First Report of Apple mosaic virus in Alaska

Apple mosaic virus (ApMV; family Bromoviridae, genus Ilarvirus) is one of the oldest and most economically important viruses of apples (Malus × domestica Borkh.) (1,3). Yield losses may vary from negligible to as much as 50%, depending on the affected cultivar. Although ApMV is found worldwide and occurs naturally in more than 65 plant species (1), it has not been reported to occur in Alaska. In July 2011, noticeably bright yellow mosaic leaves were observed on apple ‘Valentine’ and its rootstalk ‘Ranetka’ from an apple orchard in Wasilla, AK. Leaves were collected and assayed by reverse transcription (RT)-PCR using ApMV-specific primers (2) and total RNA extracted with buffer modifications to RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Briefly, 50 mg of leaf tissue was ground in liquid nitrogen and 450 μl of SE buffer (0.14 M NaCl, 2 mM KCl, 2 mM KH2PO4, 8 mM Na2HPO4·2H2O [pH 7.4], 0.05% vol/vol Tween-20, 2% wt/vol polyvinylpyrrolidone 40, 0.2% wt/vol ovalbumin, 0.5% wt/vol bovine serum albumin, and 0.05% wt/vol sodium azide) was added, and after vigorous vortexing, 80 μl of the mixture was added to 400 μl of RLT buffer supplied by the kit and then processed as directed by the manufacturer (4). Direct sequencing of the predicted ~260-bp PCR product resulted in 97 to 98% nucleotide identities to ApMV accessions in GenBank when analyzed by BLAST. To determine the distribution and incidence of infection in the Wasilla orchard, all 118 apple trees (99 cultivars) were then sampled and assayed serologically by double-antibody sandwich-ELISA with ApMV antiserum according to the manufacturer's protocol (Agdia, Inc., Elkhart, IN). Apple ‘Geneva Early’ and the same ‘Valentine’ tree and its rootstock tested positive for ApMV by ELISA and RT-PCR. Strong diagnostic ApMV symptoms were not apparent on the infected ‘Geneva Early’, which is typical for most commercially grown apples. No leaves were available on the ‘Ranetka' rootstock of ApMV-infected ‘Geneva Early’ for virus indexing. An additional 21 apple trees with no symptoms from an orchard in Talkeetna, AK tested negative to ApMV by ELISA. Limited natural spread of ApMV to other plants may be by pollen and seed transmission. The most prevalent mode of transmission is from ApMV-infected rootstock and grafts. It is important to obtain new propagation plant material from certified virus tested nurseries and to avoid grafting plant material containing ApMV. To my knowledge, this is the first report of ApMV in Alaska. References: (1) R. W. Fulton. No. 83. CMI/AAB Descriptions of Plant Viruses. 1972. (2) W. Menzel et al. J. Virol. Methods 99:81, 2002. (3) M. J. Roossinck et al. Virus Taxonomy. Eight Report of the International Committee on Taxonomy of Viruses, 1049, 2005. (4) J. Thompson et al. J. Virol. Methods 111:85, 2003.

Download Full-text

First Report of Tomato torrado virus Infecting Tomato in Colombia

Plant Disease ◽

10.1094/pdis-11-11-1000 ◽

2012 ◽

Vol 96 (4) ◽

pp. 592-592 ◽

Cited By ~ 9

Author(s):

M. Verbeek ◽

A. M. Dullemans

Keyword(s):

