First report of Pectobacterium versatile causing potato soft rot in Oregon and Washington

Potato (Solanum tuberosum cv. Norkotah) tubers with symptoms of soft rot were submitted to Oregon State University, Hermiston Agricultural Research and Extension Center Plant Clinic in 2019. One submission in May, originated from a field with poor emergence and seed piece decay (~20% affected) in Umatilla County, Oregon. The second submission, in September, originated from a field in Washington. From each submission, ~100 mg tissue at the margin of infection was washed with distilled water, excised, macerated in 500 L sterile distilled water for 5 minutes. The resulting solution was streaked on crystal violet pectate (CVP) medium and incubated at 28°C for 24 hours. One colony, representative of the many white colonies that formed depressions on CVP plates, was isolated from each submission. Bacterial isolates from Oregon and Washington were named JB56A and JB133A, respectively, and preserved in Luria-Bertani (LB) broth with 15% glycerol at -80°C for long-term storage. Genomic DNA was extracted from JB56A and JB133A cultures grown in LB broth overnight at 30°C using the Wizard SV Genomic DNA kit. The partial dnaX gene (537 bp) was amplified from genomic DNA of each isolate using dnaXf/dnaXr primers (Slawiak et al. 2009) and sequenced. These sequences were deposited to the NCBI GenBank Database, accession numbers MW930747 (JB56A) and MW930748 (JB133A). BLAST analyses (Altschul et al. 1990) using default parameters indicated that the dnaX sequences of JB56A and JB133A were 99.2% (533/537) and 98.7% (530/537) identical to that of P. versatile SCC1 (CP021894). A condensed maximum likelihood tree was built using the partial dnaX sequence of the two query strains, twelve Pectobacterium reference strains to include all known species of Pectobacterium, and four Dickeya species as an outgroup (Fig. S1). JB56A and JB133A formed a monophyletic clade with P. versatile SCC1. Potato (cv. Upstate Abundance) tuber and stem bioassays (Ma et al. 2018) were conducted twice to assess the pathogenicity of these isolates. Tubers were wounded with a sterile 2 mm wide wooden applicator stick and 5 μl culture grown in LB broth overnight (~109 CFU) was pipetted into the wound. Tubers were incubated at 29°C for 24 hours and cut through puncture sites to observe symptoms. Stems of four- or five-week-old plants were wounded with a sterile toothpick about 10 cm above the soil line and a smear of JB56A or JB133A grown on LB agar was inserted into the wound using a toothpick and incubated in a greenhouse for 72 hours. Positive controls (D. dianthicola ME23) and negative controls (no bacteria) were included in both assays. Tubers and stems exhibited disease symptoms after 24 and 72 hours, respectively, following inoculation with JB56A, JB133A, and D. dianthicola ME23. No symptoms were observed for negative controls. The identity of bacteria re-isolated from the margin of stem lesions was confirmed by partial dnaX sequence analyses. P. versatile was recently described as a distinct species based on whole genome sequence comparisons (Portier et al. 2019). In 2018, we isolated P. versatile from potato stems with blackleg disease in New York, and a recent study found that it was isolated in the US from an iris in 1946 (Ma et al. 2021; Portier et al. 2019). However, the geographic distribution and importance of this pathogen in the US remains largely unknown. To our knowledge, this is the first report of potato soft rot caused by P. versatile in Oregon and Washington, two important potato producing states.

Download Full-text

First Report of Dickeya solani Causing Soft Rot in Imported Bulbs of Hyacinthus orientalis in China

Plant Disease ◽

10.1094/pdis-09-14-0916-pdn ◽

2015 ◽

Vol 99 (1) ◽

pp. 155-155 ◽

Cited By ~ 4

Author(s):

X. F. Chen ◽

H. L. Zhang ◽

J. Chen

Keyword(s):

