scholarly journals First report of rubber tree wilt caused by Ceratocystis fimbriata in China

Plant Disease ◽  
2022 ◽  
Author(s):  
Kecheng Xu ◽  
Ruiqi Zhang ◽  
Jie Li ◽  
Xue Li ◽  
Jing Yang ◽  
...  
Keyword(s):  
Sequence Data ◽  
Rubber Tree ◽  
Morphological Characteristics ◽  
Bootstrap Support ◽  
Outer Cell ◽  
Distilled Water ◽  
Ceratocystis Fimbriata ◽  
Single Spore ◽  
Economic Resource ◽  
First Report

The rubber tree (Hevea brasiliensis) is an important economic resource for the rubber and latex industry. During November 2013 and June 2016, rubber trees showing typical wilt symptoms were found in Mengla, Xishuangbannan, Yunnan, China (N 21° 28', E 101° 33'). Symptomatic trees initially exhibited wilting of foliage on individual branches, then spread to the whole canopy, finally followed by death of the whole tree. Dark-blue to black discoloration was observed in the inner bark and affected xylem, a grayish layer of fungal growth and sporulation occasionally. The disease was detected on 20% of trees surveyed. The diseased tissues of three rubber trees were surface disinfected with 75% ethanol for 30 s and 0.1% mercuric chloride (HgCl2) for 2 min, rinsed three times with sterile distilled water, plated onto potato dextrose agar (PDA), and incubated at 25°C. After 7 days, a fungus was consistently observed growing from the tissue. Three single-spore isolates were obtained. In culture, colonies reaching 69 mm diam within 10 days, mycelium was initially white, then becoming celadon. After 5 days of perithecium formation, observed perithecia were black, globose (173.1 - 237.9 × 175.6 - 217.2 μm) and showed a long black neck (507.3 - 794.1 μm). Ascospore with outer cell wall forming a brim, hat-shaped at the tips of ostiolar hyphae (3.43 × 5.63 μm). Cylindrical endoconidia (10.5 - 39.7 × 3.5 - 6.6 μm) were hyaline. Chain of barrel-shaped conidia (7.2 - 9.5 × 4.1 - 6.2 μm) was found. Aleuroconidia were ovoid or obpyriform, and smooth (10.2 - 14.1 × 8.4 - 10.6 μm). Morphological characteristics of the fungus were consistent with the description of Ceratocystis fimbriata (Engelbrecht and Harrington 2005). The genomic DNA was extracted from isolates (XJm10-2-5, XJm8-2-5, XJm4) using the Chelex-100 method (Xu et al. 2020). The ITS region of rDNA was sequenced using the procedures of Thorpe et al. (2005). Analysis of ITS sequence data (GenBank accessions KJ511488, KJ511485, KT963149) showed that the isolates were 100% homologous to those of the isolates on Punica granatum and Colocasia esculenta from China (GenBank accessions KT963152, MH793673) by BLAST analysis. Neighbor-joining phylogenetic analyse were performed using MEGA 6.06 based on ITS sequences (Fig. 1). Analyses showed that all isolates located on the same clade with all C. fimbriata with a high bootstrap support. Therefore, the fungus was identified as C. fimbriata based on morphology and molecular evidences. Pathogenicity of C. fimbriata isolated from this study was tested by inoculation of three one-year-old pot-grown (3L) seedlings of rubber tree. The soil of three seedlings was inoculated by drenching with 30 ml spore suspension (2.0 × 106 spores / ml). Three control plants were inoculated with 30 ml of sterile distilled water. The experiment was repeated three times. The plants were kept in a controlled greenhouse at 25°C and watered weekly. After the inoculation for one month, all the isolates produced typical wilt symptoms, while control plants showed no symptoms. The original fungus was successfully re-isolated from inoculated trees and identified as C. fimbriata according to the methods described above. The pathogenicity assay showed that C. fimbriata was pathogenic to rubber trees. C. fimbriata was first reported on rubber tree in Brazil (Albuquerque et al. 1972; Silveira et al. 1985). To the best of our knowledge, this is the first report of C. fimbriata causing wilt of rubber tree in China. This finding contributes to understanding the diversity of this pathogen, and it appears to be a significant threat to rubber trees in its ecosystem.

scholarly journals First report of Eucalyptus wilt caused by Chalaropsis thielavioides in China

Plant Disease ◽  
2022 ◽  
Author(s):  
Kecheng Xu ◽  
Ruiqi Zhang ◽  
Xue Li ◽  
Jinglong Zhang ◽  
Hang Zhao ◽  
...  
Keyword(s):  
Rubber Tree ◽  
Morphological Characteristics ◽  
Fungal Growth ◽  
Composite Likelihood ◽  
Likelihood Method ◽  
Bootstrap Support ◽  
Eucalyptus Species ◽  
Distilled Water ◽  
Ceratocystis Fimbriata ◽  
First Report

