First Report of Pseudomonas cichorii Causing Tomato Pith Necrosis in Fujian Province, China

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of Pseudomonas viridiflava Causing Pith Necrosis of Tomato (Solanum lycopersicum) in Serbia

Plant Disease ◽

10.1094/pdis-01-15-0052-pdn ◽

2015 ◽

Vol 99 (7) ◽

pp. 1033-1033 ◽

Cited By ~ 1

Author(s):

T. Popović ◽

Ž. Ivanović ◽

M. Ignjatov

Keyword(s):

Solanum Lycopersicum ◽

First Report ◽

Pseudomonas Viridiflava ◽

Pith Necrosis

Download Full-text

First Report of Leaf Spot Caused by Pseudomonas cichorii on Coreopsis lanceolata in Italy

Plant Disease ◽

10.1094/pdis-93-9-0967a ◽

2009 ◽

Vol 93 (9) ◽

pp. 967-967 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

C. Moretti ◽

M. L. Gullino

Keyword(s):

Leaf Spot ◽

Casein Hydrolysate ◽

Its Region ◽

Soft Rot ◽

Chrysanthemum Morifolium ◽

Luria Bertani ◽

Nutrient Broth ◽

Bacterial Leaf Spot ◽

Pseudomonas Cichorii ◽

First Report

Coreopsis lanceolata L. (Compositae), an ornamental species grown in parks and gardens, is very much appreciated for its long-lasting flowering period. In August of 2008, pot-grown plants with necrotic leaf lesions were observed in a commercial nursery located near Biella (northern Italy). Lesions were present, especially along the margin of basal leaves, and sometimes had a chlorotic halo. On infected leaves, dark brown necrosis developed. Leaf stalks were sometimes affected. In many cases, the leaves, especially those at collar level, were withered. Of 1,500 plants, 15% were infected by the disease. Microscopic examination did not reveal any fungal structures within the lesions. Small fragments of tissue from 30 affected leaves were macerated for 15 min in casein hydrolysate and 0.1-ml aliquots of the resulting suspension were spread onto Luria Bertani agar (LB) and potato dextrose agar (PDA). Plates were maintained at 22 ± 1°C for 48 h. No fungi were isolated from the leaf spots on LB or PDA. Colonies similar to those of Pseudomonas spp. were consistently isolated on LB. Colonies were fluorescent on King's medium B, levan negative, oxidase positive, potato soft rot negative, arginine dihydrolase negative, and tobacco hypersensitivity positive (LOPAT test). The bacterial colonies were identified as Pseudomonas cichorii (2). The internal transcribed spacer (ITS) region of rDNA was amplified using primers 27F and 1492R and sequenced (GenBank Accession No. FJ534557). BLAST analysis (1) of the 998-bp segment showed a 98% homology with the sequence of P. cichorii. The pathogenicity of one isolate was tested twice by growing the bacterium in nutrient broth shake cultures for 48 h at 20 ± 1°C. The suspension was centrifuged, the cell pellet resuspended in sterile water to a concentration of 107 CFU/ml, and 30 4-month-old healthy coreopsis plants were sprayed with the inoculum. The same number of plants was sprayed with sterile nutrient broth as a control. After inoculation, plants were covered with plastic bags for 48 h and placed in a growth chamber at 20 ± 1°C. Five days after inoculation, lesions similar to those seen in the field were observed on all plants inoculated with the bacterium, but not on the controls. Ten days later, 40% of the leaves were withered. Isolations were made from the lesion margins on LB and the resulting bacterial colonies were again identified as P. cichorii. The pathogen caused the same symptoms also on plants of Dendranthema frutescens (cv. Camilla), Chrysanthemum morifolium (cvs. Eleonora and Captiva), and an Osteospermum sp. (cv. Wild side) when artificially inoculated with the pathogen with the same methodology. The same bacterial leaf spot caused by P. cichorii was observed in 2005 in other nurseries in the same area on Phlox paniculata (3). To our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on C. lanceolata in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) H. Bergey et al. Bergey's Manual on Determinative Bacteriology. Williams and Wilkins, Baltimore, MD, 1994. (3) A. Garibaldi et al. Plant Dis. 89:912, 2005.