16S Rrna ◽

The Netherlands ◽

Bacterial Pathogen ◽

Soft Rot ◽

Potato Production ◽

Sterile Water ◽

First Report ◽

Hyacinthus Orientalis ◽

Dickeya Solani ◽

Negative Controls

A bacterial pathogen, Dickeya solani, emerged as a major threat to potato (Solanum tuberosum) production in Europe in 2004 and has spread to many potato-growing regions via international trade. In December 2013, soft rot symptoms were observed in hyacinth (Hyacinthus orientalis) bulbs imported from the Netherlands into China at Ningbo Port. Diseased bulbs gave off an offensive odor. The base and internal parts of diseased bulbs rotted, and the margins of diseased tissues showed brown discoloration. Isolation on nutrient agar glucose (NAG) medium resulted in dominating colonies of characteristic “fried egg” morphology (1). One colony was chosen for further investigation and tentatively named “isolate 6165-3.” Under microscopic visualization after gram stain, the cells of isolate 6165-3 were gram-negative, motile, and rod shaped. The isolate was then identified as a member of genus Dickeya using the Biolog GN microplate. The 16S rRNA, recA, and dnaX sequences of isolate 6165-3 were subsequently determined and deposited in GenBank with accession numbers KM405240, KM405241, and KM405242, sharing 99% (16S rRNA), 100% (recA), and 100% (dnaX) nucleotide identity with those of known D. solani isolates, respectively. By this means, the isolate 6165-3 was identified as D. solani (1,2). To confirm the pathogenicity of the isolate, four plants each of 30-day-old hyacinth, 14-day-old potato, and 60-day-old moth orchid (Phalaenopsis amabilis) were inoculated with suspensions of the isolate with a concentration of 108 CFU/ml in sterile water by stabbing. Plants were incubated in a climate chamber at 28°C during the day and 24°C during the night with a relative humidity of 93% and a photoperiod of 12/12 h. Plants inoculated with sterile water were included as negative controls. After 2 or 3 days, typical symptoms such as water-soaked lesions and soft rot developed around the inoculation point, while the negative controls remained symptomless. Koch's postulates were fulfilled by re-isolating bacteria from lesions, which had identical sequence and morphology characters with the inoculated isolate. This is the first report of intercepted D. solani on hyacinth bulbs imported from the Netherlands into China, indicating that D. solani can spread via hyacinth. Further spread of the pathogen into potato production might lead to immeasurable economic consequences for China. References: (1) P. F. Sarris et al. New Dis. Rep. 24:21, 2011. (2) J. M. van der Wolf et al. Int. J. Syst. Evol. Microbiol. 64:768, 2014.

Download Full-text

First Report of Curvularia aeria on Etlingera linguiformis from Nagaland, India

Plant Disease ◽

10.1094/pdis-01-14-0060-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1580-1580 ◽

Cited By ~ 2

Author(s):

C. Kithan ◽

L. Daiho

Keyword(s):

Leaf Surface ◽

Agricultural Research ◽

Disease Incidence ◽

Indian Agricultural Research Institute ◽

Mountain Range ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

First Report ◽

Initial Symptoms

Etlingera linguiformis (Roxb.) R.M.Sm. of Zingiberaceae family is an important indigenous medicinal and aromatic plant of Nagaland, India, that grows well in warm climates with loamy soil rich in humus (1). The plant rhizome has medicinal benefits in treating sore throats, stomachache, rheumatism, and respiratory complaints, while its essential oil is used in perfumery. A severe disease incidence of leaf blight was observed on the foliar portion of E. linguiformis at the Patkai mountain range of northeast India in September 2012. Initial symptoms of the disease are small brown water soaked flecks appearing on the upper leaf surface with diameter ranging from 0.5 to 3 cm, which later coalesced to form dark brown lesions with a well-defined border. Lesions often merged to form large necrotic areas, covering more than 90% of the leaf surface, which contributed to plant death. The disease significantly reduces the number of functional leaves. As disease progresses, stems and rhizomes were also affected, reducing quality and yield. The diseased leaf tissues were surface sterilized with 0.2% sodium hypochlorite for 2 min followed by rinsing in sterile distilled water and transferred into potato dextrose agar (PDA) medium. After 3 days, the growing tips of the mycelium were transferred to PDA slants and incubated at 25 ± 2°C until conidia formation. Fungal colonies on PDA were dark gray to dark brown, usually zonate; stromata regularly and abundantly formed in culture. Conidia were straight to curved, ellipsoidal, 3-septate, rarely 4-septate, middle cells broad and darker than other two end cells, middle septum not median, smooth, 18 to 32 × 8 to 16 μm (mean 25.15 × 12.10 μm). Conidiophores were terminal and lateral on hyphae and stromata, simple or branched, straight or flexuous, often geniculate, septate, pale brown to brown, smooth, and up to 800 μm thick (2,3). Pathogen identification was performed by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi (ITCC Accession No. 7895.10). Further molecular identity of the pathogen was confirmed as Curvularia aeria by PCR amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA by using primers ITS4 and ITS5 (4). The sequence was submitted to GenBank (Accession No. MTCC11875). BLAST analysis of the fungal sequence showed 100% nucleotide similarity with Cochliobolus lunatus and Curvularia aeria. Pathogenicity tests were performed by spraying with an aqueous conidial suspension (1 × 106 conidia /ml) on leaves of three healthy Etlingera plants. Three plants sprayed with sterile distilled water served as controls. The first foliar lesions developed on leaves 7 days after inoculation and after 10 to 12 days, 80% of the leaves were severely infected. Control plants remained healthy. The inoculated leaves developed similar blight symptoms to those observed on naturally infected leaves. C. aeria was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. The pathogenicity test was repeated twice. To our knowledge, this is the first report of the presence of C. aeria on E. linguiformis. References: (1) M. H. Arafat et al. Pharm. J. 16:33, 2013. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (3) K. J. Martin and P. T. Rygiewicz. BMC Microbiol. 5:28, 2005. (4) C. V. Suberamanian. Proc. Indian Acad. Sci. 38:27, 1955.