Mosaic Virus ◽

Potato Virus ◽

Polyclonal Antibodies ◽

Sandwich Elisa ◽

Potato Virus X ◽

Rt Pcr ◽

Leaf Extracts ◽

Serological Tests ◽

First Report ◽

Initial Symptoms

Tomato (Solanum lycopersicum L.) plants grown in plastic greenhouses near Villa de Leyva, northeast of Bogota, Colombia showed necrotic spots on the leaves in September 2008. Initial symptoms were necrosis beginning at the base of leaflets that were surrounded by yellow areas. These symptoms resembled those described for Tomato torrado virus (ToTV; family Secoviridae, genus Torradovirus), which was first found in Spain (2). Other (tentative) members of the genus Torradovirus, Tomato marchitez virus (ToMarV), Tomato chocolate spot virus (ToChSV), and Tomato chocolàte virus (ToChV) (3) induce similar symptoms on tomato plants. One sample, coded T418, was stored in the freezer and brought to our lab in 2011. Serological tests (double-antibody sandwich-ELISA) using polyclonal antibodies (Prime Diagnostics, Wageningen, The Netherlands) on leaf extracts showed the absence of Pepino mosaic virus (PepMV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Cucumber mosaic virus (CMV), Potato virus X (PVX), and Potato virus Y (PVY). Leaf extracts were mechanically inoculated onto the indicator plants Physalis floridana, Nicotiana hesperis ‘67A’, and N. occidentalis ‘P1’ (six plants in total) and were kept in a greenhouse at 20°C with 16 h of light. Necrotic symptoms appeared 4 to 5 days postinoculation and resembled those described for ToTV (2). Two dip preparations of systemically infected P. floridana and N. occidentalis leaves were examined by electron microscopy, which revealed the presence of spherical virus particles of approximately 30 nm. To confirm the presence of ToTV, total RNA was extracted from the original leaf material and an inoculated P. floridana and N. occidentalis plant using the Qiagen Plant Mini Kit (Qiagen, Hilden, Germany) following manufacturer's instructions. ToTV-specific primer sets ToTV-Dp33F/ToTV-Dp20R (5′-TGCTCAATGTTGGAAACCCC-3′/5′-AGCCCTTCATAGGCTAGCC-3′, amplifying a fragment of the RNA1 polyprotein with an expected size of 751 bp) and ToTV-Dp1F/ToTV-Dp2R (5′-ACAAGAGGAGCTTGACGAGG-3′/5′-AAAGGTAGTGTAATGGTCGG-3′, amplifying a fragment on the RNA2 movement protein region with an expected size of 568 bp) were used to amplify the indicated regions in a reverse transcription (RT)-PCR using the One-Step Access RT-PCR system (Promega, Madison, WI). Amplicons of the predicted size were obtained in all tested materials. The PCR products were purified with the Qiaquick PCR Purification Kit (Qiagen) and sequenced directly. BLAST analyses of the obtained sequences (GenBank Accession Nos. JQ314230 and JQ314229) confirmed the identity of isolate T418 as ToTV, with 99% identity to isolate PRI-ToTV0301 in both fragments (GenBank Accession Nos. DQ388879 and DQ388880 for RNA1 and RNA 2, respectively). To our knowledge, this is the first report of ToTV in Colombia, and interestingly, since ToTV has been found only in Europe and Australia (1) so far, this is the first report of ToTV on the American continent. References: (1) C. F. Gambley et al. Plant Dis. 94:486, 2010. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007. (3) M. Verbeek et al. Arch. Virol. 155:751, 2010.

Download Full-text

First Report of Lettuce big-vein associated virus (Varicosavirus) Infecting Lettuce in Mexico

Plant Disease ◽

10.1094/pdis-07-13-0761-pdn ◽

2014 ◽

Vol 98 (4) ◽

pp. 573-573 ◽

Cited By ~ 3

Author(s):

D. L. Ochoa-Martínez ◽

J. Alfonsina-Hernández ◽

J. Sánchez-Escudero ◽

D. Rodríguez-Martínez ◽

J. Vera-Graziano

Keyword(s):

