scholarly journals First report of lettuce necrotic leaf curl virus infecting cultivated lettuce in France

Plant Disease ◽  
2020 ◽  
Author(s):  
Laurence Svanella-Dumas ◽  
Armelle Marais ◽  
Chantal Faure ◽  
Marie Lefebvre ◽  
Jonathan Gaudin ◽  
...  
Keyword(s):  
The Netherlands ◽  
Open Field ◽  
Sequence Data ◽  
Natural Infection ◽  
Post Inoculation ◽  
Sequencing Analysis ◽  
First Report ◽  
Reference Isolate ◽  
Leaf Curl Virus ◽  
Leaf Curl

Lettuce necrotic leaf curl virus (LNLCV, genus Torradovirus, family Secoviridae) has a bipartite single-stranded RNA genome and has so far only been reported in the Netherlands in open field lettuce (Verbeek et al. 2014). It was the first Torradovirus described from non-tomato host and, contrary to whitefly-transmitted tomato torradoviruses, aphids are its natural vectors (Verbeek et al. 2017). In October 2019, a symptomatic lettuce (JG3, cv. “Tregoney”) was collected in an open field in southwestern France. Symptoms included stunted and deformed leaves with light necrosis and yellow spotting along minor veins of older leaves. Double-stranded RNAs were purified from JG3 leaves as described (Marais et al. 2018) and a cDNA library prepared and analyzed by Illumina NovaSeq sequencing. Analysis of sequence data identified two nearly fully assembled RNAs integrating respectively 28.9% and 60.9% of the sequencing reads and sharing respectively 85.5% and 83.3% nucleotide (nt) identity with the RNAs 1 and 2 of the LNLCV reference isolate, (NC_035214 and NC_035219, respectively). To confirm the presence of LNLCV in the original JG3 plant, it was used to mechanically inoculate indicator Nicotiana benthamiana, Chenopodium quinoa and C. amaranticolor plants. Only N. benthamiana developed symptoms, in the form of smaller and yellowed leaves. All inoculated plants were tested one month post-inoculation for the presence of LNLCV. Total RNAs were extracted according to Foissac et al. (2005) and used for RT-PCR tests with primers designed from the alignment between NC_035214 and our RNA1 sequence (LNLCV-S 5’-ATATTTTCCAAGTTGGAGGCTC-3’ and LNLCV-R 5’-AGTRACAAAGGGACTAACTG-3’). LNLCV was detected in 3 out of 4 inoculated N. benthamiana plants. The full length RNA1 sequence (7577 nt) and the near complete RNA2 (5286 nt, lacking 3 nt at the 5’ end as compared to NC_035219) could be assembled from the JG3 sequencing data and have been deposited in GenBank (MW172270 and MW172271, respectively). The lettuce JG3 isolate RNA1 shows 86.5% nt identity with the reference isolate while the taxonomically informative protease-polymerase regions share 96.8% aa identity. JG3 RNA2 shares 84.8% nt identity with NC_035219 while the movement protein and capsid subunits share respectively 92.5% and 98.3% aa identity. The smaller upstream ORF that slightly overlaps with the large MP-CP1/2/3 ORF is also conserved and shows 94.8% aa identity with the reference isolate. To our knowledge, this represents the first report of a natural infection of LNLCV in cultivated lettuce in France and anywhere outside the Netherlands. Since no other viruses were detected in the sequence dataset, LNLCV is most likely responsible for the mild necrosis and leaf deformation symptoms observed on the JG3 plant that appear to be similar to those initially described for LNLCV (Verbeek et al. 2014). While the pathogenicity of LNLCV in lettuce appears to be firmly established, further studies are needed to establish its distribution and prevalence, to understand why this pathogenic and aphid-transmitted virus is not more widely reported and whether it has the potential to increase in impact as a potential emerging agent on field lettuce crops.

scholarly journals First report of natural infection of tomato yellow leaf curl virus on cucumber in China

2020 ◽  
Vol 102 (4) ◽  
pp. 1371-1371
Author(s):  
Feng Zhu ◽  
Qin-Qin Zhang ◽  
Peng-Xiang Zhu ◽  
Qi-Ping Zhang ◽  
Meng-Yao Cao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Tomato yellow leaf curl virus in Tomato in Mauritius