Download Full-text

First Report of Leaf Spot Caused by Pseudomonas cichorii on Coreopsis lanceolata in Italy

Plant Disease ◽

10.1094/pdis-93-9-0967a ◽

2009 ◽

Vol 93 (9) ◽

pp. 967-967 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

C. Moretti ◽

M. L. Gullino

Keyword(s):

Leaf Spot ◽

Casein Hydrolysate ◽

Its Region ◽

Soft Rot ◽

Chrysanthemum Morifolium ◽

Luria Bertani ◽

Nutrient Broth ◽

Bacterial Leaf Spot ◽

Pseudomonas Cichorii ◽

First Report

Coreopsis lanceolata L. (Compositae), an ornamental species grown in parks and gardens, is very much appreciated for its long-lasting flowering period. In August of 2008, pot-grown plants with necrotic leaf lesions were observed in a commercial nursery located near Biella (northern Italy). Lesions were present, especially along the margin of basal leaves, and sometimes had a chlorotic halo. On infected leaves, dark brown necrosis developed. Leaf stalks were sometimes affected. In many cases, the leaves, especially those at collar level, were withered. Of 1,500 plants, 15% were infected by the disease. Microscopic examination did not reveal any fungal structures within the lesions. Small fragments of tissue from 30 affected leaves were macerated for 15 min in casein hydrolysate and 0.1-ml aliquots of the resulting suspension were spread onto Luria Bertani agar (LB) and potato dextrose agar (PDA). Plates were maintained at 22 ± 1°C for 48 h. No fungi were isolated from the leaf spots on LB or PDA. Colonies similar to those of Pseudomonas spp. were consistently isolated on LB. Colonies were fluorescent on King's medium B, levan negative, oxidase positive, potato soft rot negative, arginine dihydrolase negative, and tobacco hypersensitivity positive (LOPAT test). The bacterial colonies were identified as Pseudomonas cichorii (2). The internal transcribed spacer (ITS) region of rDNA was amplified using primers 27F and 1492R and sequenced (GenBank Accession No. FJ534557). BLAST analysis (1) of the 998-bp segment showed a 98% homology with the sequence of P. cichorii. The pathogenicity of one isolate was tested twice by growing the bacterium in nutrient broth shake cultures for 48 h at 20 ± 1°C. The suspension was centrifuged, the cell pellet resuspended in sterile water to a concentration of 107 CFU/ml, and 30 4-month-old healthy coreopsis plants were sprayed with the inoculum. The same number of plants was sprayed with sterile nutrient broth as a control. After inoculation, plants were covered with plastic bags for 48 h and placed in a growth chamber at 20 ± 1°C. Five days after inoculation, lesions similar to those seen in the field were observed on all plants inoculated with the bacterium, but not on the controls. Ten days later, 40% of the leaves were withered. Isolations were made from the lesion margins on LB and the resulting bacterial colonies were again identified as P. cichorii. The pathogen caused the same symptoms also on plants of Dendranthema frutescens (cv. Camilla), Chrysanthemum morifolium (cvs. Eleonora and Captiva), and an Osteospermum sp. (cv. Wild side) when artificially inoculated with the pathogen with the same methodology. The same bacterial leaf spot caused by P. cichorii was observed in 2005 in other nurseries in the same area on Phlox paniculata (3). To our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on C. lanceolata in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) H. Bergey et al. Bergey's Manual on Determinative Bacteriology. Williams and Wilkins, Baltimore, MD, 1994. (3) A. Garibaldi et al. Plant Dis. 89:912, 2005.

Download Full-text

First Report of Fusarium proliferatum Causing Rot of Garlic Bulbs (Allium sativum) in India

Plant Disease ◽

10.1094/pdis-08-11-0649 ◽

2012 ◽

Vol 96 (2) ◽

pp. 290-290 ◽

Cited By ~ 9

Author(s):

N. Ravi Sankar ◽

Gundala Prasad Babu

Keyword(s):