Download Full-text

First Report of a Leaf Spot Disease of Tobacco Caused by Pseudomonas cichorii in China

Plant Disease ◽

10.1094/pdis-10-21-2158-pdn ◽

2021 ◽

Author(s):

Dayu Lan ◽

Fangling Shu ◽

Yanhui Lu ◽

Anfa Shou ◽

Wei Lin ◽

...

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Pseudomonas Cichorii ◽

Koch’S Postulates ◽

First Report ◽

Initial Symptoms ◽

Wide Range ◽

Koch's Postulates

Tobacco (Nicotiana tabacum L.), one of the chief commercial crops, is wildly cultivated worldwide. In June 2020 and 2021, an unknown bacterial leaf spot on tobacco was found in Hezhou and Hechi City, Guangxi, China. 30% of the tobacco were affected and the rate of diseased leaves reached about 10% in the field under high temperature and rainstorm. The disease mainly damaged the middle and top leaves of tobacco plants at vigorous growing stage. The initial symptoms were water-soaked spots on the frontal half of a leaf, and then expanded into circular to irregular spots with a yellow halo at the edge. The spots mostly appeared dark brown at high air humidity, while yellow brown at low humidity and exhibited a concentric pattern. In severe cases, the lesions coalesced and the whole leaf was densely covered with lesions, resulting in the loss of baking value. A bacterium was consistently isolated from diseased leaf tissues on nutrient agar (NA). Growth on NA was predominantly grayish white circular bacterial colonies with smooth margins, and the bacterium is rod-shaped, gram-negative and fluorescent on King’s B medium. Seven isolates (ND04A-ND04C and ZSXF02-ZSXF05) were selected for molecular identification and pathogenicity tests. Genomic DNA of the bacterium was extracted and the housekeeping gene of cts (encoding citrate synthase) was amplified with the primers cts-Fs/cts-Rs (forward primer cts-Fs: 5’-CCCGTCGAGCTGCCAATWCTGA-3’; reverse primer cts-Rs: 5’-ATCTCGCACGGSGTRTTGAACATC-3’) (Berge et al. 2014; Sarkar et al. 2004). 409-bp cts gene sequences were deposited in the GenBank database for seven isolates (accession no. OK105110-OK105116). Sequence of seven isolates shared 100% identity with several Pseudomonas cichorii strains within the GenBank database (accession no. KY940268 and KY940271), and the phylogenetic tree of cts genes of the seven isolates clustered with the phylogroup 11 of Pseudomonas syringae (accession no. KJ877799 and KJ878111), which was classified as P.cichorii. To satisfy Koch’s postulates, a pathogenicity test was tested by using a needle to dip a suspension of the bacterium (108 CFU/ml) and pricking three holes in the tobacco leaf. The control plants leaves were needled with sterile water. Each tobacco plant was inoculated with three leaves, and the test was repeated three times. All plants were placed in transparent plastic boxes and incubated in a greenhouse at 25 ± 3°C. The water-soaked spots appeared 24h after inoculation and quickly expanded through leaf veins. Three days after inoculation, all the inoculated leaves showed symptoms similar to those observed in the field. Control plants remained healthy. Only P. cichorii was successfully re-isolated from the lesions, confirming Koch’s postulates. Pseudomonas cichorii can infect eggplant, lettuce, tomatoand other crops, and has a wide range of hosts (Timilsina et al. 2017; Ullah et al. 2015). To our knowledge, this is the first report of P. cichorii causing leaf spot on tobacco in China.

Download Full-text

First Report of Bacterial Leaf Spot of Cucumber Caused by Pseudomonas cichorii in China

Plant Disease ◽

10.1094/pdis-02-18-0267-pdn ◽

2019 ◽

Vol 103 (1) ◽

pp. 147

Author(s):

X. Y. Fu ◽

R. Y. Zhang ◽

Z. Q. Tan ◽

T. Liu ◽

Z. Q. Peng

Keyword(s):

Leaf Spot ◽

Bacterial Leaf Spot ◽

Pseudomonas Cichorii ◽

First Report

Download Full-text

First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

Plant Disease ◽

10.1094/pdis-01-21-0139-pdn ◽

2021 ◽

Author(s):

Jinjie Hu ◽

Qian Zhou ◽

Chaohui Shi ◽

Yexin Ke ◽

Shun Xiao ◽

...