Plant Disease ◽  
2010 ◽  
Vol 94 (10) ◽  
pp. 1261-1261 ◽  
Author(s):  
K. Lobin ◽  
K. L. Druffel ◽  
H. R. Pappu ◽  
S. P. Benimadhu
Keyword(s):  
Open Field ◽  
Consensus Sequence ◽  
Economic Importance ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Reunion Island ◽  
First Report ◽  
Réunion Island ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato is a food crop of economic importance in Mauritius. It is grown in open fields and in greenhouses by more than 4,500 small- and large-scale growers throughout the island. Open-field tomatoes are mostly a cooking type, while those produced in greenhouses are salad types. Acreage under production is approximately 900 ha with an annual production of approximately 11,500 tons. In September 2009, plants with reduced leaf size, leaf curling, and yellow margins associated with plant dwarfism were observed in open-field tomato crops in the southern part of the island. Whitefly populations were observed in these fields. These symptoms were suggestive of infection with a leaf curl-causing begomovirus such as Tomato yellow leaf curl virus (TYLCV) (family Geminiviridae, genus Begomovirus). Similar symptoms caused by TYLCV were reported in neighboring Reunion Island in 1997 (1). In October 2009, 3.15 ha of tomato were surveyed in the south at la Flora, Camp diable, L'escalier, Plein Bois, and Plaine Magnien to monitor the disease. Symptomatic plants were observed in all areas surveyed and disease incidence ranged from 5 to 50%. The disease was more prevalent in tomato ‘Swaraksha’ and ‘Epoch’, which are widely cultivated. Seventeen symptomatic leaf samples from La flora, Camp Diable, L'escalier, Plein Bois, and Plaine Magnien areas were collected for begomovirus detection by PCR. Total DNA was extracted and tested using AV494 (5′-GCC YAT RTA YAG RAA GCC MAG-3′) and AC1048 (5′-GGR TTD GAR GCA TGH GTA CAT G-3′) primers from the core region of the coat protein that detect most begomoviruses (2). Seventeen of 17 samples (100%) gave an amplicon of expected size. PCR amplicons from selected samples were cloned and sequenced. The consensus sequence was assembled, and the sequence (GenBank Accession no. HM448447) had 100% identity with nucleotides 458 to 1,036 of the Almeria isolate (GenBank Accession no. AJ489258), an isolate from the Netherlands (FJ439569), Morocco (EF060196), and Spain (AJ519441), and nucleotides 451 to 1,029 of the RE4 isolate from Reunion Island (AM409201). On the basis of the initial sequence obtained, specific primers (RM-TYLCV 583C: 5′-CCA CGA GTA ACA TCA CTA ACA-3′ and RM-TYLCV 895F: 5′-GGA ACA GGC ATT AGT TAA GAG-3′) were designed to amplify the remainder of the genomic sequence by PCR followed by cloning and sequencing of the amplicons. At least three clones were sequenced to arrive at the consensus sequence. Sequence comparisons showed that the TYLCV isolate from Mauritius had the greatest sequence identity (95 to 100%) with the above isolates. To our knowledge, this is the first report of TYLCV in tomato in Mauritius. In view of the economic importance of leaf curl disease in tomato in many parts of the world, an island-wide survey needs to be carried out to monitor the disease and assess its impact on tomato production. References: (1) M. Peterschmitt et al. Plant Dis. 83:303, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Papaya leaf curl virus Associated with Leaf Curl Disease in Cestrum nocturnum in Pakistan

Plant Disease ◽  
2020 ◽  
Vol 104 (11) ◽  
pp. 3089
Author(s):  
Aamir Lal ◽  
Eui-Joon Kil ◽  
Kainat Rauf ◽  
Muhammad Ali ◽  
Sukchan Lee
Keyword(s):  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Papaya Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen
Keyword(s):  
Capsicum Annuum ◽  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Yellow Leaf ◽  
First Report ◽  
Spanish Isolate ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

scholarly journals A Novel Source of Resistance to Tomato Yellow Leaf Curl Virus Exhibiting a Symptomless Reaction to Viral Infection

