Severely infected flowers and stems eventually rotted, then dried out. Diseased tissue was excised from affected flowers and surfaces and disinfected with 1% sodium hypochlorite, followed by 70% alcohol. The tissue was then rinsed in sterile distilled water, plated on potato dextrose agar (PDA), and incubated at 26°C. Mycelial growth on PDA was initially whitish and turned gray with age. Dark appearing conidiophores bore botryose heads of hyaline, ellipsoid, unicellular conidia, grey in mass, measuring 7.2 (6.2 to 9.5) × 5.3 (4.5 to 6.0) μm. Black, irregular sclerotia formed at random in the culture. These morphological features were typical of those described for Botrytis cinerea (2). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced (1). BLAST analysis of a 557-bp segment had a 99% similarity with the sequence of Botryotinia fuckeliana (anamorph = B. cinerea). The representative nucleotide sequence has been assigned the GenBank Accession No. KC999986. On the basis of morphological and molecular results, the fungus isolated from diseased konjac flowers and flower tissue was confirmed to be B. cinerea. Pathogenicity tests: Inoculum was prepared from 7-day-old cultures on PDA. Six flowering A. muelleri in 1-liter pots were spray inoculated with a 1.0 × 106 conidia/ml suspension from 7-day-old PDA cultures. As a control, six healthy plants were sprayed with sterile distilled water. Each plant was covered with a transparent polyethylene bag for 3 days and maintained in a greenhouse at temperatures between 20 and 26°C. After 8 days, small, round to irregular brown spots developed on both flowers and stems, which finally blighted. Water-treated plants remained symptomless. Koch's postulates were fulfilled when the pathogen was re-isolated from the diseased organs. Blight on common calla lily (calla lily and Amorphophallus are in the same family, different genera) flower attributed to B. cinerea was previously reported in Argentina (3). To our knowledge, this is the first report of the presence of B. cinerea on A. muelleri in China. References: (1) D. E. L. Cooke and J. M. Duncan. Mycol. Res. 101:667, 1997. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, England, 1971. (3) M. C. Rivera and S. E. Lopez. Plant Dis. 90:970, 2006.

Download Full-text

First Report of Gray Mold Caused by Botrytis cinerea on Stevia rebaudiana in Italy

Plant Disease ◽

10.1094/pdis-93-3-0318a ◽

2009 ◽

Vol 93 (3) ◽

pp. 318-318

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

M. L. Gullino

Keyword(s):

Botrytis Cinerea ◽

Stevia Rebaudiana ◽

Its Region ◽

Morphological Characters ◽

Gray Mold ◽

Fluorescent Light ◽

Pathogenicity Test ◽

Leaf Extracts ◽

First Report ◽

Potted Plants

Stevia rebaudiana (sweetleaf) is a perennial shrub belonging to the Asteraceae family and is widely grown for its sweet leaves. With its extracts having as much as 300 times the sweetness of sugar, this species is used in many countries for the production of sugar substitutes. However, in Italy, as well as in other countries, this species cannot be grown for the use of its leaf extracts. This plant is grown in a few nurseries in the Albenga Region (northern Italy) as potted plants. In February of 2008, 3-month-old plants grown in plastic pots (14-cm diameter) under glasshouse on heated benches started showing symptoms of a previously unknown blight. The temperature in the glasshouse ranged between 16 and 20°C and plants were watered by sprinkle irrigation. Leaves, starting from the basal ones, showed small, brown spots that spread across the entire leaf surface. Subsequently, the crown and stem were infected, and the pathogen developed abundant, soft, gray mycelium on leaves and stems and in the middle of the heads of S. rebaudiana. Flowers were not present when the symptoms appeared. Severely infected leaves dried out and became necrotic. The disease was observed in one nursery in which 5% of the plants were affected. The margins of the lesions were excised from leaves, immersed in a solution containing 1% sodium hypochlorite, and then cultured on potato dextrose agar (PDA) medium. A fungus produced abundant mycelium when incubated under constant fluorescent light at 22 ± 1°C after 10 days. The conidia were smooth, hyaline, ovoid, measuring 15.5 to 8.3 × 11.1 to 7.3 (average 11.6 × 8.6) μm, and were similar to those described for Botrytis cinerea. Conidiophores were slender and branched with enlarged apical cells bearing conidia on short sterigmata. The identity of the fungus was also confirmed by the production of numerous, small, black sclerotia on PDA plates incubated for 20 days at 8 ± 1°C. Sclerotia were dark and irregular with a diameter ranging from 1 to 2 mm. These morphological characters identified the fungus as B. cinerea (2). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLAST analysis (1) of the 780-bp segment showed a 100% homology with the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). The nucleotide sequence has been assigned GenBank Accession No. FJ486270. Pathogenicity tests were performed by spraying leaves of six healthy 6-month-old potted S. rebaudiana plants with a 105 conidia/ml suspension. Six plants sprayed with water only served as controls. Plants were covered with plastic bags for 3 days after inoculation to maintain high relative humidity and were placed in a growth chamber at 20 ± 1°C. The first foliar lesions developed on leaves 4 days after inoculation, whereas control plants remained healthy. B. cinerea was consistently reisolated from these lesions. The pathogenicity test was completed twice. To our knowledge, this is the first report of the presence of B. cinerea on S. rebaudiana in Italy. The disease has been reported in Ukraine (3) and more recently in Japan (4). The economic importance of this disease is at the moment limited. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972. (3) J. Takeuch and H. Horie. Annu. Rep. Kanto-Tosan Plant Prot. Soc. 53:87, 2006. (4) V. F. Zubenko et al. Zash. Rast. 18, 1991.