Mosaic Virus ◽

Consensus Sequence ◽

Leaf Tissue ◽

Plant Viruses ◽

Australian Isolate ◽

Healthy Plant ◽

Rt Pcr ◽

First Report ◽

Chlorotic Spot ◽

Spanish Isolate

Lettuce (Lactuca sativa) is a common consumed vegetable and a major source of income and nutrition for small farmers in Mexico. This crop is infected with at least nine viruses: Mirafiori lettuce big-vein virus (MiLBVV), Lettuce big-vein associated virus (LBVaV), both transmitted by the soil-borne fungus Olpidium brassicae; Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), Groundnut ringspot virus (GRSV), Lettuce mottle virus (LMoV), Cucumber mosaic virus (CMV), Bidens mosaic virus (BiMV), and Lettuce mosaic virus (LMV) (1). From March to May 2012, a disease on lettuce was observed in the south region of Mexico City displaying mild to severe mosaic, leaf deformation, reduced growth, slight thickening of the main vein, and plant death. At the beginning of the epidemic there were just a few plants with visible symptoms and 7 days later the entire crop was affected, causing a loss of 93% of the plants. It was estimated by counting the number of severely affected or dead plants in three plots. No thrips, aphids, or whiteflies were observed in the crop during this time. Twenty plants with similar symptoms were collected and tested by RT-PCR using the primers LBVaVF 5′-AACACTATGGGCATCCACAT-3′ and LBVaVR 5′-GCATGTCAGCAATCAGAGGA-3′ specific for the coat protein gene of LBVaV, amplifying a 322-bp fragment. Primers CP829F 5′-CCWACTTCATCAGTTGAGCGCTG-3′ and CP1418R 5′-TATCAGCTCCCTACACTATCCTCGC-3′ were used to detect MiLBVV (2). No amplification was obtained for MiLBVaV in any plants tested. PCR products of approximately 300 bp were obtained from four out of 20 symptomatic lettuce samples tested for LBVaV, but not from healthy plant and water controls. These results suggest the presence of another virus in symptomatic lettuce plants. Amplicons were gel-purified and sequenced using LBVaVF and LBVaVR primers. A consensus sequence was generated using the Bioedit v. 5 program. Both sequences of these Mexican lettuce isolates were 100% identical (Accession Nos. KC776266.1 and KC776267.1) and had identities between 94 and 99% to all sequences of LBVaV available in GenBank. Additionally, when alignments were made using ClustalW, these sequences showed identities of 99.7% to Almeria-Spanish isolate (Accession No. AY581686.1); 99.4% to Granada-Spanish isolate (AY581689.1); 99.1% to Dutch isolate (JN710441.1), Iranian isolate (JN400921.1), Australian isolate (GU220725.1), Brazilian isolate (DQ530354.1), England isolate (AY581690.1), and American isolate (AY496053.1); 96.2% to Australian isolate (GU220722.1); 96.3% to Japanese isolate (AB190527.1); and 92.8% to Murcia-Spanish isolate (AY581691.1). Twenty lettuce plants were mechanically inoculated with leaf tissue taken from the four plants collected in the field and tested positive for LBVaV by RT-PCR; 12 days after inoculation, mosaic symptoms were observed in all inoculated plants and six of them were analyzed individually by RT-PCR obtaining a fragment of the expected size. To our knowledge, this is the first report of LBVaV infecting lettuce in Mexico. Further surveys and monitoring of LBVaV incidence and distribution in the region, vector competence of olpidium species, and impact on the crop quality are in progress. References: (1) P. M. Agenor et al. Plant Viruses 2:35, 2008. (2) R. J. Hayes et al. Plant Dis. 90:233, 2006.

Download Full-text

First Report of Alfalfa mosaic virus Infecting Basil (Ocimum basilicum) in California

Plant Disease ◽

10.1094/pdis-06-11-0516 ◽

2012 ◽

Vol 96 (2) ◽

pp. 295-295 ◽

Cited By ~ 3

Author(s):

W. M. Wintermantel ◽

E. T. Natwick

Keyword(s):