1998 ◽  
Vol 123 (6) ◽  
pp. 1004-1007 ◽  
Author(s):  
M. Friedmann ◽  
M. Lapidot ◽  
S. Cohen ◽  
M. Pilowsky
Keyword(s):  
Natural Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Susceptible Parent ◽  
Partial Dominance ◽  
Disease Symptoms ◽  
Leaf Curl Virus ◽  
Very High ◽  
Different Levels ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), transmitted by the tobacco whitefy (Bemisia tabaci Genn.), can be devastating to tomato (Lycopersicon esculentum L.) crops in tropical and subtropical regions. The development of resistant cultivars is the best option for control of TYLCV. However, all the available resistant commercial cultivars tested at the Volcani Center, when inoculated with TYLCV, developed different levels of disease symptoms. In this study, we report the development of a breeding line, TY172, which is a symptomless carrier of TYLCV. Line TY172, whether infected in the greenhouse with viruliferous whiteflies, or when grown in the field under natural infection, showed no symptoms of the disease. Viral DNA was detected in infected TY172 plants, albeit at much lower levels than a susceptible infected control. In addition, grafting experiments using infected susceptible scions grafted onto TY172 stocks, showed that even when exposed continuously to very high levels of virus, line TY172 did not develop disease symptoms, nor did it accumulate high levels of the virus. When TY172 was crossed with susceptible lines, the hybrids exhibited milder symptoms and lower viral content than the susceptible parent, yet higher than that of TY172, suggesting a partial dominance for the TY172 resistance. Upon inoculation of F2 populations, the amount of symptomless individuals appeared in a ratio of≈7:64. This suggests that at least three genes may account for the resistance.

scholarly journals First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 428-428 ◽  
Author(s):  
F. Haj Ahmad ◽  
W. Odeh ◽  
G. Anfoka
Keyword(s):  
Tomato Yellow Leaf ◽  
Virus Species ◽  
Yellow Leaf ◽  
First Report ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Symptomatic Plant ◽  
Mexican Isolate ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Tomato (Solanum lycopersicum Mill.) is one of the most economically important vegetable crops in Jordan. Tomato cultivation in many countries in the Mediterranean basin is affected by several virus species belonging to Tomato yellow leaf curl virus complex (3). In March 2011, a field experiment was conducted at Horet Al-Sahen region to screen tomato breeding lines for resistance against TYLCD. Unexpectedly, severe TYLCD symptoms, including leaf curling, yellowing, and severe stunting were observed on some plants belonging to the F5 generation of a breeding line that was supposed to be resistant to the virus. One symptomatic plant was transferred into the greenhouse and used for whitefly transmission. The virus isolate was maintained on a susceptible tomato landrace by serial transmission using biotype B of the whitely vector (Bemisia tabaci). To confirm begomovirus infections, total nucleic acids were extracted from leaf tissues as previously described (4) and viral DNA genomes were amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). RCA products were then subjected to restriction digestion with different enzymes. Two DNA fragments of 1,035 bp and 1,760 bp were the products of EcoRl-digestion. Following sequencing, BLASTn analysis showed that the small fragment (1,035 bp) (GenBank Accession No. JX444576) corresponding to nts 2,408 to 2,690 of Watermelon chlorotic stunt virus from Jordan (WmCSV-[JO]) (EU561237) had approximately 99% nt identity with WmCSV-[JO] and other isolates from Israel (EF201809) and Iran (AJ245652), while the second fragment (1,760 bp) which corresponds to nts 117 to 1,877 of TYLCV genome had 98% nt identities with the Mexican isolate of TYLCV (FJ609655). Two pairs of primers (TYLCV29F1: TATGGCAATCGGTGTATC/TYLCV29R1: GTGTCCAGGTATAAGTAAG) and (TYLCV29F2: GAGAGCCCAATTTTTCAAG/TYLCV29R2: GGGAATATCTAGACGAAGAA) were used to amplify full TYLCV genome. Sequence analysis showed that TYLCV (JX444575) had the highest (98%) nt identity with the Mexican isolate of TYLCV (FJ609655). Because Squash leaf curl virus and WmCSV were recently reported in Jordan (1,2), we further investigated whether SLCV was also involved in the disease; therefore, two pairs of SLCV-specific primers (SLCVF-Sal (TATAGTCGACGTTGAACCGGATTTGAATG)/SLCVR-Sal (TATAGTCGACCTGAGGAGAGCACTAAATC) (DNA-A) and SLCVF-Hindlll (ATTAAAGCTTAGTGGTTATGCAAGGCG)/SLCVR-Hindlll (ATTAAAGCTTGGCTGCACCATATGAACG) (DNA-B) were used in PCR using RCA products as template. The expected sizes of DNA-A (2,639 bp) (JX444577) and DNA-B (2,607 bp) (JX444574) could successfully be amplified from the original symptomatic plant. Phylogenetic analysis showed that DNA-A was closely related to SLCV isolates from Lebanon (HM368373) and Egypt (DQ285019) with 99% nt identity, while DNA-B had highest nt identity (99%) with the Israeli isolate of SLCV (HQ184437). To our knowledge, this is the first report on the association of SLCV and WmCSV with TYLCD. Further studies will be carried out to investigate whether tomato can act as an inoculum source for these two viruses. References: (1) A. Al-Musa et al. J. Phytopath. 156:311, 2008 (2) A. Al-Musa et al. Virus Genes 43:79, 2011. (3) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (4) J. L. Potter et al. Plant Dis, 87:1205, 2003.