Eucalyptus species are widely planted in the tropics and subtropics, and eucalyptus is among the most important cash crop in Southern China. One of the most important diseases on eucalyptus is Ceratocystis wilt, caused by the fungus Ceratocystis fimbriata Ellis & Halst., and the genus name Chalaropsis has been proposed for anamorphs of Ceratocystis species (de Beer et al. 2014). During April 2018, severely infected Eucalyptus robusta trees were observed in Kunming, Yunnan Province, China. Symptomatic trees initially exhibited yellowing and wilting of foliage on individual branches, then spread to the whole canopy, sometimes followed by death of the whole tree. Reddish-brown to dark-brown discoloration in the woody xylem of affected trees, sometimes a grayish white layer of fungal growth may be seen. The disease was observed on 16% of trees surveyed. The base of trunks with typical symptoms were collected, then the discolored xylem tissues were surface disinfected with 75% ethanol for 30 s and 0.1% mercuric chloride (HgCl2) solution for 2 min, rinsed three times with sterile distilled water, plated onto potato dextrose agar (PDA) medium, and incubated at 25°C. After 6 days, a fungus was consistently observed growing from the tissue. Three isolates were obtained. In culture, colonies reaching 54mm diam within 15 days, mycelium initially white, then becoming celadon. Endoconidia unicellular, smooth, cylindrical, straight, biguttulate, 11.21 - 32.26 × 4.12 - 5.25 μm. Phialides produced on short, septate, aerial hyphae, lageniform and chain of phialoconidia (3.62 - 5.89 × 31.39 - 65.76 μm) were also observed. Chlamydospores (11.45 - 14.26 × 10.06 - 12.22 μm) were single, dark, thick-walled. Morphological characteristics of the fungus were consistent with the description of Chalaropsis thielavioides (Paulin-Mahady et al. 2002). The two of three isolates were used for molecular identification and genomic DNA was extracted from isolates (EKY2-2-1, EKY2-2-2) using the chelex-100 method (Xu et al. 2020). The ITS region of rDNA was sequenced using the procedures of Thorpe et al. (2005). Analysis of ITS sequence data (GenBank accessions MW242701, MW242702) showed that the isolates were 99% - 100% homologous to isolates of C. thielavioides from Hevea rubber, Monstera deliciosa L. and ants in China and Rosa sp. in Australia (GenBank accessions KT963172, KJ511482, KT963173 and KX954598) by BLAST analysis. Neighbor-joining (NJ) phylogenetic analysis were performed using MEGA 6.06 based on ITS sequences (Fig 1), the evolutionary distances were computed using the Maximum Composite Likelihood method. Analyses showed that both isolates (EKY2-2-1, EKY2-2-2) located on the same clade with all C. thielavioides, and clustered with the C. thielavioides strains with high bootstrap support (97% - 100%). Therefore, the fungus was identified as C. thielavioides based on morphology and molecular evidences. Pathogenicity of C. thielavioides was tested by inoculation of six one-year-old pot grown Eucalyptus citriodora seedlings. The sterilized soil of six seedlings was inoculated by drenching with 20 ml spore suspension (2.0 × 106 spores / ml). Control plants were inoculated with 20 ml of sterile distilled water. The seedlings were kept in a controlled greenhouse at 25°C and watered weekly. After one month incubation, all the isolates produced wilt symptoms, whereas control trees showed no symptoms. The original fungus was successfully re-isolated from inoculated trees and identified as C. thielavioides according to the methods described above, and no fungal growth was observed in the controls, thus satisfying Koch's postulates. Although wilt and canker caused by Ceratocystis fimbriata on eucalyptus have been previously reported in Brazil, Uruguay, Uganda, China and Pakistan (Ferreira et al. 1999; Li et al. 2014; Alam et al. 2017), eucalyptus wilt caused by C. thielavioides has not been reported anywhere. Also, wilt of rubber tree and postharvest rot on carrot caused by C. thielavioides have been reported (Li et al. 2021; Xu et al. 2020). To our knowledge, this is the first report of eucalyptus wilt caused by C. thielavioides in China.

scholarly journals First Report of Wilt of Rubber Tree Caused by Chalaropsis thielavioides in China

Plant Disease ◽  
2020 ◽  
Author(s):  
Xue Li ◽  
Jie Li ◽  
Hua Yong Bai ◽  
Kecheng Xu ◽  
Ruiqi Zhang ◽  
...  
Keyword(s):  
Rubber Tree ◽  
Morphological Characteristics ◽  
Spore Suspension ◽  
Malt Extract ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Ceratocystis Fimbriata ◽  
First Report ◽  
Mould Fungus ◽  
Its Sequence Analysis

Rubber tree (Hevea brasiliensis (Willd. ex Adr. Juss) Müll. Arg.) is used for the extraction of natural rubber and is an economically and socially important estate crop commodity in many Asian countries such as Indonesia, Malaysia, Thailand, India, Sri Lanka, China and several countries in Africa (Pu et al, 2007). Xishuangbanna City and Wenshan City are the main rubber cultivation areas in Yunnan Province, China. In November 2012, rubber tree showing typical wilt symptoms (Fig. 1 A) and vascular stains (Fig. 1 B) were found in Mengla County, Xishuangbanna City. This disease was destructive in these trees and plant wilt death rate reached 5%. The diseased wood pieces (0.5cm long) from trunk of rubber was surface disinfected with 75% ethanol for 30s and 0.1% mercuric chloride (HgCl2) for 2min, rinsed three times with sterile distilled water, plated onto malt extract agar medium (MEA), and incubated at 28℃. After 7 days, fungal-like filaments were growing from the diseased trunk. Six cultures from 6 rubber trunk were obtained and incubated on MEA at 28℃, after 7 days to observe the cultural features. The mycelium of each culture was white initially on MEA, and then became dark green. Cylindrical endoconidia apices rounded, non-septate, smooth, single or borne in chains (8.9 to 23.6 × 3.81 to 6.3μm) (Fig. 1 C). Chlamydospores (Fig. 1 D) were abundant, thick walled, smooth, forming singly or in chains (11.1 to 19.2 × 9.4 to 12.0μm). The mould fungus was identifed as Chalaropsis based on morphology (Paulin-Mahady et al. 2002). PCR amplification was carried out for 3 isolates, using rDNA internal transcribed spacer (ITS) primer pairs ITS1F and ITS4 (Thorpe et al. 2005). The nucleotide sequences were deposited in the GenBank data base and used in a Blast search of GenBank. Blast analysis of sequenced isolates XJm8-2-6, XJm8-2 and XJm10-2-6 (accessions KJ511486, KJ511487, KJ511489 respectively) had 99% identity to Ch. thielavioides strains hy (KF356186) and C1630 (AF275491). Thus the pathogen was identified as Ch. thielavioides based on morphological characteristics and rDNA-ITS sequence analysis. Pathogenicity test of the isolate (XJm8-2) was conducted on five 1-year-old rubber seedlings. The soil of 5 rubber seedlings was inoculated by drenching with 40 ml spore suspension (106 spores / ml). Five control seedlings were inoculated with 40 ml of sterile distilled water. All the seedlings were maintained in a controlled greenhouse at 25°C and watered weekly. After inoculated 6 weeks, all the seedlings with spore suspension produced wilt symptoms, as disease progressed, inoculated leaves withered (Fig. 1 E) and vascular stains (Fig. 1 F) by 4 months. While control seedlings inoculated with sterile distilled water remained healthy. The pathogen re-isolated from all inoculated symptomatic trunk was identical to the isolates by morphology and ITS analysis. But no pathogen was isolated from the control seedlings. The pathogenicity assay showed that Ch. thielavioides was pathogenic to rubber trees. Blight caused on rubber tree by Ceratocystis fimbriata previously in Brazil (Valdetaro et al. 2015), and wilt by Ch. thielavioides was not reported. The asexual states of most species in Ceratocystis are “chalara” or “thielaviopsis” (de Beer et al. 2014). To our knowledge, this is the first report of this fungus causing wilt of rubber in China. The spread of this disease may pose a threat to rubber production in China.

