First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus’s pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

Genome sequence resource of Phomopsis longicolla strain YC2-1, a fungal pathogen causing Phomopsis stem blight in soybean

Diaporthe-Phomopsis disease complex causes considerable yield losses in soybean production worldwide. As one of the major pathogens, Phomopsis longicolla T. W. Hobbs (syn. Diaporthe longicolla) is not only the primary agent of Phomopsis seed decay, but also one of the agents of Phomopsis pod and stem blight, and Phomopsis stem canker. We performed both PacBio long read sequencing and Illumina short read sequencing, and obtained a genome assembly for the P. longicolla strain YC2-1, which was isolated from soybean stem with Phomopsis stem blight disease. The 63.1 Mb genome assembly contains 87 scaffolds, with a minimum, maximum, and N50 scaffold length of 20 kb, 4.6 Mb, and 1.5 Mb respectively, and a total of 17,407 protein-coding genes. The high-quality data expand the genomic resource of P. longicolla species and will provide a solid foundation for a better understanding of their genetic diversity and pathogenic mechanisms.

Interactions between zinc and Phomopsis longicolla infection in the roots of Glycine max

To reveal the role of zinc in plant-pathogen interactions, soybean seedlings were grown hydroponically with a range of Zn concentrations, 0.06 (deficient, Zn0), 0.4 (optimal growth), 1.5, 4, 12 and 38 μM (toxic), and were subsequently inoculated with Phomopsis longicolla via the roots. P. longicolla is a hemi-biotroph fungus causing significant soybean yield loss worldwide. In vivo analyses of metal tissue-distribution by micro-X-ray fluorescence showed local Zn mobilization in the root maturation zone in all treatments 14 days post infection. Decreased root and pod biomass, and photosynthetic performance in infected Zn0.4 plants were accompanied by root Zn, jasmonoyl-L-isoleucine (JA-Ile), jasmonic acid, and cell wall-bound syringic acid (cwSyA) accumulation. In the Zn1.5 treatment, 7-fold higher root Zn concentration, JA-Ile, cwSyA, cell wall-bound vanilic acid and leaf jasmonates contributed to maintaining of photosynthesis and pod biomass under infection. Host-pathogen nutrient competition and phenolics accumulation could limit the infection in Zn-deficient plants. The low infection rate in Zn4-treated roots correlated with salicylic and 4-hydroxybenzoic acid, and cell wall-bound p-coumaric acid accumulation. Zn toxicity promoted pathogen invasion and depleted cell wall-bound phenolics. The results show that manipulation of Zn availability may improve soybean resistance to P. longicolla by stimulating phenolics biosynthesis and stress-inducible phytohormones.

Mitochondrial Genome Resource of Phomopsis longicolla, a Fungus Causing Phomopsis Seed Decay in Soybean

Phomopsis seed decay is one of the most devastating seed diseases reducing soybean seed quality worldwide. This disease is caused primarily by a seed-borne fungus, Phomopsis longicolla (syn. Diaporthe longicolla). As part of a genome sequencing project for P. longicolla, we present the mitochondrial genome resource of the isolate MSPL 10-6, one of the most aggressive field isolates. The circular mitochondrial genome is 53,646 bp long with GC content of 34.27%, and it encodes 14 common protein genes, 23 tRNA and two rRNA genes, and 10 introns. Forty-five SNPs and InDels also were identified during comparative analyses with another isolate. The mitochondrial genome sequence provides a useful resource for developing molecular markers for pathogen detection and for improvement of control strategies for the disease. [Formula: see text] Copyright © 2020 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

IDENTIFICACIÓN DE DIVERSIDAD PATOGÉNICA DE Phomopsis sp. CAUSAL DEL TIZÓN DEL TALLO Y VAINA EN SOYA (Glycine max) MEDIANTE MARCADORES MOLECULARES

Phomopsis longicolla (Plo) y P. phaseoli var. sojae (Pps) son causantes del tizón del tallo y vainas (TTV) y decaimiento de semillas (DS) en soja (Glycine max). El objetivo fue estudiar la variabilidad genética y patogénica de Phomopsis al interactuar con cultivares con resistencia variada o susceptibilidad; así como conocer la asociación entre el perfil molecular y patogénico en las interacciones estudiadas. La hipótesis fue que existe variabilidad genética en los germoplasmas fúngico y vegetal que incrementa la diversidad de reacciones específicas durante el desarrollo del TTV. Por lo tanto, en este estudio se propone una metodología para analizar la asociación entre atributos patogénicos (expresión fenotípica de la enfermedad) y marcadores moleculares. Seis aislamientos de Plo y uno de Pps se inocularon en seis cultivares de soja. La variabilidad genética fúngica se evaluó mediante marcadores tipo RAPD e ITS y el comportamiento patogénico de los aislamientos fúngicos a través de la severidad (S%) de la enfermedad generada en los cultivares de soja. La caracterización molecular separó a los aislamientos de Plo de Pps. Las interacciones específicas evidenciaron comportamientos diferenciales entre aislamientos fúngicos y entre cultivares de soja. El estudio permitió identificar asociaciones entre la variabilidad molecular de los patógenos y los comportamientos diferenciales en el conjunto de aislamientos de Phomopsis y cultivares de soja frente a TTV en G. max.

Evaluation of Commercial Soybean Cultivars for Reaction to Phomopsis Seed Decay

Phomopsis seed decay (PSD), caused by Phomopsis longicolla (syn. Diaporthe longicolla), is an economically important soybean disease causing poor seed quality. Planting resistant cultivars is one of the most effective means to control PSD. In this study, 16 commercially available maturity groups IV and V soybean cultivars, including two previously identified PSD-resistant and two PSD-susceptible checks, were evaluated for seed infection by P. longicolla in inoculated and noninoculated plots, and harvested promptly or with a 2-week delay in harvest. The test was conducted at Stoneville, Mississippi, in 2012 and 2013. Seed infection by P. longicolla ranged from 0.5 to 76%, and seed germination ranged from 18 to 97%. One MG IV cultivar (Morsoy R2 491) and five MG V cultivars (Progeny 5650, Progeny 5706, Asgrow 5606, Asgrow 5831, and Dyna-Gro33C59) had significantly (P ≤ 0.05) lower percent seed infected by P. longicolla than their respective susceptible checks and other cultivars in the same tests. Information obtained from this study will be useful for soybean growers and breeders for selection of cultivars for planting or breeding and future genetic studies in the development of cultivars with improved resistance to PSD.