Adaptive backstepping sliding mode control design for vibration suppression of earth-quaked building supported by magneto-rheological damper

In this study, the design of adaptive backstepping sliding mode control (ABSMC) has been developed for vibration suppression of earth-quaked building supported by magneto-rheological (MR) damper. The control and adaptive laws developed based on ABSMC methodology has been established according to stability analysis based on Lyupunov theorem. A Single degree of freedom (SDOF) building system has been considered and the earthquake acceleration data used in performance analysis of the proposed controller is based on El Centro Imperial Valley Earthquake. The ABSMC has been compared to classical sliding mode control in terms of vibration suppression in the controlled system subjected to earthquake. The performance of proposed controller has been assessed via computer simulation, which showed its effectiveness to stabilize the building against earthquake vibration and the boundness of estimated stiffness and viscosity coefficients.

Investigation on Seismic Behavior of Historical Tokatlı Bridge under Near-Fault Earthquakes

The main purpose of this study is to compare the static and dynamic behavior of a historical single-span masonry arch bridge under different near-fault earthquakes. The historical Tokatlı Bridge, built in Karabük, is chosen for this study. To investigate the behavior of near-fault earthquakes on the historical masonry bridge, first, a finite element model is built and analyzed under various near-fault earthquakes by using ANSYS and SAP2000. To build a finite element model, 162920 nodes and 47818 elements are used in ANSYS. First, finite element analysis results are compared to each other under Earth gravity. Then, ground motions near the fault are chosen to be used in this study. These earthquakes can be listed as follows: Cape Mend (1992), Kobe (1995), Superstition Hills (1987), Northridge (1994), Imperial Valley (1979), and Chi-Chi (1999). The behavior of the single-span historical bridge is obtained under these ground motions, and the results are compared with each other using contour diagrams using ANSYS. Furthermore, at the end of these analyses, it is observed that the tensile stresses have reached the permissible masonry tensile strength, especially on the upper side of the large belt, on the upper side of the belt, and on the side of the belt, and pose a risk for damage.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

QTL Mapping of Cucurbit yellow stunting disorder virus Resistance in Melon Accession PI 313970

Cucurbit yellow stunting disorder virus (CYSDV) is a devastating viral disease of melon that can cause significant yield and quality losses. This disease has recently emerged as a major concern in the southwest United States and major melon-growing regions across the world. Coinfection of melon by Cucurbit chlorotic yellows virus (CCYV) was recognized in Imperial Valley and neighboring production areas of California and Arizona in 2018, but its importance remains largely unknown. Identifying and deploying CYSDV resistance from elite germplasm is an economical and effective way to manage the disease. A F2:3 population was developed from a cross of susceptible ‘Top Mark’ with CYSDV-resistant PI 313970, which was shown to possess a single recessive gene for resistance to CYSDV. The F2:3 population was phenotyped in the field in response to natural, mixed infections by the two viruses, CYSDV and CCYV in the Fall melon seasons of 2018 and 2019. Phenotypic data (foliar yellowing) from both years were not useful for mapping CYSDV resistance quantitative trait loci (QTL), as PI 313970 and CYSDV-resistant F2:3 plants exhibited yellowing symptoms from CCYV coinfection. QTL analysis of the relative titer of CYSDV calculated from reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) data identified one locus on chromosome 3 at the physical location of S5-28,571,859 bp that explained 20% of virus titer variation in 2018 but was undetected in 2019. A locus on chromosome 5 between S5-20,880,639 to S5-22,217,535 bp explained 16% and 35% of the variation in CYSDV titer in 2018 and 2019, respectively. One or both of the markers were present in six of 10 putative melon CYSDV resistance sources. Markers flanking the 2019 QTL were developed and can be used in marker-assisted breeding of CYSDV-resistant melons.

PARAMETRIC STUDY OF CABLE STAYED BRIDGE USING DIFFERENT PYLON CONFIGUARTION

Cable stayed bridge are the most flexible bridge and getting popularity because of its economy for longer spans. Cable stayed bridges have good stability, optimum use of structural materials, aesthetic, low design and maintenance costs, and efficient structural characteristics. Therefore, this type of bridges are given preference for long span crossings compared to suspension bridges. A study is carried out to find the dynamic effect on different configuration of pylons of a cable stayed bridge. A pylon is inclined at 5o , 10o , 15o , 20o , 25o and 30o with vertical and horizontal axis both and compared with vertical pylon to study the dynamic response of bridge. The 3D bridge models are prepared on CSI BRIDGE software and bridge is analyzed seismically by Imperial Valley 1947, Earthquake. The bridge response in terms of Pylon, Girder and Cable axial force, moment and torsion is obtained. The study reveals that the different angle of the pylon has great influence in the seismic response of cable stayed bridge. We are getting minimum axial force at 10o in cable at main span, girder at main span and pylon.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.