First Report of the β-Tubulin E198A Mutation Conferring Resistance to Methyl Benzimidazole Carbamates in European Isolates of Monilinia fructicola

The causal agent of brown rot on stone and pome fruits, Monilinia fructicola (G. Wint.), is a quarantine pathogen in Europe. It has been detected in Austria (later eradicated), Spain, the Czech Republic, Italy, Germany, and Switzerland (1). In the United States and other countries, M. fructicola isolates were reported to show resistance to different classes of fungicides, including methyl benzimidazole carbamates (MBC) (2). Lichou et al. (2) reported the presence of isolates resistant to the MBC carbendazim in France, but the mechanisms inducing MBC resistance in these isolates were not studied. Ma et al. (3) in California, and more recently, Zhu et al. (4) in South Carolina, demonstrated that the molecular mechanisms accounting for low and high levels of resistance to MBC fungicides in M. fructicola isolates were the mutations H6Y and E198A, respectively, in the β-tubulin gene. Four M. fructicola isolates each from Italy, France, Spain, and Switzerland (16 isolates total), all having an unknown level of MBC resistance, were selected. In each isolate, the section of the β-tubulin gene containing the two potentially mutant codons was PCR-amplified with the primers TubA and TubR1 (3) and the amplicons were sequenced directly. Sequence analysis revealed the amino acid histidine (H) at codon 6 in all the isolates, which would not predict MBC resistance, while alanine (A) at codon 198 (the mutation predictive of a high level of MBC resistance) was found in all isolates from Spain and Switzerland and in three isolates each from France and Italy. A representative sequence of the four identical partial β-tubulin gene sequences from the Swiss isolates was submitted to GenBank under the Accession No. HQ709265. All isolates were tested in a potato dextrose agar (PDA) petri dish assay for resistance to the MBC fungicide thiophanate-methyl (Nippon Soda Co., Ltd., Tokyo, Japan) at the discriminatory dose of 50 μg/ml (4). All isolates with the E198A mutation were able to grow on the media, while the two isolates without the E198A mutation were not able to grow. The result indicated that most isolates had a high level of resistance to the MBC fungicide. To our knowledge, this is the first report of the presence of the E198A mutation conferring resistance to MBC fungicides in European isolates of M. fructicola. As the mutation appears to be widely distributed, we anticipate that MBC fungicides may be ineffective at controlling brown rot in countries with occurrence of M. fructicola. References: (1) M. Hilber-Bodmer et al. Plant Dis. 94:643, 2010. (2) J. Lichou et al. Phytoma 547:22, 2002. (3) Z. H. Ma et al. Appl. Environ. Microbiol. 69:7145, 2003. (4) F. X. Zhu et al. Plant Dis. 94:1511, 2010.

Download Full-text

First Report of the β-tubulin E198A Allele for Fungicide Resistance in Monilinia fructicola from South Carolina

Plant Disease ◽

10.1094/pdis-09-10-0641 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1511-1511 ◽

Cited By ~ 7

Author(s):

F. X. Zhu ◽

P. K. Bryson ◽

A. Amiri ◽

G. Schnabel

Keyword(s):