Download Full-text

First Report of Post-Harvest Gray Mold on Hyacinth bean (Lablab purpureus) Caused by Botrytis cinerea in Korea

Plant Disease ◽

10.1094/pdis-03-21-0457-pdn ◽

2021 ◽

Author(s):

Md Aktaruzzaman ◽

Tania Afroz ◽

Sung Kee Hong ◽

Byung Sup Kim ◽

Hyo-Won Choi

Keyword(s):

Botrytis Cinerea ◽

Petri Dish ◽

Gray Mold ◽

Distilled Water ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Lablab Purpureus ◽

First Report ◽

Post Harvest ◽

Hyacinth Bean

Hyacinth bean (Lablab purpureus L.) is a highly proteineous legume under the family Fabaceae. It is native to Africa, cultivated throughout the world, and recently introduced vegetable in Korea. In April 2020, approximately 10 to 15% of the total harvested pods showed gray mold rot symptoms after 3–5 days of storage at 4 °C in Jeonju, Jeonbuk province, Korea. The symptoms observed were irregular, water-soaked spots become brown or gray with white hyphae were appeared on the infected pods. Diseased tissue was excised, and surface sterilized by immersing in 1% sodium hypochlorite (NaOCl) for 1 min, rinsed three times with sterilized distilled water, placed on potato dextrose agar (PDA) plates, and incubated at 20 ± 2°C for 7 days. A total of five morphologically similar fungal isolates (HBGM001 to HBGM005) were obtained from diseased samples; isolate HBGM002 and HBGM005 were selected for identification. The fungus produced initially white colonies, after 7 days it changes to gray to dark colonies with dark mycelium that sporulated abundantly on PDA at 20ºC. The conidia (n = 50) were single-celled, ellipsoid or ovoid in shape, and 6.11 to 13.9 × 4.8 to 9.4 μm in size for HBGM001 isolate and 5.81 to 14.1× 4.5 to 9.6 μm in size for HBGM005. Conidiophores (n = 15) arose solitary or in groups, straight or flexuous, septate, with an inflated basal cell brown to light brown, and measured 103 to 420× 7 to 25 μm for HBGM001 isolate and 101 to 415 × 5 to 23 μm for HBGM005 isolate. After two weeks, the fungus formed several black sclerotia (n = 20) ranging from 0.5 to 4.2 × 0.5 to 3.4 mm for HBGM001 isolate and 0.4 to 4.4 × 0.3 to 3.3 mm for HBGM005 isolate near the edge of the Petri dish. Morphological characters were consistent with those of Botrytis cinerea Pers.: Fr. (Ellis 1971). As for molecular identification, the internal transcribed spacer (ITS) and three nuclear protein-coding genes (glyceraldehydes-3-phosphate dehydrogenase gene [G3PDH], heat-shock protein 60 gene [HSP60], and DNA-dependent RNA polymerase subunit gene [RPB2]) were amplified using primer pairs ITS1/ITS4 (White et al. 1990), G3PDH-F/G3PDH-R, HSP60-F/HSP60-R, and RPB2-F/RPB2-R (Staats et al. 2005), respectively. The ITS, G3PDH, HSP60, and RPB2 sequences of HBGM002 and HBGM005 isolates (GenBank accession number MT439648 and MT968495 for ITS; MT439649 and MT968496 for G3PDH; MT439650 and MT968497 for HSP60; MT439651 and MT968498 for RPB2 respectively) were 99% to 100% identical to those of B. cinerea (KY364366, KF015583, KJ018758, and KJ018756, respectively). To determine pathogenicity, five disinfected pods were pinpricked (3 sites per pod) with sterile needles and 50 µl of conidial suspension (1 × 105 conidia/ml) was inoculated by pipetting into the wounds. An analogous five pods, serving as controls, were inoculated with sterile distilled water. All the pods were placed in a growth chamber and maintained a temperature of 20±2ºC and a relative humidity >80%. After 5 days, gray mold symptoms developed on the inoculated pods, whereas no symptoms appeared on control pods. The pathogen was re-isolated from the inoculated pods, fulfilling Koch’s postulates. B. cinerea has been reported causing gray mold in Hyacinth bean in China, Taiwan and India (Farr and Rossman 2021). To our knowledge, this is the first report of B. cinerea causing post-harvest gray mold on hyacinth bean in Korea. The disease could represent a threat for hyacinth bean post-harvest and storage and management strategies should be investigated and applied.