scholarly journals First report of Fusarium cf. longipes associated with maize stalk rot in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Shengbo Han ◽  
Yanyong Cao ◽  
Jie Zhang ◽  
Jie Wang ◽  
Lili Zhang ◽  
...  
Keyword(s):  
Sequence Data ◽  
Fusarium Species ◽  
Apical Cell ◽  
Morphological Characteristics ◽  
Liaoning Province ◽  
Bootstrap Support ◽  
Flowering Stage ◽  
Single Spore ◽  
First Report ◽  
Stalk Rot

In a field survey from 2017 to 2019, Fusarium stalk rot symptoms including discolored, disintegrated stalk pith tissues and lodged plants were observed in maize hybrid lines Fuyu1611, Jidan66, and Danyu8439 grown in fields in Anshan (40o49′39′′N, 122 o34′6′′E), Liaoning province. Its incidence ranged from 15% to 20% and caused a yield loss of up to 30%. Infected pieces of stem tissues were dissected and then sterilized with 1% NaOCl for 1 min, 70% ethanol for 1 min, rinsed 3 times with sterilized ddH2O, and dried with filter paper in hood. Three pieces were placed onto Potato dextrose agar (PDA) and incubated at 25 °C for 5 days. The colonies were single-spore subcultured on PDA at 25 °C for 2 weeks (Leslie and Summerell 2006). Morphological features were observed on PDA and carnation leaf agar (CLA). The average mycelial growth rate was 4.5 to 10.3 mm/day at 25 °C on PDA. The colonies produced aerial mycelia, varying from dense white to grayish-rose, and secreted red pigments in the agar (Fig. 1A; 1B). Macroconidia produced on CLA were long and relatively slender, commonly 4- to 7-septate, averaging 85.6 × 5.2 μm, with thick walls and pronounced dorsiventral curvature with a distinctly foot-shaped and elongated basal cell and an apical cell that was whip-like (Fig. 1C). Microconidia were rarely observed on PDA or CLA. Morphological characteristics of the isolates were similar to the features of Fusarium longipes as previously described (Leslie and Summerell 2006). The portions of three phylogenic loci (EF1-α, RPB1, RPB2) were PCR amplified using the primer pairs EF1/EF2 (O'Donnell et al, 1998), lonR1F/lonR1R (5-TTTTCCTCACCAAGGAGCAGATCATG-3 and 5-CCAATGGACTGGGCAGCCAAAACGCC-3) and lonR2F/lonR2R (5-TATACATTTGCCTCCACTCTTTCCCAT-3 and 5-CGGAGCTTGCGTCCGGTGTGGCCGTTG-3) and sequenced. The consensus sequences were submitted to GenBank (MT513215 and MT997083 for TEF, MT513213 and MT997088 for RPB1; MT513214 and MW020572 for RPB2). BLASTn searches indicated that the nucleotide sequences of the three loci of the two isolates shared 94.52% to 99.69% identity with sequences of F. longipes strains deposited in the GenBank, Fusarium-ID and Fusarium MLST databases (Supplementary Table 1, 3, 4). A phylogram inferred via maximum likelihood analysis of the combined EF-1α, RPB1, RPB2 partial sequence data of Fusarium species (Supplementary Table 2) was inferred using the CIPRIES website (https://www.phylo.org). Isolates LNAS-05-A and LNAS-09-A clustered with F. longipes, with 98% bootstrap support (Fig. 2). Pathogenicity tests were conducted on three-leaf-stage seedlings and flowering-stage c.v. Zhengdan958 and B104 plants according to previously described methods (Ye et al., 2013; Zhang et al. 2016) with minor modifications. Three days after the roots of the seedlings were inoculated with 1 × 106 macroconidia solution, the leaves and stems exhibited typical wilt symptoms (Fig. 1D). Twenty flowering-stage maize plants were drilled individually at the second or third node above the soil using an electric drill (Bosch TSR1080-2-Li) to create a hole (8 mm in diameter). An approximately 0.5 mL mycelia plug (125 mL homogenized hyphal mats + 75 mL sterilized ddH2O) was injected into the hole and covered with Vaseline. Sterilized PDA plugs were used as a control. The stalk tissue of the split internodes turned dark brown and the brown area expanded above and below the injection site by 14 dpi. All of the inoculated plants developed characteristic stalk rot symptoms, whereas no symptoms were observed in the controls (Fig. 1E). The pathogen was re-isolated, and its identity was confirmed by sequencing the above mentioned loci. F. longipes was generally regarded as a tropical Fusarium species (Leslie and Summerell 2006). This is the first report that F. cf. longipes can cause stalk rot of maize under filed condition in a temperate, typical corn belt region of China.

