scholarly journals First Report of Cucurbit yellow stunting disorder virus in California and Arizona, in Association with Cucurbit leaf crumple virus and Squash leaf curl virus

Plant Disease ◽  
2007 ◽  
Vol 91 (3) ◽  
pp. 330-330 ◽  
Author(s):  
Y.-W. Kuo ◽  
M. R. Rojas ◽  
R. L. Gilbertson ◽  
W. M. Wintermantel
Keyword(s):  
Economic Losses ◽  
Pcr Analysis ◽  
Vegetable Production ◽  
Healthy Controls ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Cucurbit Leaf Crumple Virus ◽  
Leaf Curl

In August and September of 2006, melon plants (Cucumis melo L.) near Niland in California's Imperial Valley and near Yuma, AZ began exhibiting interveinal chlorosis and leaf mottling and spotting, symptoms resembling those resulting from infection by viruses of the genus Crinivirus, family Closteroviridae (4). Some plants also exhibited leaf crumpling and curling, symptoms characteristic of begomovirus (genus Begomovirus, family Geminiviridae) infection. Leaves of plants had large populations of silverleaf whitefly (Bemisia tabaci biotype B), a known vector of begomoviruses and some criniviruses. Leaf samples were collected from four plants from California and 13 plants from three separate fields in Arizona. Total RNA was extracted using RNeasy kits (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR using degenerate primers specific to the conserved polymerase region of a diverse group of criniviruses (3). The expected 500-bp RT-PCR product was amplified from RNA obtained from all the symptomatic melons, whereas no fragment was obtained from RNA extracted from leaves of healthy controls. The 500-bp fragment from four plants from California and five plants from Arizona was sequenced and found to be identical for all nine isolates (GenBank Accession No. EF121768). The sequenced region of the California and Arizona Cucurbit yellow stunting disorder virus (CYSDV) isolates was identical to that from a CYSDV isolate from Texas (GenBank Accession No. AY242077) and shared 99% identity with a CYSDV isolate from Spain (GenBank Accession No. AJ537493). Subsequent RT-PCR analysis of RNA from these nine plants, with primers specific to the capsid protein (CYScp1F 5′ GCACGGTGACCAAAAGAAG 3′ and CYScp1R 5′ GAA-CATTCCAAAACTGCGG 3′) and HSP70h (CYShspF 5′ TGATGTATG-ACTTCGGAGGAGGAAC 3′ and CYShspR 5′ TCAGCGGACAAA-CCACCTTTC 3′) genes of CYSDV, was used to further confirm virus identity. The expected fragments, 202 and 175 bp, respectively, were amplified from all nine samples, but not from healthy controls. DNA extracts also were prepared from these nine melon samples from California and Arizona, and PCR assays were conducted for the begomoviruses Cucurbit leaf crumple virus (CuLCrV) and Squash leaf curl virus (SLCV) (2). The four plants from California showed crumpling, curling, and yellowing symptoms; all were infected with SLCV and one with CuLCrV. The five plants from Arizona showed mostly yellowing symptoms; five were infected with SLCV and two with CuLCrV. These results demonstrate begomovirus and crinivirus co-infection. The economic impact of mixed infections with CYSDV and begomoviruses remains to be determined. Incidence of CYSDV in melon was directly correlated with incidence of its vector, B. tabaci. Host range information has demonstrated that the primary hosts of CYSDV are members of the Cucurbitaceae (1). A number of experimental hosts have been documented; however, the extensive vegetable production in the southwestern United States warrants further study on the potential for the establishment of local reservoirs in both crop and weed species in the area. The virus causes economic losses worldwide for curcurbit production. References: (1) A. Celix et al. Phytopathology 86:1370, 1996. (2) R. Gilbertson. Ann. Rep. CA Melon Res. Board, 2001. (3) R. Martin et al. Acta Hortic. 656:137, 2004. (4) G. Wisler et al. Plant Dis. 82:270. 1998.