Download Full-text

First Report of Gray Mold of Blackberry Caused by Botrytis cinerea in South Carolina

Plant Disease ◽

10.1094/pdis-06-11-0530 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1592-1592 ◽

Cited By ~ 1

Author(s):

X. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Signs And Symptoms ◽

Gray Mold ◽

Fluorescent Light ◽

Its2 Region ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

First Report ◽

Control Fruit

Botrytis cinerea Pers.: Fr. is a causal agent of gray mold of blackberry but may also affect grapevine, tomato, bulb flowers, and ornamental crops (2). In August 2010, blackberries (Rubus fruticosus and other species) showing gray mold symptoms were found in Longcreek, Six Mile, and Cheddar, SC. Symptomatic blackberry fruit exhibited patterns of brown-to-gray mycelia and conidiophores. Upon isolation, the mycelium grew at a rate of 12.3 mm per day at 22°C on potato dextrose agar, forming pale white-to-gray colonies with concentric rings and conidiophores (less than 12 h of fluorescent light per day). Some isolates formed dark brown sclerotia in the dark after 18 days. The lemon-shaped spores averaged 12 × 9 μm and were consistent with descriptions of B. cinerea. (1) The ribosomal internal transcribed spacer (ITS) ITS1-5.8S-ITS2 region was amplified via PCR from genomic DNA obtained from mycelia using primers ITS1 and ITS4. A BLAST search in GenBank revealed highest similarity (99 to 100%) to sequences from various Botrytis spp. collected in China, Canada, and Spain (GenBank Accession Nos. FJ169666.1, GU934505.1, and EF207414.1). The ITS sequence amplified from the blackberry isolate was submitted to GenBank (Accession No. JN164269). The pathogen was further identified to the species level as B. cinerea using glyceraldehyde-3-phosphate dehydrogenase, heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) gene sequences (2) (GenBank Accession Nos. JN164270, JN164271, JN164272). Pathogenicity was confirmed by inoculating three surface-sterilized (soaked in 5% bleach for 15 min), mature blackberry fruit (R. fruticosus) with a conidial suspension (105 spores/ml) of the blackberry isolate. A 20-μl droplet was placed on the fruit; control fruit received sterile water without conidia. After 5 days of incubation at room temperature in an air-tight Magenta box, the inoculated fruit developed typical signs and symptoms of gray mold. The developing spores on inoculated fruit were confirmed to be B. cinerea. All control fruit remained healthy. To our knowledge, this is the first report of B. cinerea on blackberry in South Carolina. The disease must be managed with fungicides to obtain high quality fruit with market-requested shelf life. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , June 17, 2011. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold Disease on Peach from Pakistan

International Journal of Phytopathology ◽

10.33687/phytopath.007.03.2668 ◽

2018 ◽

Vol 7 (3) ◽

pp. 131-131

Author(s):

Raees Ahmed ◽

Amjad S. Gondal ◽

Muhammad Tariq Khan ◽

Shazia Shahzaman ◽

Sajjad Hyder

Keyword(s):