scholarly journals First Report of Sweet potato leaf curl Georgia virus on Sweet Potato in China

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1388-1388 ◽  
Author(s):  
Y. Qin ◽  
Z. Zhang ◽  
Z. Qiao ◽  
Q. Qiao ◽  
D. Zhang ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Nucleotide Sequence ◽  
Sweet Potato ◽  
Leaf Growth ◽  
Negative Control ◽  
Post Inoculation ◽  
Natural Occurrence ◽  
Potato Leaf ◽  
First Report ◽  
Leaf Curl

Begomoviruses infecting sweet potato (Ipomoea batatas) are phylogenetically distinct from other members of the genus Begomovirus, and have been named “sweepoviruses” (1). Sweepoviruses cause sweet potato yield losses and cultivar decline, and have been found in China (1,3). In 2011, a survey was conducted to determine the incidence, genetic diversity, and distribution of sweepoviruses in China. Thirty sweet potato cuttings showing upward leaf curl, leaf roll, chlorosis, and stunting were collected from fields in Jiangsu, Guangxi, Guizhou, Shanxi, Henan, and Hebei Provinces. Five-leaf growth stage I. setosa plants were inoculated by side-grafting with scions from these samples, and grown in an insect-proof greenhouse in 20-cm-diameter clay pots. Each sample was grafted onto three replicate plants. Healthy, non-grafted I. setosa plants were used as the negative control treatment. Total nucleic acids were extracted from 100 mg fresh leaves harvested 30 days post-inoculation (dpi) from symptomatic and negative control plants using the Universal Genomic DNA Extraction Kit (TaKaRa, Dalian, China). Universal primers for amplification of Geminiviruses (BM-V [5′-KSGGGTCGACGTCATCAATGACGTTRTAC-3′] and BM-C [5′-AARGAATTCATKGGGGCCCARARRGACTGGC-3′]) (2) were used to amplify the begomovirus A component by PCR assay. A DNA fragment of the expected size (2.8 kb) was obtained from grafted leaf samples of the Hebei Province plant, and was cloned into the pMD-19T vector (TaKaRa). The recombinant plasmid was transformed into competent cells of Escherichia coli strain JM109, and the inserted fragment sequenced. The nucleotide sequence obtained (GenBank Accession No. JX448368) was 2,785 nt long, and contained two open reading frames (ORFs) in the virion sense, and four ORFs in the complementary sense, similar to other monopartite begomoviruses (1). The sequence was compared with sequences in GenBank using BLAST. The results revealed the greatest nucleotide sequence identity, 90.8%, with that of the Sweet potato leaf curl Georgia virus (SPLCGV) from Georgia, United States (AF326775). The sequence also shared identities of <89% with other sweepoviruses, and was therefore designated SPLCGV-China: Hebei: 2011. Comparison of the complete genome sequence of SPLCGV-China: Hebei: 2011 with SPLCGV revealed an 18 nucleotide insertion between AV-1 and AC-3. The results confirmed that the sweet potato sample from which SPLCGV-China: Hebei: 2011 was obtained was infected with SPLCGV. To our knowledge, this is the first report of the natural occurrence of SPLCGV in China. This study will assist with understanding the presence of this virus and genetic diversity of sweepoviruses in China. References: (1) H. P. Bi and P. Zhang. Arch. Virol. 157:441, 2012. (2) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1994. (3) Y. S. Luan et al. Virus Genes 35:379, 2007.

Sign in / Sign up

Export Citation Format

Share Document