Nucleic Acid ◽

Mosaic Virus ◽

Alfalfa Mosaic Virus ◽

Plant Viruses ◽

Ocimum Basilicum ◽

Mechanical Transmission ◽

Rt Pcr ◽

Imperial Valley ◽

First Report ◽

Production Region

Basil (Ocimum basilicum L.) plants collected from three fields in Imperial County, CA in May, 2011 were found to be exhibiting yellowing, chlorotic sectors and spots on leaves, resulting in unmarketable plants. Dodder (Cuscuta spp.) was present in one of the fields, but was not visibly associated with symptomatic plants. Total nucleic acid was extracted from four symptomatic and three asymptomatic basil plants, as well as from the dodder plant with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Nucleic acid extracts were tested by reverse transcription (RT)-PCR for the presence of Alfalfa mosaic virus (AMV) using primers designed to amplify a 350-nt region of the AMV coat protein gene (3). RT-PCR produced bands of the expected size in extracts from all symptomatic plants and the dodder sample. No amplification was obtained from symptomless plants. A 350-nt band amplified from one plant was gel-extracted, sequenced (TACGen, Richmond, CA), and confirmed to be AMV by comparison to sequences available in GenBank (Accession No. K02703). Although serological tests on an initial basil sample were negative for AMV by ELISA using antiserum produced against AMV by R. Larsen, USDA-ARS, Prosser, WA (unpublished), AMV was confirmed by ELISA and RT-PCR in symptomatic Nicotiana benthamiana, N. clevelandii, and Malva parviflora plants following mechanical transmission from basil source plants. The fields with AMV infections were located at opposite ends of the production region from one another, indicating widespread dispersal of AMV in the region. All AMV positive plants were adjacent to alfalfa. Two additional basil plantings in shade houses open to the outside environment did not have AMV symptomatic plants and were also confirmed negative by RT-PCR, but these plantings were at the extreme north end of Imperial Valley agriculture and well away from any alfalfa fields. At the time the basil plantations were sampled for AMV, no aphids were found in any plantations, but during the several weeks prior to finding the AMV-positive plants, cowpea aphid, Aphis craccivora Koch; pea aphid, Acyrthosiphon pisum Harris; blue alfalfa aphid, Acyrthosiphon kondoi Shinji; and spotted alfalfa aphid, Therioaphis maculata Buckton were colonizing Imperial Valley alfalfa fields, producing winged adults. AMV is transmitted by at least 14 aphid species (1), and most aphid populations increase during the late spring in this important desert agricultural region. The acquisition of AMV by dodder suggests the parasitic plant may serve as a vector of AMV within basil fields, although further study will be necessary for clarification. Significant acreage of basil is grown in the Imperial Valley. This acreage is surrounded by extensive and increasing alfalfa production totaling 55,442 ha (137,000 acres) in Imperial County and representing a 21% increase in acreage over 2009 for the same region (2). To our knowledge, this is the first report of basil infected by AMV in California. The proximity of basil production to such a large alfalfa production region warrants the need for enhanced efforts at aphid management in basil production to reduce vector populations and reduce transmission to basil crops. References: (1) E. M. Jaspars and L. Bos. Alfalfa mosaic virus. No. 229 in: Descriptions of Plant Viruses. Commonw. Mycol. Inst./Assoc. Appl. Biol., Kew, England, 1980. (2) C. Valenzuela. Imperial County California Crop and Livestock Report, 2010. (3) H. Xu and J. Nie. Phytopathology 96:1237, 2006.

Download Full-text

First Report of Pea enation mosaic virus Infecting Pea and Broad Bean in Spain

Plant Disease ◽

10.1094/pdis-92-10-1469c ◽

2008 ◽

Vol 92 (10) ◽

pp. 1469-1469 ◽

Cited By ~ 4

Author(s):

T. Tornos ◽

M. C. Cebrián ◽

M. C. Córdoba-Sellés ◽

A. Alfaro-Fernández ◽

J. A. Herrera-Vásquez ◽

...

Keyword(s):

Mosaic Virus ◽

Genomic Sequence ◽

Broad Bean ◽

Direct Sequencing ◽

Plant Viruses ◽

Positive Sample ◽

Yellow Mosaic Virus ◽

First Report ◽

Wilt Virus ◽

Pea Enation Mosaic Virus

During the spring of 2007, pea plants (Pisum sativum L.) (cvs. Utrillo and Floreta) showing virus-like symptoms were observed in several commercial fields in the southern and eastern regions of Catalonia, Spain. Incidence of symptomatic plants ranged from 5 to 15% and was distributed in both small and large patches. Infected plants exhibited yellow mosaic leaf symptoms that later became translucent. Leaves gradually curled and in some cases developed enations near the veins on the abaxial surface. Plants were “bushy” and had shortened internodes. Infection prior to pod formation resulted in pods that were distorted and stunted (1). The infected leaves and pods were tested by indirect-ELISA with a potyvirus-specific antibody (Agdia, Elkhart, IN) and double-antibody sandwich (DAS)-ELISA with antibodies specific to Pea enation mosaic virus (PEMV), Broad bean wilt virus 1 (BBWV-1), Beet western yellow virus (BWYV), Bean yellow mosaic virus (BYMV), Alfalfa mosaic virus (AMV), and Tomato spotted wilt virus (TSWV) (Loewe Biochemica GmbH, Sauerlach, Germany). PEMV was detected in all 24 symptomatic samples that were collected from 10 locations between March 2007 and March 2008. Thirteen of these samples also tested positive for BWYV, but no differences in symptom expression were observed in plants infected with both viruses or PEMV alone. PEMV was also identified in seven broad bean plants (Vicia faba L.) from three additional locations. These plants expressed interveinal yellow mosaic on leaves and deformed pods. The genomic sequence of PEMV-1 (GenBank Accession No. L04573) was used to design primers to amplify a 451-nt segment of the polymerase gene by reverse transcription (RT)-PCR; PEMV-D (5′-TGACCATGAGTCCACTGAGG-3′), PEMV-R (5′-AGTATCTTCCAACAACCACAT-3′). One ELISA-positive sample was analyzed and the expected size amplicon was generated. Direct sequencing (GenBank Accession No. EU652339) revealed that PEMV-1 and our pea isolate have nucleotide sequence identities of 95%. To our knowledge, this is the first report of PEMV in Spain, which might cause important economical losses since PEMV is an important viral disease of pea and other legumes worldwide. Reference: (1) J. S. Skaf and G. A. Zoeten. No. 372 (No. 257 revised) in: Description of Plant Viruses. AAB, Kew, Surrey, England, 2000.