Sodium Hypochlorite ◽

Allium Sativum ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Its Region ◽

Fusarium Proliferatum ◽

Distilled Water ◽

Sequence Comparisons ◽

First Report ◽

Plant Pathol

In September 2009, diseased garlic bulbs (Allium sativum L. cv. Yamuna Safed) were received from producers and exporters in Hyderabad, Andra Pradesh, India. From 2009 to 2010, similar symptoms were observed on stored garlic bulbs (cvs. Yamuna Safed and Agrifound White) in Chittoor, Kadapa, and Hyderabad districts. In some locations, approximately 60% of the garlic bulbs were affected. At first, infected bulbs showed water-soaked, brown spots and then the disease progressed as small, slightly depressed, tan lesions. A total of 120 diseased samples were collected from all localities. Infected tissues were surface sterilized in 1% sodium hypochlorite for 2 min, rinsed three times in sterile distilled water, plated on potato dextrose agar (PDA), and incubated at 25°C for 7 days. Resultant fungal colonies were fast growing with white aerial mycelium and violet to dark pigments. Hyphae were septate and hyaline. Conidiophores were short, simple, or branched. Microconidia were abundant, single celled, oval or club shaped, measuring 4.5 to 10.5 × 1.3 to 2.5 μm, and borne in chains from both mono-and polyphialides. Macroconidia were not produced. On the basis of morphological characteristics, the pathogen was identified as Fusarium proliferatum (Matsushima) Nirenberg (2). Identification was confirmed by amplification of the internal transcribed spacer (ITS) region. Genomic DNA was extracted from pure cultures of an isolate, and the ITS region was amplified using the ITS4/5 primer pair. PCR amplicons of approximately 574 bp were obtained from isolates, and sequence comparisons with GenBank showed 99% similarity with F. proliferatum (Accession No. FN868470.1). Sequence from this study was submitted to GenBank nucleotide database (Accession No. AB646795). Pathogenicity tests were conducted with three isolates of the fungus following the method of Dugan et al. (1). Each assay with an isolate consisted of 10 garlic cloves disinfected in 1% sodium hypochlorite for 45 s, rinsed with sterile distilled water, and injured to a depth of 4 mm with a sterile 1-mm-diameter probe. The wounds were filled with PDA colonized by the appropriate isolate from a 5-day-old culture. Ten cloves for each tested isolate received sterile PDA as a control. The cloves were incubated at 25°C for 5 weeks; tests were repeated once. After 17 days, rot symptoms similar to the original symptoms developed on all inoculated cloves and F. proliferatum was consistently reisolated from symptomatic tissue, fulfilling Koch's postulates. No fungi were recovered from control cloves. F. proliferatum has been reported on garlic in the northwestern United States (1), Serbia (4), and Spain (3). To our knowledge, this is the first report of F. proliferatum causing rot disease on garlic bulbs in India. References: (1) F. M. Dugan et al. Plant Pathol. 52:426, 2003. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) D. Palmero et al. Plant Dis. 94:277, 2010. (4) S. Stankovic et al. Eur. J. Plant Pathol. 48:165, 2007.

Download Full-text

First Report of Leaf Spot of Dieffenbachia picta and Aglaonema commutatum Caused by Burkholderia gladioli in Argentina

Plant Disease ◽

10.1094/pdis-93-5-0550c ◽

2009 ◽

Vol 93 (5) ◽

pp. 550-550 ◽

Cited By ~ 1

Author(s):

A. M. Alippi ◽

A. C. López

Keyword(s):

Burkholderia Cepacia ◽

Disease Incidence ◽

Soft Rot ◽

Distilled Water ◽

First Report ◽

Burkholderia Gladioli ◽

Sterile Needle ◽

Pcr Products ◽

Humidity Chamber ◽

Physiological Tests

During May of 2008 (austral autumn), an uncharacterized disease was observed on Dieffenbachia picta (Lodd.) Schott and Aglaonema commutatum Schott in commercial greenhouses in Pontevedra (34°45′6″S, 58°42′42″W), Argentina. Affected plants showed irregular, brown lesions on leaves, approximately 15 to 20 mm in diameter, surrounded by water-soaked haloes that progressed inward from the margins. Water-soaked rotting symptoms were also observed in petioles. Disease incidence approached 80%. Abundant bacterial streaming was observed from lesions when examined at ×100. Bacteria consistently isolated from lesions formed cream-colored, glistening, convex colonies on sucrose peptone agar and produced a yellowish green, diffusible, nonfluorescent pigment on King's medium B. Four isolates from different symptomatic plants were selected for further study. All were aerobic, gram-negative rods that accumulated poly-β-hydroxybutyrate inclusions. In LOPAT tests, all induced a hypersensitive response in tobacco plants, caused soft rot of potato tubers, and were positive for levan, negative for arginine dihydrolase, and variable for oxidase. All isolates oxidized glucose, did not hydrolyze starch and were able to rot onion slices. Colonies developed at 41°C but not at 4°C. With the API 20NE test strips and database (bioMerieux, Buenos Aires, Argentina), all isolates matched (99% identity) Burkholderia cepacia, but their inability to metabolize cellobiose and sucrose further identified them as B. gladioli. For molecular identification, 23S rDNA was amplified by PCR using B. gladioli-specific primers LP1 and LP4, which yielded a 700-bp product (3), and PCR-restriction fragment length polymorphism of 16S rDNA using AluI (2). PCR products were identical to those from the type strain for B. gladioli, ICMP 3950, isolated from Gladiolus spp. that had been included in all tests for comparison. Pathogenicity was verified on D. picta and A. commutatum by spraying the plants with bacterial suspensions in sterile distilled water at 108 CFU/ml with and without wounding the leaves with a sterile needle and also by injection-infiltration of bacterial suspensions at 105 CFU/ml. In addition, another host plant, Gladiolus communis L., was inoculated in the same manner. Controls were sprayed or infiltrated with sterile distilled water. After 48 h in a humidity chamber, plants were kept at 25 ± 3°C in a greenhouse. In all hosts, symptoms were first detected 3 days after inoculation and lesions expanded to resemble natural infections within 4 to 7 days. All strains caused necrosis around the inoculation sites and lesions were identical to those induced by the ICMP reference strain. Bacteria were reisolated from each host tested and then the original and reisolated strains were compared by enterobacterial repetitive intergeneric consensus-PCR (1); DNA fingerprints of the reisolated strains were identical to those of the original strains, thereby fulfilling Koch's postulates. No lesions were observed on controls or on plants inoculated by spraying without wounding, suggesting that bacteria gain entry through wounds. On the basis of PCR and physiological tests the pathogen was identified as B. gladioli (2–4). To our knowledge, this is the first report of B. gladioli on Dieffenbachia and Aglaonema spp. References: (1) F. J. Louws et al. Appl. Environ. Microbiol. 60:2286, 1994. (2) C. Van Pelt et al. J. Clin. Microbiol. 37:2158, 1999. (3) P. W. Whitby et al. J. Clin. Microbiol. 38:282, 2000. (4) E. Yabuuchi et al. Microbiol. Immunol. 36:1251, 1992.