South Carolina ◽

East Coast ◽

Brown Rot ◽

Petri Dish ◽

Monilinia Fructicola ◽

Tubulin Gene ◽

First Report ◽

Additional Control ◽

Benzimidazole Carbamates ◽

Β Tubulin

Resistance to methyl benzimidazole carbamates (MBCs) in Monilinia fructicola, the causal agent of brown rot of stone fruits, is known to be present in South Carolina peach orchards, but the molecular mechanism of resistance has not been investigated. Nine isolates were collected from peach in five counties in South Carolina and examined in petri dish assays on potato dextrose agar (PDA) for resistance to the MBC fungicide thiophanate-methyl (Topsin-M 70WP; Ceraxagri, King of Prussia, PA) at the discriminatory dose of 50 μg/ml. Isolates that grew on the fungicide-amended medium were considered highly resistant (HR). The β-tubulin gene from four sensitive (S) and five HR M. fructicola isolates was PCR-amplified with primer pair TubA and TubR1 as described previously (1). Sequence analysis revealed several silent mutations in introns and exons in S and HR isolates and the presence of the previously described E198A allele in HR but not S isolates (1). Nucleotide sequences of the β-tubulin gene from three S (BS, S2, MfEgpc1) and two HR isolates (MfPdt6 and BR2) were submitted to GenBank under accession numbers HM051379, HM051380, HM051381, HM051382, and HM051383, respectively. To our knowledge, this is the first report of the E198A in M. fructicola isolates from South Carolina and the East Coast. This allele is responsible for high levels of MBC resistance in M. fructicola (1). A previously reported PCR-based method using primers HRF+HRR designed to detect the E198A mutation in M. fructicola HR isolates (1) was improved by adding primer TR739 (5′-TCA CGA CGA ACA ACA TCA AGA-3′) to the PCR cocktail. This additional internal primer amplified a 222-bp fragment from all S and HR isolates and therefore provided a useful, additional control. The confirmation of the E198A allele in M. fructicola isolates provides another useful tool to detect MBC resistance in commercial peach orchards in South Carolina. Reference: (1) Z. H. Ma et al. Appl. Environ. Microbiol. 69:7145, 2003.

Download Full-text

First Report of Pilidium concavum Causing Tan-brown Rot on Strawberry Nursery Stock in South Carolina

Plant Disease ◽

10.1094/pdis-01-14-0048-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1010-1010 ◽

Cited By ~ 1

Author(s):

D. Fernández-Ortuño ◽

P. K. Bryson ◽

G. Schnabel

Keyword(s):

United States ◽

South Carolina ◽

Brown Rot ◽

The United States ◽

Conidial Suspension ◽

Strawberry Fruit ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Nursery Stock ◽

Wide Range

Pilidium concavum (Desm.) Höhn. [synanamorph: Hainesia lythri (Desm.) Höhn.] is an opportunistic pathogen that causes leaf spots and stem necrosis in a wide range of hosts, including strawberry (Fragaria ananassa) (1,2). In October 2013, 24 strawberry plug plants (cv. Chandler) with brown to dark brown necrotic lesions on stolons were obtained from a nursery in Easley, SC. The lesions were oval shaped and varied in length from 2 to 8 mm. The tips of stolons with larger spots had died. To isolate the causal agent, 3 to 5 cm of necrotic stolon tissue was surface disinfected for 1 min with 10% bleach, rinsed with sterile distilled water, air dried, and placed on potato dextrose agar (PDA). After 7 days of incubation at 22°C, pink-orange masses of spores emerged. Single spore colonies on PDA produced a gray to brown colony with whitish aerial mycelium. Numerous discoid to hemisphaerical conidiomata (0.3 to 2.2 mm in diameter) developed with a dark base and exuded a pink, slimy mass that contained many conidia. Conidiophores (10.2 to 47.8 × 0.8 to 2.0 μm) were hyaline, unicellular, cylindrical, and filiform. Conidia (3.0 to 8.5 × 1.0 to 2.9 μm) were aseptate, fusiform, hyaline, and canoe-shaped to allantoid. On the basis of morphology, the pathogen was identified as P. concavum (3). The internal transcribed spacer region ITS1-5.8S-ITS2 was amplified by PCR and sequenced with primers ITS1 and ITS4 (4). The sequence was submitted to GenBank (Accession No. KF911079) and showed 100% homology with sequences of P. concavum. Pathogenicity was examined on strawberry fruit and leaves. Our previous efforts to achieve infection without wounding failed, which is consistent with experiences of other scientists (not cited). Thus, 24 strawberry fruit were wounded (1 cm deep) with a needle once, and submerged for 3 min in a conidial suspension (2 × 106 conidia ml−1). Controls were wounded and submerged in sterile water. After 4 days of incubation at 22°C, characteristic symptoms were observed at the wound site only on inoculated fruit. Detached leaves (about 6 cm in diameter) from 3- to 4-week-old strawberry plants cv. Chandler were surface sterilized and placed right side up in petri dishes (one leaf per dish) containing water agar. Leaves were inoculated at one site with a 50 μl conidial suspension (2 × 106 conidia ml−1) after inflicting a scraping-type injury with a needle to the surface at the point of inoculation. Control leaves received just water. After 7 days of incubation at 22°C, only the inoculated leaves showed symptoms similar to those observed on strawberry stolons. The fungus was re-isolated from symptomatic fruit and leaf lesions and identity was confirmed based on morphological features. The experiments were repeated. To our knowledge, this is the first report of P. concavum causing tan-brown rot on strawberry tissue in South Carolina. Prior to this study, the pathogen has been described from different hosts and countries including Belgium, Brazil, China, France, Iran, Poland, and the United States. Contamination of strawberry nursery stock by P. concavum could become a plant health management issue in the United States, especially if the pathogen is transferred to strawberry production areas. Further information on in-field occurrence of P. concacum is needed. References: (1) J. Debode et al. Plant Dis. 95:1029, 2011. (2) W. L. Gen et al. Plant Dis. 96:1377, 2012. (3) A. Y. Rossman et al. Mycol. Prog. 3:275, 2004. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Monilinia fructicola Causing Brown Rot on Stored Japanese Plum Fruit in Chile