scholarly journals Cucurbit leaf curl virus, a New Whitefly Transmitted Geminivirus in Arizona, Texas, and Mexico

Plant Disease ◽  
2000 ◽  
Vol 84 (7) ◽  
pp. 809-809 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris ◽  
M. W. Olsen ◽  
M. E. Miller ◽  
T. Isakeit ◽  
...  
Keyword(s):  
Binding Site ◽  
Field Isolate ◽  
Bipartite Begomovirus ◽  
Degenerate Primers ◽  
Field Isolates ◽  
Squash Leaf Curl Virus ◽  
Cp Gene ◽  
Honeydew Melon ◽  
Leaf Curl Virus ◽  
Leaf Curl

In 1998 to 1999, geminivirus-like symptoms were observed in whitefly-infested pumpkin, honeydew melon, and muskmelon in Arizona and Texas and in Coahuilla, Mexico (MX), respectively. Plants exhibited leaf curl and/or mottling, reminiscent of symptoms caused by Squash leaf curl virus (SLCV-WAZ) described from Arizona in 1981 (2). The isolate from Arizona pumpkin fields was experimentally transmitted to pumpkin seedlings by the “B type” of Bemisia tabaci (Genn.), and symptoms were indistinguishable from those observed in infected fields. Samples from AZ, MX, and TX were assessed for begomovirus presence by polymerase chain reaction (PCR) using degenerate primers that amplify a contiguous fragment containing the viral coat protein (Cp) gene and common region (CR) of the A component (CR-A) (~2,100 bp) and a fragment containing the CR of the B component (CR-B) (~1,100 bp). One to four isolates from each location were examined by PCR using both primer pairs, and at least three amplicons per isolate were cloned and their sequences determined. Alignment of viral Cp nucleotide (nt) sequences revealed that AZ [AF256199], MX, and TX field isolates shared 98.7 to 100% sequence identity, but were only 84.5 to 85.6% identical to the Cp gene of SLCV-extended (SLCV-E) [M38183] and SLCV-restricted (SLCV-R) (S. G. Lazarowitz, unpublished), respectively, suggesting a new, previously undescribed begomoviral species (3). Further, the Cp nt sequence of the three field isolates was 6 nt shorter than SLCV-E, SLCV-WAZ [AF256203], and SLCV-R Cp sequences. The CR-A [AF256200] and CR-B [AF256201] sequences (179 nt, each) of field isolates, including the theoretical Rep binding element, GGTGT, were 100% identical. Although the Rep binding site is identical among field isolates, SLCV-E, SLCV-R, and SLCV-WAZ, the field isolate CR sequence shared only 64.2, 67.5, and 66.9% overall identity with CR-A SLCV-E, SLCV-R [M63155], and SLCV-WAZ [AF256202], respectively. Prior to 1998 to 1999, SLCV-WAZ was the only New World begomovirus of cucurbits known to infect both melon (Cucumis) and pumpkin (Cucurbita) (1). Therefore, SLCV was initially suspected as the causal agent. However, here we provide evidence for a new, previously undescribed bipartite begomovirus of cucurbits in AZ, MX, and TX that is herein provisionally designated Cucurbit leaf curl virus (CuLCV). Prediction of its closest begomovirus relatives by Cp nt sequence and Rep binding site comparisons suggest that CuLCV is a new member of the SLCV lineage, also containing Bean calico mosaic virus, Cabbage leaf curl virus, SLCV-E, and Texas pepper virus-TAM. References: (1) J. K. Brown and M. R. Nelson. Phytopathology 74:1136, 1984. (2) J. K. Brown and M. R. Nelson. Ann. Appl. Biol. 115:243, 1986. (3) M. A. Mayo and C. R. Pringle. J. Gen. Virol. 97:649, 1998.

scholarly journals First Report of Tomato Yellow Leaf Curl Virus in Réunion Island