Download Full-text

First Report of Wheat streak mosaic virus in Slovakia

Plant Disease ◽

10.1094/pdis-92-9-1365c ◽

2008 ◽

Vol 92 (9) ◽

pp. 1365-1365 ◽

Cited By ~ 8

Author(s):

O. Kúdela ◽

M. Kúdelová ◽

S. Nováková ◽

M. Glasa

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Mosaic Virus ◽

Direct Sequencing ◽

Sandwich Elisa ◽

Triticum Aestivum L ◽

Wheat Streak Mosaic Virus ◽

Natural Occurrence ◽

First Report ◽

Sequence Identities

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS-8909R 5′ GCATAATGGCTCGAAGTGATG 3′) designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

Download Full-text

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia

Plant Disease ◽

10.1094/pdis-93-7-0761b ◽

2009 ◽

Vol 93 (7) ◽

pp. 761-761 ◽

Cited By ~ 5

Author(s):

M. I. Font ◽

M. C. Córdoba-Sellés ◽

M. C. Cebrián ◽

J. A. Herrera-Vásquez ◽

A. Alfaro-Fernández ◽

...

Keyword(s):

Mosaic Virus ◽

Capsicum Annuum ◽

Polyclonal Antibodies ◽

Plant Viruses ◽

Mottle Virus ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Tomato Plants ◽

First Report ◽

Pepper Plants

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

Download Full-text

First Report of Alfalfa mosaic virus Infecting Tedera (Bituminaria bituminosa (L.) C.H. Stirton var. albomarginata and crassiuscula) in Australia

Plant Disease ◽

10.1094/pdis-04-12-0378-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1384-1384 ◽

Cited By ~ 5

Author(s):

R. A. C. Jones ◽

D. Real ◽

S. J. Vincent ◽

B. E. Gajda ◽

B. A. Coutts

Keyword(s):