Plant Disease ◽

10.1094/pdis-06-13-0647-pdn ◽

2014 ◽

Vol 98 (1) ◽

pp. 160-160 ◽

Cited By ~ 3

Author(s):

B. A. Latorre ◽

G. A. Díaz ◽

A. L. Valencia ◽

P. Naranjo ◽

E. E. Ferrada ◽

...

Keyword(s):

San Francisco ◽

Brown Rot ◽

Soft Rot ◽

The United States ◽

Its2 Region ◽

Monilinia Fructicola ◽

Conidial Suspension ◽

First Report ◽

Japanese Plum ◽

Official Control

In autumn 2013, fruit of Japanese plum (Prunus salicina) cvs. Angelino and Black Kat developed an unusual brown and soft rot after 2 months in cold storage (0°C) on nearly 1% of the fruit. Fruit showed small, circular, light brown spots that eventually destroyed the entire fruit. Small sporodochia appeared on the fruit surface. Fruit was harvested from orchards located near San Francisco de Mostazal (33°59′ S, 70°41′ W), Chile. Small pieces of diseased tissue were selected from margins of lesions of surface disinfected (96% ethanol) fruit (n = 7) and placed on acidified potato dextrose agar (PDA) plates for 5 days at 20°C. Light brown colonies with even margins and concentric rings of spores were obtained. The conidia of five isolates were one-celled, hyaline, lemon-shaped, (min. 10.7) 14.9 ± 1.5 (max. 18.6) × (min. 8.1) 9.4 ± 0.8 (max. 10.8) μm (n = 30), and borne in branched monilioid chains. This fungus was identified as Monilinia fructicola (G. Winter) Honey (1). Identification was confirmed by amplifying and sequencing the ribosomal ITS1-5.8S-ITS2 region using ITS1 and ITS4 primers (3). BLAST analysis of Chilean plum isolates (GenBank Accession Nos. KF148610 and KF148611) were 99 to 100% identical to isolates of M. fructicola originating from the United States (DQ314727 and HQ846966, respectively) and 100% identical to the first Chilean isolate (JN001480) found in nectarines originating from California at the supermarkets in Santiago in June 2009. Koch's postulates were fulfilled by reproducing brown rot symptoms on mature wounded Japanese plums cv. Angelino (n = 8) inoculated with 10 μl of a conidial suspension (105 conidia/ml) or with a mycelium plug (5-mm diameter). After 2 days in humid chambers (>80% relative humidity) at 25°C, all inoculated fruit developed brown rot symptoms with necrotic lesion means of 15.8 and 21.5 mm in diameter in fruit inoculated with conidia and mycelium, respectively. Non-inoculated control fruit remained healthy. Re-isolations were performed on PDA and the presence of M. fructicola was morphologically confirmed in 100% of the symptomatic fruits. To our knowledge, this is the first report demonstrating the presence of M. fructicola causing brown rot in stored Japanese plums in Chile after its first interception in 2009 in Chile, suggesting that this pathogen has been established in the field. Currently, M. fructicola is a quarantine organism under official control, restricted to Prunus orchards between Santiago and Nancagua in central Chile (2). References: (1) EPPO. EPPO Bull. 39:337, 2009. (2) Servicio Agrícola y Ganadero, SAG, Ministerio de Agricultura, Gobierno de Chile. www.sag.cl , accessed 15 November 2013. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, NY, 1990.