Plant Disease ◽  
1999 ◽  
Vol 83 (3) ◽  
pp. 303-303 ◽  
Author(s):  
M. Peterschmitt ◽  
M. Granier ◽  
R. Mekdoud ◽  
A. Dalmon ◽  
O. Gambin ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Economic Losses ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yield Reduction ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Capsid Protein Gene ◽  
Pcr Product ◽  
Leaf Curl Virus ◽  
Leaf Curl

In September 1997, stunting, reduced leaf size, leaf curling, and yellow margins were observed on tomato plants on a farm on the south coast of Réunion, a French island belonging to the Mascarenes archipelago. To our knowledge, these symptoms appeared to be characteristic of a tomato yellow leaf curl virus (TYLCV) infection. Diseased plants gave positive reactions with a triple antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), using ADGEN antibodies specific for begomoviruses (1). The serological results were confirmed by polymerase chain reaction (PCR) with a pair of degenerate primers—MP16, 5′-CCTCTAGATAATATTAC(C/T)(G/T)(G/A)(A/T)(T/G)G(G/A)CC-3′ and MP82, 5′-CGGAATTC(T/C)TGNAC(C/T)TT(G/A)CANGGNCC(T/C)T C(G/A)CA-3′—designed by Malla Padidam (ILTAB, San Diego, CA) to amplify a region of the A component of begomoviruses, between the intergenic conserved nonanucleotide sequence (TAATATTAC) and the first 5′ quarter of the capsid protein gene. A 500-bp PCR product was obtained from a symptomatic plant but not from a healthy looking one. After cloning the PCR product in a pGEM-T Easy vector (Promega, Madison, WI) and sequencing it with plasmid-specific primers (SP6, T7), the sequence was compared with the sequences of the NCBI data base, with the use of BLAST. Nineteen sequences among those producing the highest scoring segment pairs were compared with each other and with the 500-bp PCR product from Réunion by the Clustal method of MegAlign (DNASTAR, London). The Réunion sequence (AJ010790) was at least 94% similar to sequences of TYLCV isolates from the Dominican Republic (AF024715), Cuba (AJ223505), and Israel (X15656, X76319 for the mild clone). Based on these results, it appeared that the analyzed tomato plant was infected by a geminivirus isolate belonging to the Israeli species of TYLCV. A preliminary survey was carried out from December 1997 to April 1998 in both outdoor and protected tomato crops. Infected plants were detected by TAS-ELISA in 52 of the 123 locations visited. Severe economic losses were observed: 14 locations with 60 to 100% yield reduction and 11 locations with 40 to 60% yield reduction. All the infected samples were collected in the leeward coast, which is the driest region of the island. Although Bemisia tabaci (Gennadius) has been recorded since 1938 in Réunion (2), it has been observed on tomato crops only since 1997 and population levels were low compared with those of Trialeurodes vaporariorum Westwood. During the first six months of 1998, B. tabaci was found on Euphorbia heterophylla L., Lantana camara L., Solanum melongena L., S. nigrum L., and Phaseolus vulgaris L. These host plants often occur near infected tomato crops. References: (1) S. Macintosh et al. Ann. Appl. Biol. 121:297, 1992. (2) L. Russell and J. Etienne. Proc. Entomol. Soc. Wash. 87:202, 1985.

scholarly journals Introduction of the New World Squash leaf curl virus to Squash (Cucurbita pepo) in Egypt: A Potential Threat to Important Food Crops

Plant Disease ◽  
2006 ◽  
Vol 90 (9) ◽  
pp. 1262-1262 ◽  
Author(s):  
A. M. Idris ◽  
A. Abdel-Salam ◽  
J. K. Brown
Keyword(s):  
United States ◽  
New World ◽  
The United States ◽  
Pcr Analysis ◽  
Broad Host Range ◽  
Species Introduction ◽  
Crop Species ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