Keyword(s):

Disease Incidence ◽

Solanum Melongena ◽

Stem Canker ◽

Morphological Characters ◽

Single Spore ◽

Specific Primers ◽

Fujian Province ◽

Phomopsis Longicolla ◽

Fungal Isolation ◽

First Report

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus’s pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

Download Full-text

First Report of Pseudomonas cichorii Causing Leaf Spot of Vegetable Sponge Gourd in China

Plant Disease ◽

10.1094/pdis-03-13-0312-pdn ◽

2014 ◽

Vol 98 (1) ◽

pp. 153-153 ◽

Cited By ~ 3

Author(s):

B. J. Li ◽

H. L. Li ◽

Y. X. Shi ◽

X. W. Xie

Keyword(s):

Leaf Spot ◽

Pathogenic Bacteria ◽

Identification System ◽

Pathogenicity Test ◽

Distilled Water ◽

Pseudomonas Cichorii ◽

First Report ◽

Microbial Identification ◽

Pectolytic Activity ◽

Sponge Gourd

A suspect bacterial leaf spot on vegetable sponge gourd (Luffa cylindrical (L.) Roem.) was found in a commercial greenhouse in Pi County, Chengdu City, Sichuan Province, China, in February 2011. Approximately 20 to 30% of plants were affected, causing serious economic loss. Symptoms occurred only on seedlings and consisted of water-soaked, irregularly shaped, black lesions on the surface and margins of cotyledons. A bacterium was consistently isolated on nutrient agar from diseased leaf tissues that had been surface disinfected in 70% ethyl alcohol for 30 s. The bacterium produced small gray colonies with smooth margins, was gram negative, fluoresced on King's B medium, and showed pectolytic activity when inoculated on potato slices. The partial sequences of 16SrRNA gene (1,377 bp) of the bacterium (GenBank Accession No. KC762217), amplified by using universal PCR primers 16SF (5′-AGAGTTTGATCCTGGCTCAG-3′) and 16SR (5′-GGTTACCTTGTTACGACTT-3′), shared 100% similarity with that of Pseudomonas cichorii (GenBank Accession No. HM190228). The vegetable sponge gourd isolate was also identified by using the Biolog Microbial Identification System (version 4.2, Biolog Inc., Hayward, CA) as P. cichorii with the following characteristics (1): negative for arginine dihydrolase, gelatin liquefaction, and N2 production. Positive reactions were obtained in tests for catalase, oxidase, potato rot, utilization of melibiose, and mannitol. Tests were negative for utilization of sucrose, trehalose, D-arabinose, raffinose, cellobiose, and rhamnose. A pathogenicity test was conducted on 4-week-old vegetable sponge gourd plants by spray-inoculation with 108 CFU/ml sterile distilled water on the leaves of 15 vegetable sponge gourd plants and by needle puncture on the stems of 15 other plants with P. cichorii, respectively. Control plants were misted with sterile distilled water or punctured on the stem with a clean needle. Plants were placed in a greenhouse maintained at 28 ± 2°C with relative humidity of 80 to 85%. Symptoms, the same as seen on the original diseased plants, developed after 7 to 10 days on inoculated plants. Control plants remained healthy. The bacterium was readily re-isolated from inoculated plants and identified as P. cichorii using P. cichorii-specific primer hrpla/hrp2a (1). To our knowledge, this is the first report of P. cichorii causing disease on commercially grown vegetable sponge gourd in China. This new finding will provide the basis for developing resources for diagnostics and management, including screening varieties for resistance. References: (1) S. Mazurier et al. J. FEMS Microbiol. Ecol. 49:455, 2004. (2) N. W. Schaad et al., eds. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press, St. Paul, MN, 2001.

Download Full-text