Download Full-text

First Report of Fusarium ipomoeae Causing Peanut leaf Spot in China

Plant Disease ◽

10.1094/pdis-01-21-0226-pdn ◽

2021 ◽

Author(s):

Manlin Xu ◽

Xia Zhang ◽

Jing Yu ◽

zhiqing Guo ◽

Ying Li ◽

...

Keyword(s):

Leaf Spot ◽

Genomic Dna ◽

Block Design ◽

Management Strategies ◽

Morphological Characteristics ◽

Ethanol Solution ◽

Distilled Water ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report

Peanut (Arachis hypogaea L.) is one of the most economically important crops as an important source of edible oil and protein. In August 2020, circular to oval-shaped brown leaf spots (2-6 mm in diameter) with well-defined borders surrounded by a yellow margin were observed on peanut plant leaves in Laixi City, Shandong Province, China. Symptomatic plants randomly distributed in the field, the incidence was approximately 5%. Leave samples were collected consisted of diseased tissue and the adjacent healthy tissue. The samples were dipped in a 70% (v/v) ethanol solution for 30 s and then soaked in a 0.1% (w/v) mercuric chloride solution for 60 s. The surface-sterilized tissues were then rinsed three times with sterile distilled water, dried and placed on Czapek Dox agar supplemented with 100 μg/ml of chloramphenicol. The cultures were incubated in darkness at 25 °C for 3–5 days. Fungal colonies were initially white and radial, turning to orange-brown in color, with abundant aerial mycelia. Macroconidia were abundant, 4 to 7 septate, with a dorsiventral curvature, and were 3.3–4.5 × 18.5–38.1 μm (n=100) in size; microconidia were absent; chlamydospores were produced in chains or clumps, ellipsoidal to subglobose, and thick walled. The morphological characteristics of the conidia were consistent with those of Fusarium spp. To identify the fungus, an EasyPure Genomic DNA Kit (TransGEN, Beijing, China) was used to extract the total genomic DNA from mycelia. The internal transcribed spacer region (ITS rDNA) and the translation elongation factor 1-α gene (TEF1) were amplified with primers ITS1/ITS4 (White et al. 1990) and EF1/EF2 (O’Donnell et al. 1998), respectively. Based on BLAST analysis, sequences of ITS (MT928727) and TEF1 (MT952337) showed 99.64% and 100% similarity to the ITS (MT939248.1), TEF1 (GQ505636.1) of F. ipomoeae isolates. Sequence analysis confirmed that the fungus isolated from the infected peanut was F. ipomoeae (Xia et al. 2019). The pathogenicity of the fungus was tested in the greenhouse. Twenty two-week-old peanut seedlings (cv. Huayu20) grown in 20-cm pots (containing autoclaved soil) were sprayed with a conidial suspension (105 ml−1) from a 15-day-old culture. Control plants were sprayed with distilled water. The experiment was conducted as a randomized complete block design, and placed at 25 °C under a 12-h photoperiod with 90% humidity. Symptoms similar to those in the field were observed on leaves treated with the conidial suspension ten days after inoculation, but not on control plants. F. ipomoeae was re-isolated from symptomatic leaves but not from the control plants. Reisolation of F. ipomoeae from inoculated plants fulfilled Koch's postulates. To our knowledge, this is the first report of F. ipomoeae causing peanut leaf spot in China. Our report indicates the potential spread of this pathogen in China and a systematic survey is required to develop effective disease management strategies.