Squash plants showing leaf curling, yellow mottling, and reduced fruit set were observed in fields in Giza, Egypt in spring 2005. These particular symptoms had not been observed previously in zucchini squash plants in Egypt, but were reminiscent of those caused by begomoviruses (Geminiviridae) that are known to occur in the region, including Watermelon chlorotic stunt virus. Squash plants were heavily infested with the whitefly Bemisia tabaci (Genn.), the only known vector of begomoviruses. Total nucleic acids were isolated from symptomatic squash leaves using the cetyltrimethylammoniumbromide method, and extracts were subjected to polymerase chain reaction (PCR) analysis using two sets of PCR primers. One primer set (prAV2644 and prAC1154) was designed to amplify a fragment that contains the entire viral coat protein (Cp), while the second primer set (prBV1855 and prBC656) was designed to amplify the common region (CR) of DNA-B of begomoviruses (1). The expected size fragments were cloned and the sequence was determined for five clones each. Unexpectedly, the Cp and the CR-B fragments shared their highest nucleotide sequence (nt) identity among well-characterized begomoviruses to the bipartite Squash leaf curl virus (SLCV) native to the western United States. A third primer set (prAC344 and prAV1134) (1) was subsequently used to amplify the remainder of the putative SLCV DNA-A. The fragment was cloned and the DNA sequence was determined. Assembly of the overlapping DNA-A fragments resulted in a complete DNA-A component sequence of 2,636 nt, which is identical to the expected size of the SLCV DNA-A component (GenBank Accession No. DQ285019). Comparison with the latter sequence indicated that the Egyptian squash isolate shared 98% nt identity with SLCV. The sequence for the DNA-B fragment (1,162 nt) shared 94% nt identity with SLCV and was deposited in GenBank as Accession No. DQ285020. The high-shared nt identity with SLCV (2) from the United States suggests that this isolate, herein SLCV-EG, has been introduced into Egypt. The relatively low DNA-B nt sequence identity was a not a surprise since this component is normally less conserved even between strains of a single begomoviral species. Introduction of SLCV is not only potentially significant to the domestic production of crop species in the Cucurbitaceae but also for legume crops. SLCV has a broad host range that also includes members of the Fabaceae, which includes species that contribute significant sources of protein for much of Egypt's population. The virus thus far is thought to be present only in Lower Egypt, however, it could feasibly threaten legume and cucurbit crops if it spreads to Upper Egypt. To our knowledge, this is the first begomovirus of New World origin to become established in the Old World. References: (1) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998. (2) S. G. Lazarowitz. Virology 180:70, 1991.

scholarly journals Cucurbit leaf crumple virus (CuLCrV) associated to watermelon disease in Campeche state, Mexico

Plant Disease ◽  
2020 ◽  
Author(s):  
Edgar Antonio Rodríguez-Negrete ◽  
Rafael Jordan-Ramírez ◽  
Norma Elena Leyva-López ◽  
Jesus Mendez-Lozano
Keyword(s):  
Citrullus Lanatus ◽  
Infectious Clone ◽  
Rolling Circle Amplification ◽  
Yield Reduction ◽  
Specific Primers ◽  
Genebank Accession ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Cucurbit Leaf Crumple Virus ◽  
Leaf Curl