Download Full-text

First Report of Brown Rot Caused by Monilinia fructicola on Apricot in a Swiss Orchard

Plant Disease ◽

10.1094/pdis-94-5-0643b ◽

2010 ◽

Vol 94 (5) ◽

pp. 643-643 ◽

Cited By ~ 12

Author(s):

M. Hilber-Bodmer ◽

M. Bünter ◽

A. Patocchi

Keyword(s):

Large Scale ◽

Natural Infection ◽

Brown Rot ◽

The United States ◽

Prunus Armeniaca ◽

Monilinia Fructicola ◽

First Report ◽

Production Region ◽

Molecular Tests ◽

Two Samples

Monilinia fructicola (G. Wint.), causal agent of brown rot on stone and pome fruits, is a quarantine pathogen in Europe (EPPO A2 quarantine pest). Since it was first discovered in French orchards in 2001, this pathogen has been officially identified from orchards in Austria (eradicated), Spain, Czech Republic, Italy, and Germany. M. fructicola has also been reported on imported fruit in Hungary and Switzerland (2). Orchard surveys in Switzerland in 2003 and 2005 found no evidence of natural infections (2). From July to August 2008, a large-scale survey of orchards was conducted in the primary apricot- (Prunus armeniaca Linn.) production region of Switzerland (Canton Valais). Apricots showing brown rot symptoms were collected from 57 different orchards at packinghouses (152 samples). In addition, mummies and fresh fruits showing brown rot symptoms were directly collected from three orchards (70 samples). All samples were tested using the PCR-based assay of Côté et al. (3). Ten apricots, originating from an orchard where the samples were directly collected from the trees, tested positive for M. fructicola. These apricots showed brown, sunken lesions covered with grayish pustules. The remaining brown rot samples were identified as M. laxa and M. fructigena. The positive samples were confirmed by the M. fructicola PCR protocols of Hughes et al. (4), following the EPPO diagnostic protocol (1). Eight amplicons obtained with the PCR protocol of Hughes et al. (4) were sequenced, compared with each other, and blasted to the NCBI database. These amplicons were identical to each other and had a 100% match to 16 M. fructicola isolates originating from several countries including the United States, New Zealand, Japan, and China. The unicellular, hyaline, lemon-shaped conidia of three isolates grown at 22°C on PDA averaged 14.4 ± 1.3 μm long and 8.8 ± 0.77 μm wide, therefore fitting the description for M. fructicola (1). Koch's postulates were fulfilled by reproducing brown rot symptoms on mature apricots inoculated with conidia. Six days after inoculation, typical brown rot symptoms appeared on inoculated fruits while control fruits remained healthy. Molecular tests performed with the protocol of Côté et al. (3) and Hughes et al. (4) confirmed the presence of M. fructicola on the inoculated fruits. In 2009, the presence M. fructicola in the orchard where the pathogen was detected in 2008 was verified. One hundred and thirty-seven apricots showing brown rot symptoms were collected and tested (3). M. fructicola was recovered from two samples, indicating the persistence of the pathogen in the orchard. To our knowledge, this is the first report of natural infection of M. fructicola in a Swiss orchard. References: (1) Anonymous. OEPP/EPPO Bull. 33:281, 2003. (2) E. Bosshard et al. Plant Dis. 90:1554, 2006. (3) M.-J. Côté et al. Plant Dis. 88:1219, 2004. (4) K. J. D. Hughes et al. OEPP/EPPO Bull. 30:507, 2000.

Download Full-text

First Report of Stem and Foliage Blight of Chrysanthemum Caused by Phytophthora drechsleri in the United States

Plant Disease ◽

10.1094/pdis-03-21-0631-pdn ◽

2021 ◽

Author(s):

Charles Krasnow ◽

Nancy Rechcigl ◽

Jennifer Olson ◽

Linus Schmitz ◽

Steven N. Jeffers

Keyword(s):

United States ◽

South Carolina ◽

Sequence Similarity ◽

Morphological Characteristics ◽

The United States ◽

Universal Primers ◽

Broad Host Range ◽

Pathogenicity Test ◽

First Report ◽

Foliage Blight

Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.