Mosaic Virus ◽

Alfalfa Mosaic Virus ◽

Plant Viruses ◽

Yellow Mosaic Virus ◽

Rt Pcr ◽

First Report ◽

Pasture Legumes ◽

Bituminaria Bituminosa ◽

Pcr Products ◽

Burr Medic

Tedera (Bituminaria bituminosa (L.) C.H. Stirton vars albomarginata and crassiuscula) is being established as a perennial pasture legume in southwest Australia because of its drought tolerance and ability to persist well during the dry summer and autumn period. Calico (bright yellow mosaic) leaf symptoms occurred on occasional tedera plants growing in genetic evaluation plots containing spaced plants at Newdegate in 2007 and Buntine in 2010. Alfalfa mosaic virus (AlMV) infection was suspected as it often causes calico in infected plants (1,2) and infects perennial pasture legumes in local pastures (1,3). Because AlMV frequently infects Medicago sativa (alfalfa) in Australia and its seed stocks are commonly infected (1,3), M. sativa buffer rows were likely sources for spread by aphids to healthy tedera plants. When leaf samples from plants with typical calico symptoms from Newdegate (2007) and Buntine (2010) were tested by ELISA using poyclonal antisera to AlMV, Bean yellow mosaic virus (BYMV) and Cucumber mosaic virus (CMV), only AlMV was detected. When leaf samples from 864 asymptomatic spaced plants belonging to 34 tedera accessions growing at Newdegate and Mount Barker in 2010 were tested by ELISA, no AlMV, BYMV, or CMV were detected, despite presence of M. sativa buffer rows. A culture of AlMV isolate EW was maintained by serial planting of infected seed of M. polymorpha L. (burr medic) and selecting seed-infected seedlings (1,3). Ten plants each of 61 accessions from the local tedera breeding program were grown at 20°C in an insect-proof air conditioned glasshouse. They were inoculated by rubbing leaves with infective sap containing AlMV-EW or healthy sap (five plants each) using Celite abrasive. Inoculations were always done two to three times to the same plants. When both inoculated and tip leaf samples from each plant were tested by ELISA, AlMV was detected in 52 of 305 AlMV-inoculated plants belonging to 36 of 61 accessions. Inoculated leaves developed local necrotic or chlorotic spots or blotches, or symptomless infection. Systemic invasion was detected in 20 plants from 12 accessions. Koch's postulates were fulfilled in 12 plants from nine accessions (1 to 2 of 5 plants each), obvious calico symptoms developing in uninoculated leaves, and AlMV being detected in symptomatic samples by ELISA, inoculation of sap to diagnostic indicator hosts (2) and RT-PCR with AlMV CP gene primers. Direct RT-PCR products were sequenced and lodged in GenBank. When complete nucleotide CP sequences (666 nt) of two isolates from symptomatic tedera samples and two from alfalfa (Aq-JX112758, Hu-JX112759) were compared with that of AlMV-EW, those from tedera and EW were identical (JX112757) but had 99.1 to 99.2% identities to the alfalfa isolates. JX112757 had 99.4% identity with Italian tomato isolate Y09110. Systemically infected tedera foliage sometimes also developed vein clearing, mosaic, necrotic spotting, leaf deformation, leaf downcurling, or chlorosis. Later-formed leaves sometimes recovered, but plant growth was often stunted. No infection was detected in the 305 plants inoculated with healthy sap. To our knowledge, this is the first report of AlMV infecting tedera in Australia or elsewhere. References: (1) B. A. Coutts and R. A. C. Jones. Ann. Appl. Biol. 140:37, 2002. (2) E. M. J. Jaspars and L. Bos. Association of Applied Biologists, Descriptions of Plant Viruses No. 229, 1980. (3) R. A. C. Jones. Aust. J. Agric. Res. 55:757, 2004.

Download Full-text

First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

Plant Disease ◽

10.1094/pdis-12-20-2744-pdn ◽

2021 ◽

Author(s):

Qiang Gao ◽

Hai-long Ren ◽

Wanyu Xiao ◽

Yan Zhang ◽

Bo Zhou ◽

...

Keyword(s):

Mosaic Virus ◽

Direct Sequencing ◽

Rna Extraction ◽

Viral Disease ◽

Complete Sequence ◽

Mosaic Disease ◽

Shanxi Province ◽

Watermelon Mosaic Virus ◽

Rt Pcr ◽

First Report

Cucumis metuliferus, also called horned cucumber or jelly melon, is considered as a wild species in the Cucumis genus and a potential material for nematodes- or viruses-resistant breeding (Provvidenti, et al. 1977; Sigüenza et al. 2005; Chen et al. 2020). This species, originating from Africa, has been cultivated as a fruit in China in recent years. In July 2020, a mosaic disease was observed on C. metuliferus growing in five fields (approximately 0.7 hectare) in Urumqi, Xijiang, China, where more than 85~100% of the field plants exhibited moderate to severe viral disease-like leaf mosaic and/or deformation symptoms. Delayed flowering and small and/or deformed fruits on the affected plants could result in yield loss of about 50%. To identify the causal pathogen, the symptomatic leaf samples were collected from the five fields (five plants/points for each field) and their total RNAs were extracted using a commercial RNA extraction kit. The universal potyviral primers (Ha et al. 2008) and specific primers for a number of frequently-occurring, cucurbit crop-infecting viruses including Papaya ringspot virus (PRSV) (Lin et al. 2013), Cucumber mosaic virus (CMV) and Watermelon mosaic virus (WMV) were designed and used for detection by RT-PCR. The result showed that only the WMV primers (forward: 5’-AAGTGTGACCAAGCTTGGACTGCA-3’ and reverse: 5’-CTCACCCATTGTGCCAAAGAACGT-3’) could amplify the corresponding target fragment from the total RNA templates, and direct sequencing of the RT-PCR products and GenBank BLAST confirmed the presence of WMV (genus Potyvirus) in the collected C. metuliferus samples. To complete Koch’s postulates, the infected C. metuliferus leaves were ground in the sodium phosphate buffer (0.01 M, pH 7.0) and the sap was mechanically inoculated onto 30 four-leaf-stage C. metuliferus seedlings (two leaves for each seedling were inoculated) kept in an insect-proof, temperature-controlled greenhouse at 25~28℃. Twenty-five of the inoculated plants were observed to have apparent leaf mosaic similar to the field symptoms two weeks after inoculation, and positive result was obtained in RT-PCR detection for the symptomatic leaves of inoculated plants using the WMV primers aforementioned, confirming the virus as the pathogen of C. metuliferus in Urumqi. To our knowledge, this is the first report of WMV naturally infecting C. metuliferus in China. We obtained the full-length sequence of the WMV Urumqi isolation (WMV-Urumqi) by sequencing the RT-PCR amplicons from seven pairs of primers spanning the viral genome and the 5’RACE and 3’RACE products. The complete sequence of WMV-Urumqi (GenBank accession no. MW345911) is 10046 nucleotides (nt) long and contains an open reading frame that encodes a polyprotein of 3220 amino acids (aa). WMV-Urumqi shares the highest nt identity (95.9%) and aa identity (98.0%) with the Cucurbita pepo-infecting isolation (KX664483) from Shanxi province, China. Our findings provide a better understanding of the host range and genetic diversity of WMV, and a useful reference for virus-resistant breeding involving C. metuliferus.