An annual recurrent disease causing yield reduction in cultivated watermelon (Citrullus lanatus) was documented by the growers in different farms of Campeche state, Mexico. In April 2019 and March 2020 open field grown watermelon plants showed symptoms such as leaf curling, crumpling, and leaf basal or apical necrosis (Figure S1), with an incidence ranging from 30 up to 80%. These plants also presented high populations of whitefly, especially in the most affected fields. In order to identify the causal agent of the disease, a total of 22 symptomatic watermelon plants were collected in four locations from Campeche state. Total nucleic acids (DNA and RNA) were extracted from these leaf samples. Initially, RT-PCR analysis was performed with specific primers (Table S1) for cucurbit-infecting Crinivirus transmitted by whitefly but the expected size PCR product for those viruses was not amplified in any of these samples. To investigate the presence of cucurbit-infecting begomoviruses, PCR was performed by using specific primers for those begomoviruses reported in Mexico and north/central America including Squash leaf curl virus (SLCV), Watermelon chlorotic stunt virus (WmCSV), Melon chlorotic leaf curl virus (MCLCuV), and Cucurbit leaf crumple virus (CuLCrV) (Table S1). Only the expected amplicon size of ~1089 bp for CuLCrV was amplified from DNA extracts from all 22 watermelon samples, suggesting a single cucurbit-associated virus. The putative complete genome of the CuLCrV Campeche isolate was amplified by circular DNA enrichment using a Rolling Circle Amplification (RCA) procedure from two representative samples, followed by enzymatic digestion using BamHI, EcoRI, KpnI, and SacI enzymes (Inoue-Nagata et al., 2004). Expected linearized full-length viral components (~2.7 kb) were obtained with EcoRI and SacI, and both products, from one selected sample, were cloned in to pGreen0029 vector and were fully sequenced. Sequence analysis of the EcoRI clone, designated as LV2019Camp_A (deposited in GenBank accession no. MW273384) revealed the highest identity of 97.52% to CuLCrV DNA-A isolate Baja California Sur isolate (GeneBank accession no. MN625831.1), whereas the KpnI clone, designated as LV2019Camp_B (deposited in GenBank accession no. MW273385), shared 94.87% identity with DNA B of CuLCrV isolate Arizona (GeneBank accession no. AF327559.1). Subsequently, CuLCrV isolate Campeche-derived agroinfectious clone, was obtained by constructing a partial dimeric tandem repeat of both DNA-A and DNA-B components (Bang et al., 2014). Twelve watermelon plants were agroinfiltrated with the infectious clone at the fourth true leaf stage, resulting in symptomatic plants (11/12) exhibiting leaf yellowing, curling, and crumpling 15 days after agroinfiltrated (Figure S1), and CuLCrV infection was confirmed by PCR specific detection using DNA extract from non-inoculated leaves. Previously CuLCrV has been detected in the USA (Arizona, Texas, California, Florida, South Carolina, and Georgia), and north Mexico (Coahuila) infecting cucurbits including squash, cucumber, cantaloupe, pumpkin, and watermelon (Brown et al., 2000., Keinath et al., 2018), in both single and mixed infection with other whitefly transmitted RNA viruses (CYSDV, genera Crinivirus), and DNA viruses (SLCV, genera Begomovirus) (Kuo et al., 2007). To our knowledge, this is the first report of CuLCrV infecting a cucurbit crop in the Campeche state from the Yucatán peninsula, in Mexico.

scholarly journals First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba

Plant Disease ◽  
2008 ◽  
Vol 92 (5) ◽  
pp. 836-836 ◽  
Author(s):  
Y. Martínez-Zubiaur ◽  
E. Fiallo-Olivé ◽  
J. Carrillo-Tripp ◽  
R. Rivera-Bustamante
Keyword(s):  
Tomato Yellow Leaf ◽  
Pcr Analysis ◽  
Mixed Infections ◽  
Yellow Leaf ◽  
Rt Pcr ◽  
Specific Primers ◽  
First Report ◽  
Tomato Chlorosis Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

scholarly journals Resistanceto Cucurbit Leaf Crumple Virus in Melon

HortScience ◽  
2005 ◽  
Vol 40 (4) ◽  
pp. 1108E-1109 ◽  
Author(s):  
James D. McCreight ◽  
Hsing-Yeh Liu ◽  
Thomas A. Turini
Keyword(s):  
Sweet Potato ◽  
Cucumis Melo ◽  
Field Data ◽  
Field Tests ◽  
Squash Leaf Curl Virus ◽  
Biotype B ◽  
Leaf Curl Virus ◽  
Cucurbit Leaf Crumple Virus ◽  
Greenhouse Tests ◽  
Leaf Curl