scholarly journals First Report of Coffee Canker Disease Caused by Ceratocystis fimbriata in China

Plant Disease ◽  
2022 ◽  
Author(s):  
Kecheng Xu ◽  
Ruiqi Zhang ◽  
Haixia Lu ◽  
Jinglong Zhang ◽  
Jing Yang ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Molecular Characteristics ◽  
Outer Cell ◽  
Leaf Margin ◽  
Malt Extract ◽  
Distilled Water ◽  
Ceratocystis Fimbriata ◽  
Canker Disease ◽  
First Report

Coffee (Coffea arabica L.) is one of the most important agricultural commodities in the world market. As an important cash crop in China, coffee is cultivated mainly in Yunnan and Hainan provinces. During October 2013 and September 2020, coffee trees showing typical dieback and wilt symptoms were found in Nanping town (N 22° 38', E 101° 0'), Pu’er, and Puwen town (N 22° 32', E 101° 4'), Xishuangbanna in Yunnan province, China. Symptomatic trees initially exhibited yellowing of foliage, expanding in size along the leaf margin, then became blighted and dry, and the internal xylem in main stem discolored brown to black. Infected trees eventually developed dieback and wilt. Disease incidence ranged from 10% to 22% and 25% to 40% of crown symptoms in the affected coffee trees. In extreme cases, 50% out of 380 trees were affected. The stems of coffee trees with typical symptoms were collected, and then the diseased tissues were surface disinfected with 75% ethanol for 30 s and 0.1% mercuric chloride (HgCl2) solution for 2 min, rinsed three times with sterile distilled water, plated onto potato dextrose agar (PDA) medium, and incubated at 25°C. After 6 days, fungal mycelium was observed growing from the tissue. Three isolates (C3-1, C3-2, and C3-2-1) were obtained by picking spore masses from the apices of perithecia and transferring them to malt extract agar (MEA) medium and incubated at 25°C for 10 days to observe the cultural features. In culture, colonies reaching 65 mm within 10 days, mycelium initially white, then becoming light blue-green. After 6 days of formation, perithecia were black, globose (123.8 - 173.4 μm × 138.2 - 180.6 μm), and showed a long black neck (414.2 - 650.0 μm). Ascospores with outer cell wall forming a brim, hat-shaped, accumulating in a mucilaginous mass at the tips of ostiolar hyphae (4.3 μm × 6.0 μm). Cylindrical endoconidia (14.1 - 45.2 μm × 3.5 - 5.7 μm) were hyaline. Chain of barrel-shaped conidia (6.6 - 10.2 μm × 6.8 - 8.8 μm) were found. Aleuroconidia (10.8 - 16.9 μm × 9.1 - 13.0 μm) were olive-brown, ovoid or obpyriform, and smooth. Morphological characteristics of the fungus were consistent with the description of Ceratocystis fimbriata Ellis & Halst. (Engelbrecht and Harrington 2005). The three isolates were used for molecular identification, and their genomic DNA was extracted using the chelex-100 method (Xu et al. 2020). The internal transcribed spacer (ITS) region of rDNA was sequenced using the procedures of Thorpe et al. (2005). Analysis of the ITS sequence data (GenBank accessions KY580836, KJ511480, and KJ511479) showed that the isolates were 100% homologous to isolates of C. fimbriata from Punica granatum, Camellia sinensis, and Cucumis sativus in China (GenBank accessions KY580891, KY580870, and MH535909, respectively) by BLAST analysis. Neighbor-joining (NJ) phylogenetic analysis was performed using MEGA 6.06 based on the ITS sequences. The three isolates were clustered on the same clade with other C. fimbriata isolates with a high bootstrap value (90%). Therefore, the fungus was identified as C. fimbriata based on both morphological and molecular characteristics. Pathogenicity of the three isolates was tested by inoculating one-year-old pot grown coffee seedlings (C. arabica) through drenching the loams with 30 ml spore suspension (1 × 106 spores/ml). Control plants were inoculated with 30 ml of sterile distilled water. The trees were kept in a controlled greenhouse at 25°C and watered weekly. One month after inoculation, all inoculated plants produced typical dieback and wilt symptoms, whereas the control trees showed no symptoms. The same fungus was isolated from the inoculated trees on PDA and identified as C. fimbriata according to the methods described above, and no fungal growth was observed in the controls, thus fulfilling the Koch's postulates. Coffee canker disease caused by C. fimbriata has been reported in Indonesia and Colombia (Marin et al. 2003). To our knowledge, this is the first report of C. fimbriata causing canker disease of coffee trees in China.

scholarly journals First Report of Red-Fleshed Apple Anthracnose Caused by Colletotrichum siamense

Plant Disease ◽  
2021 ◽  
Author(s):  
Fengying Han ◽  
Yu-tong Zhang ◽  
Zaize Liu ◽  
Lei Ge ◽  
Lian-Dong Wang ◽  
...  
Keyword(s):  
Sequence Data ◽  
Phylogenetic Analyses ◽  
Aerial Mycelium ◽  
Morphological Characters ◽  
Apple Fruit ◽  
Bootstrap Support ◽  
Single Spore ◽  
First Report ◽  
Crucial Information ◽  
Average Size