Download Full-text

First Report of a Lettuce-Infecting Sequivirus in Chile

Plant Disease ◽

10.1094/pd-89-1129a ◽

2005 ◽

Vol 89 (10) ◽

pp. 1129-1129 ◽

Cited By ~ 3

Author(s):

R. Krause-Sakate ◽

A. S. Jadão ◽

A. C. Firmino ◽

M. A. Pavan ◽

F. M. Zerbini ◽

...

Keyword(s):

Polymerase Chain Reaction ◽

Mosaic Virus ◽

Plant Viruses ◽

Yellow Mosaic Virus ◽

Mixed Infections ◽

Replicase Gene ◽

Rt Pcr ◽

Chain Reaction ◽

First Report ◽

Polymerase Chain

Sequiviruses are isometric aphidborne plant viruses. Dandelion yellow mosaic virus (DaYMV), genus Sequivirus, was isolated from dandelion and lettuce in Europe. Lettuce mottle virus (LeMoV), a putative sequivirus, is often found in mixed infections with Lettuce mosaic virus (LMV) in Brazil (3). DaYMV, LeMoV and LMV cause similar mosaics in field-grown lettuce. Differences in biology and sequence suggest that DaYMV and LeMoV are distinct species (2). Forty-two and 101 lettuce samples with mosaic symptoms collected from two locations near Santiago during a survey of lettuce viruses in Chile in 2002 and 2003, respectively, were analyzed for the presence of LeMoV using reverse transcription polymerase chain reaction (RT-PCR). Total RNA was extracted (1) and used for RT-PCR with the specific LeMoV primers pairs Lmo3 (5′ ACATGAGCACTAGTGAGG 3′) and Lmo4 (5′ AGATAGAGCCGTCT GGCG 3′) (2). One of the 42 and three of the 101 samples produced the expected 300-bp fragment. Isometric particles of 30 nm diameter, typical of a sequivirus, were visualized by transmission electron microscopy. These samples were tested using RT-PCR for the presence of LMV and Cucumber mosaic virus (CMV), but no mixed infections were observed. One isolate, Ch36, was reamplified with the degenerate primer pairs DALE 1 (5′ GARTTCAACATGCACGCCAG 3′) and DALE 2 (5′ TTTTTCTCCCCATYCGTCAT 3′) which amplify part of the putative replicase gene (2) and produced a 563-bp fragment that was cloned on pGEM-T Easy (Promega, Madison, WI) and sequenced. The Ch36 product (EMBL Accession No. AM039965) showed 97% amino acid identity with LeMoV from Brazil, 79% with DaYMV, 72% with the sequivirus Parsnip yellow fleck virus, and 34% with the waikavirus Maize chlorotic dwarf virus. To our knowledge, this is the first report of a sequivirus in field lettuce in Chile, and although the virus was found at low incidence, this report extends the range of LeMoV to the western side of the Cordillera de Los Andes. The impact of LeMoV needs to be further analyzed in Chile, Brazil, and possibly other South American countries. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998. In: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on potatoes. M. C. N. Perombelon and J. M. van der Wolff, eds. Scott. Crop Res. Inst. Occasional Publ., Dundee, 1998. (2) A. S. Jadão. Caracterização parcial e desenvolvimento de oligonucleotídeos específicos para detecção de sequivirus infectando alface. Ph.D. thesis. FCA-UNESP-Botucatu, Brazil, 2004. (3) O. Stangarlin et al. Plant Dis. 84:490, 2000.