Download Full-text

First Report of Leptosphaeria biglobosa (Blackleg) on Brassica oleracea (Cabbage) in Mexico

Plant Disease ◽

10.1094/pdis-94-6-0791c ◽

2010 ◽

Vol 94 (6) ◽

pp. 791-791 ◽

Cited By ~ 10

Author(s):

A. Dilmaghani ◽

M. H. Balesdent ◽

T. Rouxel ◽

O. Moreno-Rico

Keyword(s):

Brassica Oleracea ◽

Sequence Data ◽

Leptosphaeria Maculans ◽

The United States ◽

Internal Transcribed Spacers ◽

First Report ◽

5.8S Rdna ◽

Single Location ◽

Leptosphaeria Biglobosa ◽

Β Tubulin

Broccoli (Brassica oleracea var. italica), cauliflower (B. oleracea var. botrytis), and cabbage (B. oleracea var. capitata) have been grown in central Mexico since 1970, with 21,000 ha cropped in 2001. In contrast, areas grown with oilseed rape (B. napus) are very limited in Mexico (<8,000 ha). Blackleg, a destructive disease of B. napus in most parts of the world, was first observed in Mexico in Zacatecas and Aguascalientes in 1988 on B. oleracea, causing as much as 70% yield loss. A species complex of two closely related Dothideomycete species, Leptosphaeria maculans and L. biglobosa, is associated with this disease of crucifers (1), but leaf symptoms on susceptible plants are different, with L. maculans typically causing >15-mm pale gray lesions with numerous pycnidia, whereas L. biglobosa causes dark and smaller lesions only containing a few pycnidia. Having a similar epidemiology, both species can be present on the same plants at the same time, and symptom confusion can occur as a function of the physiological condition of the plant or expression of plant resistance responses. A total of 209 isolates from symptomatic B. oleracea leaves were collected from three fields in central states of Mexico (58 to 71 isolates per location). All leaves showed similar symptoms, including a 10- to 15-mm tissue collapse with an occasional dark margin. Cotyledons of seven B. napus differentials were inoculated with conidia of all the isolates as described by Dilmaghani et al. (1). Two hundred isolates caused tissue collapse typical of L. maculans. However, nine obtained from white cabbage in a single location in Aguascalientes caused <5-mm dark lesions. When inoculated onto cotyledons of three B. oleracea genotypes commonly grown in Mexico (cvs. Domador, Monaco, and Iron Man), the nine isolates caused a range of symptoms characterized by tissue collapse (maximum 10 to 15 mm), showing the presence of patches of black necrotic spots within the collapse. The occasional presence of a few pycnidia allowed us to reisolate the fungus for molecular identification. ITS1-5.8S-ITS2, (internal transcribed spacers and 5.8S rDNA), actin, and β-tubulin sequences were obtained as described previously (4). Multiple gene genealogies based on these sequence data showed two subclades of L. biglobosa: L. biglobosa ‘occiaustralensis’ (one isolate; ITS [AM410082], actin [AM410084], and β-tubulin [AM410083]) and L. biglobosa ‘canadensis’ (eight isolates; ITS [AJ550868], actin [AY748956], and β-tubulin [AY749004]) (3,4), which were previously described on B. napus in the United States, Canada, and Chile. To our knowledge, this is the first report of L. biglobosa in Mexico. Previously, this species has only been reported once on B. oleracea without discrimination into subclades (2). In the Aguascalientes sampling, 24% of the isolates were L. biglobosa, similar to Canadian locations where this species is still common as compared with L. maculans (1). The large proportion of sampled L. biglobosa ‘canadensis’, highlights the prevalence of this subclade throughout the American continent (1). References: (1) A. Dilmaghani et al. Plant Pathol. 58:1044, 2009. (2) E. Koch et al. Mol. Plant-Microbe Interact. 4:341, 1991. (3) E. Mendes-Pereira et al. Mycol Res. 107:1287, 2003. (4) L. Vincenot et al. Phytopathology 98:321, 2008.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First report of Meloidogyne javanica pathogenic on hybrid lavender (Lavandula ×intermedia) in the United States

Plant Disease ◽

10.1094/pdis-06-21-1175-pdn ◽

2021 ◽

Author(s):

Samara A. Oliveira ◽

Daniel M. Dlugos ◽

Paula Agudelo ◽

Steven N. Jeffers

Keyword(s):