The red-fleshed apple (Malus niedzwetzkyana) produces a colored fruit and rich anthocyanins and it has become popular among consumers in Shandong (Yang et al 2020). In recent years, anthracnose diseases have been reported in red-fleshed apple orchards and nurseries in Shandong province, China. The incidence of anthracnose in the red-fleshed apple plantings ranges from 50-90%. Initially, anthracnose lesions on fruit begin as sub-circular shaped, sunken, pale brown. Over time black lesions enlarged and coalesced into large necrotic areas. The sunken centers of mature lesion became filled with slimy pink sporulation. In September 2015, fifteen fruit with anthracnose symptoms and sporulation were collected, and 11 single-spore isolates were obtained. Three representative isolates (JNTW11, JNTW2, JNTW33) were used for morphological and molecular characterization. On PDA, the colonies were initially white and turned into pale brown in three days. Orange-brown pigmentation was produced near the center on the reverse. Aerial mycelium was cottony, dense, pale white to pale gray. Acervuli developed visible orange-pink conidial masses. Conidiophores were colorless, septate, not branched or branched at the base. Conidia were 1-celled, hyaline, subcylindrical, oblong, attenuated with blunt ends, and the average size was 16.7 ± 1.5 × 6.1 ± 0.9 μm (n = 50). Appressoria were brown, obovoid or irregular, 9.2 ± 1.6 × 8.0 ± 1.8 μm (n = 20). The morphological characters matched the descriptions of Colletotrichum gloeosporioides sensu lato (Cannon et al. 2008). Isolates JNTW11, JNTW2, and JNTW33 were subject to bioinformatic characterization by partial sequencing of 6 genetic loci including the ribosomal internal transcribed spacer (ITS), actin (ACT), beta-tub2 (TUB2), calmodulin (CAL), chitin synthase (CHS-1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Weir et al, 2012). The ITS (MT577037, MT577040, MT577042), ACT (MT767712, MT767715, MT767717), TUB2 (MT767723, MT767726, MT767728), CAL (MT767689, MT767692, MT767694), CHS-1(MT767700, MT767703, MT767705), and GAPDH (MT767734, MT767737, MT767739) sequences were deposited in GenBank. The six sets of sequence data were concatenated “ITS-GAPDH-ACT-CHS-1-TUB2-CAL”, and the aligned sequences (2,007 bp) had 99.0% similarity to ex-type C. siamense ICMP18578. In a maximum likelihood phylogenetic tree, the highest log likelihood was -9148.55, and the isolates tested were in the C. siamense cluster with 96 % bootstrap support. Thus, the isolates were identified as C. siamense on the basis of multilocus phylogenetic analyses and morphological characters. To complete Koch’s postulates, several healthy red-fleshed apple fruit (‘Jiuhong’, 1 month prior to harvest) were inoculated using colonized and uncolonized hyphal plugs and a blank agar as a control. All inoculated fruit were placed in sterile tissue culture bottles containing 2 layers of wet paper towels at 28 °C under a 12 h light/dark cycle. All fruit developed anthracnose symptoms in 7 days while the controls did not develop any symptoms. The symptoms were similar to those collected from fruit in the field, and same fungus was re-isolated from the lesions. Presently it was known that C. acutatum, C. asianum, C. chrysophilum, C. cuscutae, C. fioriniae, C. fragariae, C. fructicola, C. gloeosporioides, C. godetiae, C. kahawae, C. karstii, C. limetticola, C. melonis, C. noveboracense, C. nymphaeae, C. paranaense, C. rhombiforme, C. salicis, and C. theobromicola could infect M. coronaria, M. domestica, M. prunifolia, M. pumila, and M. sylvestris worldwide. To our knowledge, this is the first report of C. siamense as a pathogen of M. niedzwetzkyana. This finding provides crucial information for the management of anthracnose disease in China.

scholarly journals First Report of Anthracnose of Gossypium indicum Lam. caused by Colletotrichum theobromicola in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Donghun Kang ◽  
Jungyeon Kim ◽  
Youn Mi Lee ◽  
Balaraju Kotnala ◽  
Yongho Jeon
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Bootstrap Support ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
First Report ◽  
Spray Method ◽  
Cotton Plants ◽  
Leaf Surface Area ◽  
And Control