Cucurbit leaf crumple geminivirus (CuLCrV) is transmitted by sweet-potato whitefly (Bemisia tabaci) biotype B (SPWF-B) and occurs on cucurbits in Arizona, California, Texas, and Mexico. This virus is identical to Cucurbit leaf curl virus, and their symptoms are similar to Squash leaf curl virus on squash (Cucurbita sp.) and Melonleaf curl virus on melon (Cucumis melo L.). Melon has been reported to be either susceptible to CuLCrV, or to have the ability to recover from infection. Twenty-three melon cultigens were inoculated with CuLCrV in greenhouse tests using SPWF-B. Eighteen of the cultigens tested were highly susceptible to CuLCrV (≥60% infected plants) and generally exhibited pronounced CuLCrV symptoms: `Amarillo', `Edisto 47', `Esteem', `Fuyu 3', `Impac', `Moscatel Grande', `Negro', `Perlita', PI 234607, PI 236355, PI 414723, `PMR 5', `Seminole', `Sol Dorado', `Sol Real', `Top Mark', `Vedrantais', and WMR 29. Five cultigens were resistant to CuLCrV (<40% infected plants that exhibited restricted, mild symptoms): MR-1, PI 124111, PI 124112, PI 179901, and PI 313970. Symptoms abated with time in both groups although infected plants remained positive for the virus. Ten of the cultigens (`Edisto 47', `Fuyu 3', `Impac', MR-1, PI 124112, PI 313970, PI 414723, `PMR 5', `Top Mark', and WMR 29) were included in field tests in 2003 and 2004 that were naturally infected with CuLCrV. With the exception of PI 414723, the greenhouse and field data were consistent for reaction to CuLCrV.

scholarly journals First Report of Squash leaf curl virus in Cucurbits in Lebanon

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1231-1231 ◽  
Author(s):  
H. Sobh ◽  
J. Samsatly ◽  
M. Jawhari ◽  
C. Najjar ◽  
A. Haidar ◽  
...  
Keyword(s):  
Citrullus Lanatus ◽  
Rolling Circle Amplification ◽  
Nucleotide Identity ◽  
Small Scale ◽  
Degenerate Primers ◽  
Squash Leaf Curl Virus ◽  
Pcr Assays ◽  
Leaf Curl Virus ◽  
Severe Leaf ◽  
Leaf Curl

During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5′AGCTGTATCTTGGGCAACAGA3′ and SqA2F: 5′TATCTCCCATCTTGGCAAGG3′; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production. References: (1) Antignus et al. Phytoparasitica 31:415, 2003. (2) Guenoune-Gelbart et al. J. Virol. Methods 168:87, 2010. (3) Rojas et al. Plant Dis. 77:340, 1993. (4) Zhang et al. J. Virol. Methods 71:45, 1998.

scholarly journals Leaf Curl Disease of Carica papaya from India May Be Caused by a Bipartite Geminivirus