South Carolina ◽

Sandy Loam ◽

Meloidogyne Javanica ◽

The United States ◽

Crown Rot ◽

Cultivated Plants ◽

Broad Host Range ◽

First Report ◽

Tomato Roots ◽

The Usa

Root-knot nematodes (RKNs), Meloidogyne spp., are some of the most economically important pathogens of cultivated plants. Meloidogyne javanica is one of the most destructive RKN species and is well known for its broad host range and the severe damage it causes to plant roots (Perry et al. 2009). In Feb 2018, four mature dead and dying hybrid lavender plants (Lavandula ×intermedia ‘Phenomenal’) were collected in Edgefield County, South Carolina, and suspected of having Phytophthora root and crown rot (Dlugos and Jeffers 2018). Greenhouse-grown plants had been transplanted in Dec 2016 and Jan 2017 into a sandy loam soil on a site that had been fallow or in pasture for over 30 years. Some plants began to turn gray and die in summer 2017, and approximately 40% of 1230 plants were symptomatic or dead by Feb 2018. Phytophthora spp. were not isolated from the collected plants but were isolated from plants collected on subsequent visits. Instead, all four plants had small, smooth galls on the roots. Lavender roots were examined microscopically (30-70×), and egg masses of RKNs were observed on the galls. Mature, sedentary RKN females were handpicked from galled roots, and perineal patterns of 10 specimens were examined and identified as M. javanica. Juveniles and eggs were extracted from lavender roots by the method of Coolen and D’herde (1972). To confirm species identification, DNA was extracted from 10 individual juveniles, and a PCR assay was conducted using species-specific primers for M. javanica, Fjav/Rjav (Zijlstra et al. 2000). A single amplicon was produced with the expected size of approximately 720 bp, which confirmed identity as M. javanica. To determine pathogenicity, M. javanica from lavender roots were inoculated onto susceptible tomato plants for multiplication, and severe gall symptoms occurred on tomato roots 60 days later. Nematodes were extracted from tomato roots and inoculated onto healthy, rooted cuttings of ‘Phenomenal’ lavender plants growing in pots of soilless medium in a greenhouse. Plants were inoculated with 0, 1000, 2000, 5000, or 10000 eggs and juveniles of M. javanica. Five single-plant replicates were used for each treatment, and plants were randomized on a greenhouse bench. Plants were assessed 60 days after inoculation, and nematodes were extracted from roots and counted. The reproduction factor was 0, 43.8, 40.9, 9.1, 7.7, and 2.6 for initial nematode populations 0, 1000, 2000, 5000, and 10000, respectively, which confirmed pathogenicity (Hussey and Janssen 2002). Meloidogyne javanica also was recovered in Mar 2018 from galled roots on a ‘Munstead’ (L. angustifolia) lavender plant from Kentucky (provided by the Univ. of Kentucky Plant Disease Diagnostic Laboratories), and an unidentified species of Meloidogyne was isolated in Aug 2020 from a ‘Phenomenal’ plant grown in Florida. COI mtDNA sequences from the SC (MZ542457) and KY (MZ542458) populations were submitted to Genbank. M. javanica previously was found associated with field-grown lavender (hybrid and L. angustifolia) in Brazil, but pathogenicity was not studied (Pauletti and Echeverrigaray 2002). To our knowledge, this is the first report of M. javanica pathogenic to L. ×intermedia in the USA, and the first time RKNs have been proven to be pathogenic to Lavandula spp. following Koch’s Postulates. Further studies are needed to investigate the geographic distribution of M. javanica on lavender and the potential threat this nematode poses to lavender production in the USA.

Download Full-text

First Report of Brown Rot Caused by Monilinia fructicola Affecting Peach Orchards in Slovenia

Plant Disease ◽

10.1094/pdis-94-9-1166a ◽

2010 ◽

Vol 94 (9) ◽

pp. 1166-1166 ◽

Cited By ~ 15

Author(s):

A. Munda ◽

M. Viršček Marn

Keyword(s):