Download Full-text

First Report of Zucchini yellow mosaic virus in Watermelon in Serbia

Plant Disease ◽

10.1094/pdis-08-11-0664 ◽

2012 ◽

Vol 96 (1) ◽

pp. 149-149 ◽

Cited By ~ 1

Author(s):

A. Vučurović ◽

A. Bulajić ◽

I. Stanković ◽

D. Ristić ◽

D. Nikolić ◽

...

Keyword(s):

Amino Acid ◽

Mosaic Virus ◽

Sandwich Elisa ◽

Zucchini Yellow Mosaic Virus ◽

Yellow Mosaic Virus ◽

Rt Pcr ◽

Total Rna ◽

First Report ◽

Cp Gene ◽

Negative Controls

During a survey of cucurbit viruses in the Gornji Tavankut locality (North Backa District), Serbia in June 2011, field-grown (a surface of 1.8 ha) watermelon plants (Citrullus lanatus [Thunb.] Matsum and Nakai) with mild mosaic symptoms were observed. Large numbers of Aphis gossypii were colonizing the crop. A total of 26 samples, six from plants exhibiting mosaic and 20 from asymptomatic plants, were analyzed by double-antibody sandwich-ELISA using polyclonal antisera virus (Bioreba AG, Reinach, Switzerland) against three cucurbit-infecting viruses known to infect Cucurbita pepo in Serbia: Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus, and Watermelon mosaic virus (3). Commercial positive and negative controls were included in ELISA analysis. Only six symptomatic samples tested positive for ZYMV, but no other tested viruses were found. The virus was mechanically transmitted from a representative ELISA-positive watermelon sample (550-11) to five plants of C. pepo ‘Ezra F1’ and severe mosaic was noticed 10 days after inoculation. For further confirmation of ZYMV infection, total RNA from a naturally infected watermelon plant and symptomatic C. pepo ‘Ezra F1’ plants were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Reverse transcription (RT)-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using primer pair ZY-2 and ZY-3 (2). Total RNA obtained from a Serbian isolate of ZYMV from pumpkin (GenBank Accession No. HM072432) and healthy watermelon plants were used as positive and negative controls, respectively. The expected sizes of the RT-PCR products (1,186 bp) were amplified from naturally and mechanically infected symptomatic samples, but not from healthy tissues. The amplified product that derived from isolate 550-11 was purified (QIAquick PCR Purification Kit, Qiagen), sequenced in both directions, deposited in GenBank (Accession No. JN561294), and subjected to sequence analysis using MEGA4 software. Sequence comparisons revealed a high nucleotide identity of 99.9 to 99.8% and 100 to 99.6% amino acid identity for the CP gene with Serbian ZYMV isolates from C. pepo (Accession Nos. JF308188, HM072431, and HM072432). The nucleotide and deduced amino acid sequences of the entire CP gene (837 nt) of the Serbian ZYMV isolate from watermelon shared 99.9 to 93.7% and 100 to 96.8% identity, respectively, with innumerous isolates of ZYMV deposited in the GenBank (e.g., Accession Nos. AJ420012–17 and FJ705262). To our knowledge, this is the first report of ZYMV spreading its host range to watermelon in Serbia. ZYMV infection has been responsible for severe epidemics on cucurbits throughout the world (1). The presence of ZYMV on watermelon could therefore represent a serious threat for this valuable crop in Serbia, especially considering that it is prevalent in other cucurbit crops in the country and the vectors are widespread. References: (1) H. Lecoq et al. Virus Res. 141:190, 2009. (2) K. G. Thomson et al. J. Virol. Methods 55:83, 1995. (3) A. Vučurović et al. Pestic. Phytomed. (Belgrade) 24:85, 2009.

Download Full-text