Plant Disease ◽  
1998 ◽  
Vol 82 (1) ◽  
pp. 126-126 ◽  
Author(s):  
Sangeeta Saxena ◽  
Vipin Hallan ◽  
B. P. Singh ◽  
P. V. Sane
Keyword(s):  
Southern Blot ◽  
Blot Hybridization ◽  
Southern Blot Hybridization ◽  
Dna Probes ◽  
Economic Losses ◽  
Degenerate Primers ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Papaya has considerable economic importance to agriculture in India. Papaya leaf curl disease was first reported in 1939 by Thomas and Krishnaswamy (3). This disease is of moderate incidence and widely distributed in India. Recent observations of papaya fields in India indicated that there has been a continued increase in the incidence of papaya leaf curl disease (as shown by symptoms), resulting in severe economic losses. The disease is characterized by downward curling and cupping of leaves followed by vein clearing and thickening. Enations develop in the form of frills on green veins. The affected leaves become leathery and brittle and the petioles become twisted in a zig-zag manner. Diseased plants may bear a few small fruits, which are distorted in shape and tend to fall prematurely. The disease could be transmitted by the whitefly Bemisia tabaci Genn. Therefore, possible involvement of a geminivirus was suspected. Three different cloned geminiviral DNAs, Indian tomato leaf curl virus (ITLCV) (2), tomato yellow leaf curl virus from Sardinia (TYLCV Sar), and tomato golden mosaic virus (TGMV), were used as probes (with radioactive labeling) to detect the presence of geminiviral DNA from infected papaya tissue in both slot-blot and Southern blot hybridization studies with high stringency washes. These DNA probes gave strong signals with DNA isolated from infected papaya tissue whereas they did not give any signals with DNA from healthy tissue. Further, successful polymerase chain reaction (PCR)-based amplification of fragments from both DNA-A and DNA-B components with geminivirus degenerate primers (1) was accomplished only from the DNA of infected papaya plants. The PCR-amplified DNA fragments gave positive signals in Southern blot hybridization with the three geminiviral DNA probes. These results suggest that the causal agent of papaya leaf curl disease is a bipartite geminivirus that may be provisionally called papaya leaf curl virus (PLCV). References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) K. M. Srivastava et al. J. Virol. Methods 51:297, 1995. (3) K. M. Thomas and C. S. Krishnaswamy. Curr. Sci. 8:316, 1939.

scholarly journals Characterization of a Synergistic Interaction Between Two Cucurbit-Infecting Begomoviruses: Squash leaf curl virus and Watermelon chlorotic stunt virus

2011 ◽  
Vol 101 (2) ◽  
pp. 281-289 ◽  
Author(s):  
Tali Sufrin-Ringwald ◽  
Moshe Lapidot
Keyword(s):  
Eastern Mediterranean ◽  
Dual Infection ◽  
Synergistic Interaction ◽  
Bipartite Begomoviruses ◽  
Disease Symptoms ◽  
Squash Leaf Curl Virus ◽  
Effect On Yield ◽  
Leaf Curl Virus ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Squash leaf curl virus (SLCV) and Watermelon chlorotic stunt virus (WmCSV) are cucurbit-infecting bipartite begomoviruses. Both viruses are found in the eastern Mediterranean basin but the effects of dual infection of both viruses on melon (Cucumis melo L.) have not been described. ‘Arava’ melon plants were inoculated in the greenhouse, using whiteflies, with either SLCV, WmCSV, or both. Control plants were exposed to nonviruliferous whiteflies or not exposed at all. Following inoculation, plants were transplanted to a 50-mesh insect-proof nethouse and grown until fruit maturity. The experiment was performed in two melon-growing seasons: spring, transplant in May and harvest in July; and summer, transplant in August and harvest in October. Following inoculation, SLCV-infected melon plants showed mild symptoms that disappeared with time, and there was no effect on plant height. WmCSV-infected plants developed disease symptoms that became more obvious with time, and plants were somewhat shorter than control plants in the spring but not in the summer. SLCV had no effect on yield, regardless of season. WmCSV had no statistically significant effect on yield in the spring but, in the summer, reduced yield by 22%, on average. Dual-inoculated plants showed a synergistic interaction between the two viruses. They developed disease symptoms that were more pronounced than WmCSV alone, with plants being shorter than control plants by 20 to 25% regardless of season. Moreover, the yield of dual-inoculated plants was reduced on average by 21% in the spring and 54% in the summer, and fruit appearance was adversely affected. Dual inoculation did not affect WmCSV DNA level but SLCV DNA level was increased several-fold by the presence of WmCSV.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Sign in / Sign up

Export Citation Format

Share Document