Download Full-text

First report of stalk bacterial soft rot of sugarcane caused by Dickeya zeae in China

Plant Disease ◽

10.1094/pdis-10-20-2234-pdn ◽

2020 ◽

Author(s):

yanchang Yang ◽

Ziting Yao ◽

Mu-Qing Zhang ◽

Chengwu Zou ◽

Baoshan Chen

Keyword(s):

Pure Water ◽

Bacterial Species ◽

Evolutionary Relationship ◽

Soft Rot ◽

Bacterial Suspension ◽

Rrna Gene ◽

Post Inoculation ◽

Distilled Water ◽

Sugarcane Cultivar ◽

First Report

In late September 2019, seven stalks of about 1400 stalks of sugarcane cultivar Zhongzhe 1 exhibited soft rot symptoms in a trial plot in Beihai city, Guangxi province of China. Symptoms included scorched and collapsed leaves, maceration of stalks, and sour smelling exudates from the stalks (Supplementary Fig. S1). Severely diseased stalks had collapsed and were dead. Internal stalk fragments of 5 × 5 mm were collected at the junction of healthy and diseased tissue after surface-sterilization of stalks with 70% ethanol for one minute, and three times rinsing with sterile distilled water. Stalk fragments were placed on Luria–Bertani agar medium (1 % w/v tryptone, 0.5 % w/v yeast extract, 1 % w/v NaCl, 1 % w/v agar, pH7.0) and plates were put in an incubator at 30°C for 48h. Four types of bacterial colonies were obtained, and small and white colonies with irregular margins were the most dominant. A single colony of each type was diluted in sterile distilled water and aliquots of each suspension were streaked on fresh medium plates to obtain pure cultures. Ten eight-week-old stalks (11 th leaf stage) of sugarcane plants, which derived from cuttings of symptomless cultivar Zhongzhe 1, were inoculated by injection of 300 μl of bacterial suspension (3.5x108 CFU/ml) into the stalks. Another 10 stalks were injected with pure water and served as control. The inoculated plants were kept in a greenhouse at 25-37℃.Among the four types of bacteria, only strain BH9 induced symptoms that were identical to those of diseased canes observed in the field (Supplementary Fig. S1). Elongated water-soaked lesions were observed around the inoculation sites three days post inoculation. Five of the 10 BH9-inoculated plants had collapsed two days later. Water-soaked stalks had a sour smell similar to the filed diseased plants. Eight days post inoculation, all BH9-inoculated plants exhibited symptoms but control plants remained symptomless up to 30 days after inoculation. Uniform white colonies with irregular margins were isolated from the inoculated stalks that developed soft rot symptom, and these bacteria caused again stalk soft rot symptoms when inoculated to a new batch of 10 healthy plants. The 16S rRNA gene of strain BH9 was amplified by PCR with primer pair fD2/rP1 and the PCR amplicons from three independent colonies were sequenced. The sequences of the three amplicons were identical (Accession No. MT723897). BLAST alignments of the 16S rDNA sequence from BH9 strain with the GenBank database revealed that BH9 belonged to the genus Dickeya (98.5% identity between D. zeae BH9 and D. zeae EC1). Further PCR assays and sequencing of three genes, DNA polymerase III gamma subunit gene dnaX with primers dnaXf/dnaXr, DNA gyrase gene gyrB with primers gyrBf1/gyrBr1, and recombinase A gene recA with primers recAf/recAr, were performed to identify the species within the genus Dickeya (Zhang et al., 2014). BH9 sequences of these genes (Accession No. MT723898 to MT723900) had highest identity (97.5%, 97.6%, and 97.7%, respectively) with those from D. zeae EC1 (GenBank accession No. CP006929.1). To determine the evolutionary relationship of BH9 to other Dickeya species and strains, a phylogenetic analysis was performed using dnaX, gyrB, and recA sequences. As shown in Supplementary Fig. S2, BH9 clustered with D. zeae strains and formed a lineage distinguishable from other Dickeya species. Among the closest strains, D. zeae NCPPB3531 (Accession No. CM001980.1) was isolated from potato and D. zeae CSL RW192 (Accession No. CM001972.1) from river water (Pritchard et al., 2013). Consequently, strain BH9 was identified as D. zeae. This bacterial species has been reported to cause soft rot in rice (Pu et al., 2012), banana (Zhang et al., 2014), maize (Martinez-Cisneros et al., 2014), and clivia (Hu et al., 2018). To the best of our knowledge, this is the first report of a bacterial stalk rot caused by D. Zeae in sugarcane. In fact, low incidence of D. zeae-caused stalk soft rot was recently found in sugarcane fields in Fusui County, about 150 km north to Beihai. Given the potential threat of this disease to the local sugarcane industry, the mode of transmission, cultivar resistance, and measures to control the disease should be investigated.