In September 2020, typical anthracnose symptoms were observed on cotton (Gossypium indicum Lam.) leaves growing in Hahoe village, Andong, Gyeongbuk Province, Korea. The leaves of the infected plants initially showed spots with halo-lesions which became enlarged and spread to the entire leaf surface area. The infected leaves later became yellowish and chlorotic (Fig. 1A). The disease incidence was at least 90% in the field. For pathogen isolation, fresh samples collected from symptomatic leaves were cut into small pieces (4 to 5 mm2), surface-sterilized in 1% sodium hypochlorite for 1 min, rinsed three times, and macerated in sterile distilled water (SDW). They were spread onto potato dextrose agar (PDA) plates and incubated at 25 °C for 5 days under a 12-h photoperiod. Five isolates were recovered from the infected leaves. Purified fungal colonies were initially white, later turned yellow on PDA medium. Conidia were yellow-colored, smooth-walled, aseptate, straight or slightly distorted, and cylindrical with one end slightly acute or with broadly rounded ends, and with size ranges from 15.3 to 17.5 µm (length) × 4.5 to 5.2 µm (width) (Fig. 1B). The morphological characteristics of the present isolates were consistent with those of Colletotrichum gloeosporioides (Weir et al. 2012). A single isolate, ANUK97, was selected for identification. The multilocus sequence analysis (MLSA) of the actin (ACT), calmodulin (CAL), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), internal transcribed spacer (ITS) rDNA, and β-tubulin (Tub2) were amplified by PCR with the primer pairs of ACT-521F/ACT-783R, CL1C/CL2C, GDF/GDR, ITS1/ITS4, and T1/T2, respectively (White et al. 1990). The resulting sequences were deposited in GenBank under accession numbers MW580367 (ACT), MW580368 (CAL), MW580369 (GAPDH), MW580370 (ITS), and MW580371 (TUB2). A nucleotide BLAST search revealed that ACT, CAL, GAPDH, ITS, and TUB2 sequences be 99% similar to accession numbers MN307380.1, MH155176.1, MK796226.1, MW580370.1, and JX010377.1, respectively of C. theobromicola. Maximum likelihood (ML) phylogenetic analysis was conducted based on a combined dataset of ACT, CAL, GAPDH, ITS, and TUB2 sequences using MEGA-X 10.1.8. The isolate ANUK97 was clustered with a representative strain C. theobromicola CBS124945 100% bootstrap support (Fig. 2). For the pathogenicity test, two-month-old cotton seedlings (n = 10) were inoculated with conidial suspensions (10⁶ spore/mL) of C. theobromicola obtained from 7-day-old PDA cultures at 25 °C by spray method. Seedlings treated with sterile distilled water served as controls. Inoculated and control cotton plants were incubated in the greenhouse at 25 °C under a 12-h photoperiod. After 7 days, necrotic lesions were observed on the artificially inoculated cotton plants, while control plants did not develop any disease symptoms. The pathogen was re-isolated from infected cotton leaves, but not from control plants to fulfill Koch’s postulates. To our knowledge, this is the first report of anthracnose of cotton caused by Colletotrichum theobromicola in Korea.

scholarly journals First Report of Alternaria spp. Causing Leaf Spot on Sweet Viburnum in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chaodong Qiu ◽  
Yingying Zhang ◽  
Zhenyu Liu
Keyword(s):  
Leaf Spot ◽  
Genomic Dna ◽  
Morphological Characteristics ◽  
Leaf Spot Disease ◽  
Molecular Characteristics ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Single Spore ◽  
First Report ◽  
Sweet Viburnum

Sweet viburnum [Viburnum odoratissimum (L.) Ker Gawl] is an evergreen shrub mainly cultivated along roadsides in urban landscapes and also in parks and residential areas. A foliar disease occurred on about 40% of sweet viburnum plants near Anhui Grand Theatre, Anhui Province of China in June 2019. In early stages of sweet viburnum infection, the symptoms appeared as small brown spots ranged in length from 2 to 3 millimeters on the leaves. The spots developed on the upper, middle, and lower leaves of the plant, however, the upper leaves got more severely affected. As the disease develops, the spots enlarged and became rectangular or oval, brown to dark-brown, and their centers became ashen gray. In later stages of infection, the diseased leaves became wilting. Diseased leaves were surface disinfested and three small sections (2-3 mm2) were cut from the margin of the lesions. Sections were placed in 1.5% NaClO for 2 min, submerged in three changes of sterilized distilled water for 1 min each, placed onto potato dextrose agar (PDA) medium amended with 50 μg/ml of ampicillin and kanamycin, and incubated at 25℃ for 3 days. The mycelium from the leading edge of colonies growing from the tissue was sub-cultured onto a PDA plate for 3 days, followed by spore induction (Simmons 2007) and single spore isolation to obtain a pure culture of the putative pathogen. Colonies of one single spore isolate HF0719 were rounded, grayish white with dense aerial mycelium viewed from above and dark brown viewed from below. On potato carrot agar (PCA) medium, conidiophores were branched or occasionally unbranched. On branched conidiophores, conidia were in dwarf tree-like branched chains of 2-5 conidia. On unbranched conidiophores, conidia were simple or in chains of 2-8 conidia. Conidia were light brown or dark brown, ovoid, ellipsoidal to fusiform, and ranged in size from 7 to 26.5 × 4.5 to 11 μm with an average size of 16 × 7 µm based on 500 spore observations, with one beak and 1-7 transverse, 0-3 longitudinal, and 0-3 oblique septa. Beaks were ranged in (1.5-)2-10(-16) μm long. Based on cultural and morphological characteristics, isolate HF0719 was identified as Alternaria spp. (Simmons 2007). For molecular identification, total genomic DNA was isolated from mycelia collected from 7 day-old colonies of isolate HF0719 using the fungal genomic DNA extraction kit (Solarbio, Beijing, China). Fragments of five genes, including those encoding glyceraldehyde-3-phosphate dehydrogenase (gpd), plasma membrane ATPase, actin, calmodulin, and the Alternaria major allergen (Alt a1) regions of isolate HF0719 were amplified and sequenced using primer pairs gpd1/gpd2 (Berbee et al. 1999), ATPDF1/ATPDR1, ACTDF1/ACTDR1, CALDF1/CALDR1 (Lawrence et al. 2013), and Alt-for/Alt-rev (Hong et al. 2005), respectively. The obtained nucleotide sequences were deposited into GenBank as accession numbers: gpd, MT614365; ATPase, MT614364; actin, MT614363; calmodulin, MN706159; and Alt a1, MN304720. Phylogenetic tree using a maximum likelihood bootstrapping method based on the five-gene combined dataset in the following order: gpd, ATPase, actin, calmodulin, Alt a1 of HF0719 and standard strains representing 120 Alternaria species (Lawrence et al. 2013) was constructed. Isolate HF0719 formed a separate branch. On the basis of morphological characteristics and phylogenetic pattern, isolate HF0719 was identified as Alternaria spp.. A pathogenicity test was performed by rubbing 32 healthy leaves of six 5-year-old sweet viburnum plants with a cotton swab dipped in spore suspension containing 2.6 × 106 spores/ml, following leaf surface disinfection with 70% ethanol in the open field. Sterilized distilled water was used as control. The average air temperature was about 28℃ during the period of pathogenicity test. Eleven days after inoculation, 100% of inoculated leaves showed the leaf spot symptom identical to symptoms observed in the field. Control leaves were symptomless. The experiment was done three times. The re-isolated pathogen from the leaf lesion had the same morphological and molecular characteristics as isolate HF0719, thus satisfying Koch’s postulates. The genus Alternaria has been reported to cause leaf spot on sweet viburnum in Florida, USA (Alfieri et al. 1984). To our knowledge, this is the first report of Alternaria spp. causing leaf spot on sweet viburnum in China, a highly valued ornamental plant. Our findings will contribute to monitoring and adopting strategies for manage leaf spot disease on sweet viburnum.