Prunus Persica ◽

Brown Rot ◽

Fruit Rot ◽

Morphological Identification ◽

Monilinia Fructicola ◽

Conidial Suspension ◽

Stone Fruits ◽

The European Union ◽

First Report ◽

Representative Isolate

Monilinia fructicola, the causal agent of brown rot, is a destructive fungal pathogen that affects mainly stone fruits (Prunoideae). It causes fruit rot, blossom wilt, twig blight, and canker formation and is common in North and South America, Australia, and New Zealand. M. fructicola is listed as a quarantine pathogen in the European Union and was absent from this region until 2001 when it was detected in France. In August 2009, mature peaches (Prunus persica cv. Royal Glory) with brown rot were found in a 5-year-old orchard in Goriška, western Slovenia. Symptoms included fruit lesions and mummified fruits. Lesions were brown, round, rapidly extending, and covered with abundant gray-to-buff conidial tufts. The pathogen was isolated in pure culture and identified based on morphological and molecular characters. Colonies on potato dextrose agar (PDA) incubated at 25°C in darkness had an average daily growth rate of 7.7 mm. They were initially colorless and later they were light gray with black stromatal plates and dense, hazel sporogenous mycelium. Colony margins were even. Sporulation was abundant and usually developed in distinct concentric zones. Limoniform conidia, produced in branched chains, measured 10.1 to 17.7 μm (mean = 12.1 μm) × 6.2 to 8.6 μm (mean = 7.3 μm) on PDA. Germinating conidia produced single germ tubes whose mean length ranged from 251 to 415 μm. Microconidia were abundant, globose, and 3 μm in diameter. Morphological characters resembled those described for M. fructicola (1). Morphological identification was confirmed by amplifying genomic DNA of isolates with M. fructicola species-specific primers (2–4). Sequence of the internal transcribed spacer (ITS) region (spanning ITS1 and ITS 2 plus 5.8 rDNA) of a representative isolate was generated using primers ITS1 and ITS4 and deposited in GenBank (Accession No. GU967379). BLAST analysis of the 516-bp PCR product revealed 100% identity with several sequences deposited for M. fructicola in NCBI GenBank. Pathogenicity was tested by inoculating five mature surface-sterilized peaches with 10 μl of a conidial suspension (104 conidia ml–1) obtained from one representative isolate. Sterile distilled water was used as a control. Peaches were wounded prior to inoculation. After 5 days of incubation at room temperature and 100% relative humidity, typical brown rot symptoms developed around the inoculation point, while controls showed no symptoms. M. fructicola was reisolated from lesion margins. Peach and nectarine orchards in a 5-km radius from the outbreak site were surveyed in September 2009 and M. fructicola was confirmed on mummified fruits from seven orchards. The pathogen was not detected in orchards from other regions of the country, where only the two endemic species M. laxa and M. fructigena were present. To our knowledge, this is the first report of M. fructicola associated with brown rot of stone fruits in Slovenia. References: (1) L. R. Batra. Page 106 in: World Species of Monilinia (Fungi): Their Ecology, Biosystematics and Control. J. Cramer, Berlin, 1991. (2) M.-J. Côté et al. Plant Dis. 88:1219, 2004. (3) K. J. D. Hughes et al. EPPO Bull. 30:507, 2000. (4) R. Ioos and P. Frey. Eur. J. Plant Pathol. 106:373, 2000.

Download Full-text

Identification and Characterization of Benzimidazole Resistance in Monilinia fructicola from Stone Fruit Orchards in California

Applied and Environmental Microbiology ◽

10.1128/aem.69.12.7145-7152.2003 ◽

2003 ◽

Vol 69 (12) ◽

pp. 7145-7152 ◽

Cited By ~ 127

Author(s):

Zhonghua Ma ◽

Michael A. Yoshimura ◽

Themis J. Michailides

Keyword(s):

Dna Sequences ◽

Point Mutations ◽

Brown Rot ◽

Stone Fruit ◽

Monilinia Fructicola ◽

Tubulin Gene ◽

Benzimidazole Fungicides ◽

Specific Pcr ◽

Allele Specific ◽

Fruit Orchards

ABSTRACT Low and high levels of resistance to the benzimidazole fungicides benomyl and thiophanate-methyl were observed in field isolates of Monilinia fructicola, which is the causative agent of brown rot of stone fruit. Isolates that had low levels of resistance (hereafter referred to as LR isolates) and high levels of resistance (hereafter referred to as HR isolates) were also cold and heat sensitive, respectively. Results from microsatellite DNA fingerprints showed that genetic identities among the populations of sensitive (S), LR, and HR isolates were very high (>0.96). Analysis of DNA sequences of theβ -tubulin gene showed that the LR isolates had a point mutation at codon 6, causing a replacement of the amino acid histidine by tyrosine. Codon 198, which encodes a glutamic acid in S and LR isolates, was converted to a codon for alanine in HR isolates. Based on these point mutations in the β-tubulin gene, allele-specific PCR assays were developed for rapid detection of benzimidazole-resistant isolates of M. fructicola from stone fruit.

Download Full-text