Botrytis Cinerea ◽

Mycelial Growth ◽

Agar Medium ◽

Management Strategies ◽

Gray Mold ◽

First Report ◽

Average Production ◽

Conducive Environment ◽

Hyphal Tip ◽

Important Disease

Gray mold caused by Botrytis cinerea is an important disease that attacks fruits, leaves and twigs of peach. Peach is grown on an area of 18,008 ha with an average production of 72,085 tons per year in Pakistan (FAO, 2017). During May 2017, brown spots on 33% of the peach fruits examined were observed in Swat district of KPK province of Pakistan. Infected fruits were incubated at 25±2 °C in a humid chamber resulted in greyish mycelial growth with light brown lesions. Hyphal growths on infected fruits were cultured on PDA media and purified by hyphal tip method. Morphologically whitish grey growth was observed on PDA and later on dark sclerotia were observed after 6-7 days of incubation. Hyphae were found septate with branched hyaline conidiophores having a bunch of ovoid conidia at their tips. Further confirmations were done by amplifying internal transcribed spacer regions (Andrew et al., 2009) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) region of the isolates (Li et al., 2012). Amplicons sequenced from Macrogen Korea were blasted and submitted in NCBI showed that ITS sequences (Accessions MH049690 and MH049691) were 99% identical with already reported (MG878388 and MG654661) sequences and the G3PDH gene sequences (Accessions MH560352 and MH560353) were 99 % identical with already reported (Accessions MG204876) sequences of B. cinerea. Pathogenicity was confirmed on healthy peach fruits disinfected with 50% ethanol, inoculated by placing a plug of about 1cm2 taken from the edge of actively growing B. cinerea isolate (BTS-16). Fruits were incubated at 25±2 °C in a humid chamber (Abata et al., 2016). A set of healthy fruits mock-inoculated with a plug of agar medium were used as control. Three days after inoculation, inoculated fruits showed sunken lesions with cottony greyish mycelial growth on their surface. Fungus isolated from these infections was re-confirmed as B. cinerea. Conducive environment for the disease progression in nearby areas can result into a huge loss in peach produce so there is a need to devise management strategies to cope with the pathogen. This is the first report of gray mold disease of peach caused by B. cinerea from Pakistan.

Download Full-text

First Report of Fenhexamid-Resistant Botrytis cinerea Causing Gray Mold on Heurchera in a North American Greenhouse

Plant Disease ◽

10.1094/pdis-08-11-0721 ◽

2012 ◽

Vol 96 (1) ◽

pp. 147-147 ◽

Cited By ~ 10

Author(s):

G. W. Moorman ◽

A.-S. Walker ◽

S. May

Keyword(s):

Botrytis Cinerea ◽

Mode Of Action ◽

Gray Mold ◽

North Central ◽

First Report ◽

Group I ◽

Central Pennsylvania ◽

Commercial Operation ◽

Penn State ◽

Botryotinia Fuckeliana

Greenhouse-grown Heuchera plants, treated with fenhexamid (Decree, SePRO, Carmel, IN; FRAC group 17 hydroxyanilide), with active gray mold were submitted to the Penn State Plant Disease Clinic in December 2010 from a commercial operation in north-central Pennsylvania. Genetic and phenotypic analyses identified the isolate as Botrytis cinerea Pers. (teleomorph Botryotinia fuckeliana (de Bary) Whetzel), HydR3 phenotype (2) and not B. pseudocinerea (previously Botrytis group I) (4), naturally resistant to fenhexamid (phenotype HydR1) (1). While 0.2 μg of fenhexamid per ml or less is required to slow mycelial growth and germ tube elongation of sensitive isolates by 50% (EC50), the radial growth EC50 of the Heuchera isolate was approximately 2,000 μg of fenhexamid per ml in culture. Five cucumber seedlings receiving 25 μl of 0.1 M dextrose containing the label rate of Decree (1,800 μg/ml) on the growing tip were inoculated with colonized agar in the drop. Five check plants received 25 μl of 0.1 M dextrose. B. cinerea from silica gel storage since 1988 was also tested. This experiment was repeated three times. The 1988 isolate killed all fungicide-free but no fenhexamid-treated plants. The Heuchera isolate killed all fungicide-free and fenhexamid-treated plants within 4 days. To our knowledge, this is the first report of B. cinerea from a greenhouse in North America with fenhexamid resistance. Resistance occurs in U.S. fields (3). The Heuchera isolate's HydR3 resistance phenotype (2) has been detected in Germany, Japan, and France and has mutations affecting the 3-keto reductase protein, encoded by the erg27 gene, the specific target of fenhexamid and involved in Botrytis sterol biosynthesis. The Decree label states that it is to be used only twice on a crop before switching to a different mode of action. Greenhouses have resident Botrytis populations that are likely to be exposed to any fungicide applied in the structure. Growers should consider using fenhexamid only twice in a particular greenhouse, rather than on a particular crop, before switching to a different mode of action. References: (1) P. Leroux et al. Crop Prot. 18:687, 1999.(2) P. Leroux et al. Pest Manag. Sci. 58:876, 2002. (3) Z. Ma and T. J. Michailides. Plant Dis. 89:1083, 2005. (4) A.-S. Walker et al. Phytopathology 101:1433, 2011.

Download Full-text

First Report of Gray Mold on Allium victorialis var. platyphyllum Caused by Botrytis cinerea in Korea

Plant Disease ◽

10.1094/pdis-07-16-1051-pdn ◽

2017 ◽

Vol 101 (1) ◽

pp. 256-256

Author(s):

M. Aktaruzzaman ◽

Y. G. Lee ◽

T. Afroz ◽

B. S. Kim ◽

H. D. Shin

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

First Report

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text