scholarly journals First Report of Corynespora Leaf Spot Caused by Corynespora cassiicola on Gynura in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1007-1007 ◽  
Author(s):  
B. J. Li ◽  
J. X. Chuan ◽  
M. Yang ◽  
G. F. Du
Keyword(s):  
Leaf Spot ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Its Region ◽  
Leaf Spot Disease ◽  
Herbaceous Plant ◽  
Distilled Water ◽  
Corynespora Cassiicola ◽  
Single Spore ◽  
First Report

Gynura (Gynura bicolor DC.) is a perennial herbaceous plant in the family Compositae. It is an important Chinese vegetable, and is commonly used as a Chinese herbal medicine. In 2010, a severe leaf spot disease was observed on gynura grown in the main production areas in Tong Nan County, Chongqing City, China. Some farms experienced 60% disease incidence. Symptoms usually began on the lower leaves, as circular to elliptical or irregular spots with concentric rings. Individual spots were dark brown with grayish centers, sometimes coalescing and leading to extensive necrosis. The fungus associated with lesions was characterized as follows: Conidiophores were single or in clusters, straight or flexuous, unbranched, percurrent, cylindrical, pale to dark brown, 87.5 to 375.0 μm long and 5.0 to 10.5 μm wide. Conidia were solitary or catenate, straight to slightly curved, obclavate to cylindrical, 3 to 14 pseudoseptate, 82.8 to 237.5 μm long and 7.0 to 7.8 μm wide, and pale brown. The morphological characteristics of the conidia and conidiophores agreed with the descriptions for Corynespora cassiicola (1). To isolate the causal pathogen, surface-sterilized tissue at the margin of lesions was immersed in 75% ethanol for 30 s, rinsed in sterile water, dried in a laminar flow bench, transferred to PDA, and incubated at 28°C. Four single-spore cultures of the isolates were obtained and named from ZBTK10110637 to ZBTK10110640. All strains were identified as C. cassiicola. The isolate ZBTK10110637 was selected as representative for molecular identification. Genomic DNA was extracted by CTAB (2). The internal transcribed spacer (ITS) region of the rDNA was amplified using primers with ITS1 (5′-TCCGATGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). Amplicons were 433 bp (GenBank Accession No. JX867272) and shared 100% similarity with that of C. cassiicola (NRC2-1 No. AB539285.1). To confirm pathogenicity, four isolates were used to inoculate 12 gynura plants (6 weeks old) by mist spray-inoculation with 108 spores/ml suspension in sterile distilled water on the leaves. Control plants were misted with sterile distilled water. After inoculation, all plants were incubated in a greenhouse maintained at 20 to 28°C with relative humidity of 80 to 85%. Five days after inoculation, dark brown spots with a grayish center typical of field symptoms were observed on all inoculated plants. No symptoms were seen on water-treated control plants. The fungus was re-isolated from inoculated plants. The morphological characteristics of isolates were identical with the pathogen recovered originally. This is the first report of C. cassiicola on gynura. References: (1) M. B. Ellis. CMI Mycological Papers 65(9):1-15, 1957. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Pestalotiopsis Leaf Blotch on Mangosteen in Hawaii

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 146-146
Author(s):  
L. M. Keith ◽  
T. K. Matsumoto
Keyword(s):  
Dna Sequences ◽  
Management Practices ◽  
Sequence Data ◽  
Morphological Characteristics ◽  
Distilled Water ◽  
Basal Cells ◽  
Garcinia Mangostana ◽  
Tropical Fruit ◽  
First Report ◽  
Leaf Spots