Download Full-text

First Report of Dickeya fangzhongdai causing soft rot in Orchids in Canada

Plant Disease ◽

10.1094/pdis-04-21-0771-pdn ◽

2021 ◽

Author(s):

Aiguo Zhou ◽

Jingbai Nie ◽

Yanli Tian ◽

Jiacheng Chuan ◽

Baishi Hu ◽

...

Keyword(s):

Genome Sequence ◽

Genomic Dna ◽

Draft Genome ◽

Leaf Tissue ◽

Soft Rot ◽

Draft Genome Sequence ◽

Diseased Leaf ◽

Sterile Water ◽

Accession Number ◽

First Report

Dickeya fangzhongdai was originally described as the causal agent of bleeding canker of pear tree in China. Recently, D. fangzhongdai was isolated and identified as the causal agent of soft rot in an orchid plant purchased in a local supermarket in Prince Edward Island, Canada. A water-soaked dark green spot on the leaf surface was observed and later became larger soft rot symptom. The origin of the orchid plants was traced back to a producer in Ontario, Canada who propagated them from with cuttings originally imported from the Netherlands and Taiwan. Bacterial isolations were made from a soft rot lesion on an orchid leaf by surface sterilization of small pieces of marginal tissue of the diseased leaf in 70% alcohol. The small pieces of leaf tissue were then washed three time using sterile water, and immersed in drops of sterile water. Bacterial streaming was observed under the microscope and non-fluorescing bacterial colonies were isolated on King’s B and casamino acid-peptone-glucose agar plates and purified as isolates 908, 909, 910 and 911. The DNA samples were extracted from the four isolates, as well as the diseased leaf tissue, and tested by using a qPCR assay with the specific primer/probe set (DfF/DfR/DfP) for D. fangzhongdai (Tian et al. 2020). The assay yielded PCR amplicons of 135 bp with a melting temperature of 86.5±0.6 °C as did two control reactions using genomic DNA from D. fangzhongdai strains JS5T and QZH3 originally isolated in China, providing presumptive identification of the orchid isolates as D. fangzhongdai. To fulfill Koch’s postulates, freshly purchased healthy orchid plants (n=4) were inoculated by leaf injection with the bacterial isolates obtained in this study and strains JS5 T and QZH3 at ~107 CFU/ml. Three leaves of the same side of the plants were inoculated with the same strains as triplicates. Sterile water was used as the negative control. Inoculated plants were incubated in a growth chamber with a 16 h photoperiod at 23 °C. Water soaked lesions developed in 3-5 days after inoculation followed by soft rotting in leaves inoculated with the new bacterial strains from orchid plants while strain QZH3 caused soft rot in 10 days after inoculation (Fig. S1). The non-fluorescing bacteria on King’s B plates with colony morphology similar to those inoculated were re-isolated from the inoculated leaves and confirmed to be D. fangzhongdai by qPCR. Phylogenetic analysis of the assembled 16S rRNA sequence of isolate 908 (GenBank accession number: MT984340), together with GenBank data of all Dickeya spp. and some Pectobacterium spp, using neighbor-joining (NJ) method inferred with MEGA X software (Kumar et al. 2018) showed that isolate 908 clustered with strains JS5T and QZH3 at a phylogenetic distance of 0.0007. This clearly indicated that isolate 908 and JS5T and QZH3 belong to the same genus. Species-level identification of isolate 908 was achieved by genome sequencing and analysis based on average nucleotide identity (ANI). Genomic DNA of isolate 908 was sequenced with Illumina MiSeq to provide approximately 180X genome coverage. After quality checking using FastQC (Andrews 2010), de-novo assembly was performed with VelvetOptimiser v2.2.6 (Zerbino and Birney 2008). The draft genome size of strain 908 was 4,938,027 bp consisting of 76 contigs with 56.8% G+C content and 63,801 bp as N50. The draft genome was checked for misassembled fragments using QUAST v5.0.2 (Gurevich et al. 2013) and found to be of good quality. The draft genome sequence is deposited in GenBank under the accession number of JADCNJ000000000. The draft genome sequence of strain 908 was compared to that of D. fangzhongdai JS5T type strain genome using FastANI v1.2 (Jain et al. 2018) resulting in an ANI value of 98.9%, which is above the 95% cut-off for the same species. Previously, it was reported that D. fangzhongdai caused soft rot in orchid in Europe (Alič et al. 2018) and in onions in New York (Ma et al. 2020). The difference in virulence among D. fangzhongdai strains warrants further investigation and their pathogenicity on potato is being investigated to evaluate any threat to the potato industry. To our knowledge, this is the first report of D. fangzhongdai causing soft rot disease on orchids in Canada and North America.

Download Full-text

First Report of Potato mop-top virus on Potato in Poland

Plant Disease ◽

10.1094/pdis-94-7-0920a ◽

2010 ◽

Vol 94 (7) ◽

pp. 920-920 ◽

Cited By ~ 9

Author(s):

M. Budziszewska ◽

P. Wieczorek ◽

K. Nowaczyk ◽

N. Borodynko ◽

H. Pospieszny ◽

...