Mangosteen (Garcinia mangostana L.) is a tropical evergreen tree that produces one of the most prized tropical fruits, commonly known as the “Queen of the Fruits.″ Mangosteen has the potential to occupy a rapidly expanding niche market in Hawaii. In October 2009, a disease was observed that produced brown leaf spots and blotches surrounded by bright yellow halos at a mangosteen orchard located in Hakalau, Hawaii (19° 53′ 49″ N, 155° 7′ 35″ W). Recently transplanted 10+ year old trees were 95 to 100% infected. Pieces of infected leaves and stems were surface-sterilized, plated on potato dextrose agar (PDA), and incubated at 24°C ± 1°C for 21 days. The fungus growing on PDA was pale buff with sparse aerial mycelium and acervuli containing black, slimy spore masses. Single spore isolates were used for the morphological characteristics and molecular analysis. Conidia were 5-celled. Apical and basal cells were hyaline; the three median cells were umber to olivaceous. Conidia (n = 50) were 24.3 ± 0.2 × 7.5 ± 0.1 μm, with apical appendages, typically three, averaging 24.3 ± 0.4 μm long, and a basal appendage averaging 6.7 ± 0.2 μm long. DNA sequences were obtained from the β-tubulin gene and the internal transcribed spacer (ITS1 and ITS2) and 5.8S regions of the rDNA to confirm the identification. The morphological descriptions and measurements were similar to P. virgatula (Kleb.) Steyaert (1). Although sequence data of the ITS region (GenBank Accession No. JN542546) supports the identity of the fungus as P. virgatula, the taxonomy of this genus remains confused since there are only a few type cultures, so it is impossible to use sequences in GenBank to reliably clarify species names (2). To confirm pathogenicity, six leaves of two 3-year-old seedlings were inoculated. Seven-day-old cultures grown on 10% V8 agar at 24°C under continuous fluorescent lighting were used for inoculations. The inoculum consisted of spore suspensions in sterile distilled water adjusted to 6 × 105 conidia/ml. Using a fine haired paint brush, the inoculum was brushed onto the youngest leaves, while sterile distilled water was used as the control. The plants were incubated in a clear plastic bag placed on the laboratory bench at 24°C for 48 hours, then placed on a greenhouse bench and observed weekly for symptoms. After 14 days, leaf spots ranging in size from pinpoint to 5.4 mm in diameter with a distinctive yellow halo were present. Within 35 days, the leaf spots enlarged to leaf blotches ranging in size from 11.5 × 13.3 mm up to 28.3 × 34.6 mm with brown centers and a distinctive yellow halo identical to the field symptoms. A Pestalotiopsis sp. identical to that used to inoculate the seedlings was recovered from the leaf spots and blotches, confirming Koch's postulates. The experiment was repeated twice. Pestalotiopsis leaf blight has been reported in other countries growing mangosteen, including Thailand, Malaysia, and North Queensland, Australia (3). However, to our knowledge, this is the first report of a Pestalotiopsis sp. causing a disease on mangosteen in Hawaii. Although this disease is considered a minor problem in the literature (3), effective management practices should be established to avoid potential production losses. References: (1) E. F. Guba. Monograph of Pestalotia and Monochaetia. Harvard University Press, Cambridge, MA. 1961. (2) S. S. N. Maharachchikumbura et al. Fungal Div. 50:167, 2011. (3) R. C. Ploetz. Diseases of Tropical Fruit Crops. CABI Publishing. Wallingford, Oxfordshire, UK, 2003.

scholarly journals First Report of Fusarium pseudograminearum from Wheat Heads with Fusarium Head Blight in North China Plain

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 156-156 ◽  
Author(s):  
F. Xu ◽  
Y. L. Song ◽  
G. Q. Yang ◽  
J. M. Wang ◽  
L. L. Liu ◽  
...  
Keyword(s):  
Fusarium Head Blight ◽  
North China Plain ◽  
North China ◽  
Temporal Dynamics ◽  
Morphological Characteristics ◽  
Distilled Water ◽  
Head Blight ◽  
Single Spore ◽  
Winter Cereal ◽  
First Report

Wheat (Triticum aestivum L.), the most widely grown winter cereal crop in China, was grown on 24.3 million hectares in 2012. There was an outbreak of Fusarium head blight in 2012, and it was prevalent in 2013 in North China Plain, the largest area producing winter wheat in China. In 2013, a total of 213 Fusarium graminearum-like isolates were collected from diseased wheat heads in 33 fields in 17 counties in Henan province. The pathogen was isolated from the base of Fusarium-damaged spikelets on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s and 3% NaClO for 1.5 min) and rinsed three times in sterilized distilled water. After 3 days, the mycelia were transferred to fresh PDA and purified by the single-spore isolation method. Species were identified based on morphological characteristics (2), and sequence analysis of the translation elongation factor-1α (TEF) and trichothecene 3-O-acetyltransferase (Tri 101) gene (3). The results indicated that F. graminearum species complex (97.2%) is the main causal agent of Fusarium head blight in this region. However, four strains (2%) from the two fields in Jiao Zuo and Xin Xiang counties were found to be identical to F. pseudograminearum. The four (13JZ3-1, 13JZ3-2, 13XX1-2, and 13XX1-6) isolates of F. pseudograminearum were transferred onto carnation leaf agar (CLA) and incubated at 20°C under black light blue illumination. On CLA, macroconidia were abundant, relatively slender, curved to almost straight, commonly six- to seven-septate, and averaged 49.7 × 5.0 μm. Microconidia were not observed. Chlamydospores were observed after 4 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (2). However, the TEF sequences (Accession nos. KJ863322 to KJ863325) showed 99 to 100% similarity with several F. pseudograminearum sequences (e.g., AF212468, AF212469, and AF212470); the Tri 101 sequences (KJ863326 to KJ863329) showed 99 to 100% similarity with accession nos. AF212615 and AF212616 of F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). To complete Koch's postulates, the pathogenicity of the fungus was tested by spraying five healthy inflorescences (average of 19 spikelets per spike) of wheat cultivar Zhoumai 18 with a 5-ml suspension (5 × 104 conidia per milliliter). Another five healthy inflorescences were sprayed with sterile distilled water. Plants were placed in a growth chamber with a 12-h photoperiod at 22°C, covered with polyethylene bags that were removed after 2 days. Seven days later, while control inflorescences were asymptomatic, inoculated inflorescences showed a mean of 10 bleached spikelets per spike. By using the methodology described above, the fungus was re-isolated from infected spikelets of inoculated wheat heads but not from the controls. To our knowledge, this is the first report of F. pseudograminearum from diseased wheat heads in China. Further investigation is needed to gain a better understanding of the spatial and temporal dynamics of this new pathogen. References: (1) T. Aoki and K. O'Donnell. Mycologia 91:597, 1999. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) R. H. Proctor et al. Mol. Microbiol. 74:1128, 2009.

Sign in / Sign up

Export Citation Format

Share Document