Keyword(s):

Pcr Amplification ◽

Potato Production ◽

Amino Acid Identity ◽

Sequence Comparisons ◽

First Report ◽

Pcr Products ◽

Potato Mop Top Virus ◽

Negative Controls ◽

North And South America ◽

Das Elisa

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5′GGTTTGTTTACCACCCTTGG3′ (3) and PMTV2 5′AAAAGCCTGAGCGGTTAATTG3′ (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

Download Full-text

First Report of Diaporthe novem Causing Postharvest Rot of Kiwifruit During Controlled Atmosphere Storage in Chile

Plant Disease ◽

10.1094/pdis-02-14-0183-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1274-1274 ◽

Cited By ~ 5

Author(s):

G. A. Díaz ◽

B. A. Latorre ◽

S. Jara ◽

E. Ferrada ◽

P. Naranjo ◽

...

Keyword(s):

Aerial Mycelium ◽

Soft Rot ◽

Storage Conditions ◽

Negative Control ◽

Its2 Region ◽

Conidial Suspension ◽

Controlled Atmosphere ◽

First Report ◽

Postharvest Rot ◽

Negative Controls

Chile is considered the third major exporter of kiwifruits (Actinidia deliciosa (A. Chev.) C. F. Liang & A. R. Ferguson) worldwide after Italy and New Zealand (1). The genus Diaporthe Nitschke (anamorph: genus Phomopsis) has been reported as causing postharvest rot in kiwifruit (4). During the current study, 1,400 fruits arbitrarily collected from seven controlled atmosphere (CA) rooms after 90 days of storage conditions (2% O2, 5% CO2) determined that 21.5% of the fruit were affected by decay and 0.86% developed symptoms different than those caused by Botrytis cinerea, the main postharvest pathogen associated to kiwifruit. Symptoms were soft rot with brown skin that started at the stem-end and in severe cases affected the entire fruit. Internally, affected fruit showed browning and watery tissues. Twelve affected fruits were surface disinfested (75% ethanol) and small pieces of internal rotten tissues were placed on acidified potato dextrose agar (APDA) for 7 days at 20°C. Twelve isolates were obtained, and four of them were identified morphologically and molecularly as Diaporthe ambigua, a species that has been previously described causing rot in stored kiwifruits in Chile (2). However, eight other flat, white to grayish colonies with sparse dirty-white aerial mycelium at the edge of the dish were obtained (3). Black pycnidia contained unicellular, hyaline, biguttulate, oval to cylindrical alpha conidia, with obtuse ends of (7.9) 6.7 (5.3) × (2.9) 2.5 (2.1) μm (n = 30). These isolates were tentatively identified as a Diaporthe sp. The species identification was determined by sequencing comparison of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA (GenBank Accession Nos. KJ210020 to 24, KJ210027, and KJ210033) and a portion of beta-tubulin (BT) (KJ210034 to 38, KJ210041, and KJ210047) using primers ITS4-ITS5 and Bt2a-Bt2b, respectively. BLAST analyses showed 99 to 100% identity with D. novem J.M. Santos, Vrandecic & A.J.L Phillips reference ex-type (KC343156 and KC344124 for ITS and BT, respectively) (3). Eighteen mature kiwifruits cv. Hayward were inoculated using a sterile cork borer on the surface of the fruit and placing 5-mm agar plugs with mycelial of D. novem (DN-1-KF). An equal number of fruits treated with sterile agar plugs were used as negative controls. After 30 days at 0°C under CA, all inoculated fruit showed rot symptoms with lesions 7.8 to 16.4 mm in diameter. The same D. novem isolate was inoculated with 30 μl of a conidial suspension (106 conidia/ml) on the surface of 18 ripe kiwifruits that were previously wounded and non-wounded as described above. An equal number of wounded and non-wounded fruits, treated with 30 μl sterile water, were used as negative controls. All inoculated wounded fruits developed rot symptoms with necrotic lesions of 14.1 to 20.2 mm of diameter after 14 days at 25°C. Inoculated non-wounded and negative control fruits remained symptomless. Koch's postulates were fulfilled by re-isolating D. novem only from the symptomatic fruits. To our knowledge, this is the first report of rot caused by D. novem on kiwifruit during cold storage in Chile and worldwide. Therefore, both Diaporthe species appears to be associated to Diaporthe rot of kiwifruit in Chile. References: (1) Belrose, Inc. World Kiwifruit Review. Belrose, Inc. Publishers, Pullman, WA, 2012. (2) J. Auger et al. Plant Dis. 97:843, 2013. (3) R. Gomes et al. Persoonia 31:1, 2013. (4) L. Luongo et al. J. Plant Pathol. 93:205, 2011.

Download Full-text