scholarly journals First Report of Bacterial Spot of Tomato Caused by Xanthomonas gardneri in Pennsylvania

Plant Disease ◽  
2010 ◽  
Vol 94 (5) ◽  
pp. 638-638 ◽  
Author(s):  
S. H. Kim ◽  
T. N. Olson ◽  
N. D. Peffer ◽  
E. V. Nikolaeva ◽  
S. Park ◽  
...  
Keyword(s):  
United States ◽  
Type Strain ◽  
Tap Water ◽  
The United States ◽  
Nutrient Broth ◽  
Rrna Gene ◽  
Bacterial Spot ◽  
Tomato Plants ◽  
First Report ◽  
Leaf Spots

Recent investigation of bacteria isolated from samples submitted to the Plant Disease Diagnostic Laboratory, Pennsylvania Department of Agriculture indicated that in 1995, Xanthomonas gardneri (ex Sutic 1957) (2) caused a leaf spot on tomato plants (Lycopersicon esculentum Mill.). In 1995, we examined 185 tomato and 36 pepper samples (13 field, 2 garden center, 38 greenhouse, 4 residence, 16 field-grown transplant, and 148 greenhouse-grown transplant samples). A processing company representative collected samples showing symptoms of bacterial spot of tomato on a hybrid, whole pack processing tomato, from a 16-ha field in Northumberland County, PA exhibiting almost 50% crop infection. Symptoms consisted of circular- to irregularly shaped, dark brown spots, <5 mm in diameter, and frequently with chlorotic haloes on leaves and stems. The center of a spot may be raised and scabby. Several spots on a single leaflet may coalesce and a portion or the entire leaflet may turn yellow or die. These symptoms were indistinguishable from those of bacterial spot caused by X. euvesicatoria, X. vesicatoria, and X. perforans. Bacterial streaming from lesions was evident under dark-field microscopy. Aerobic, gram-negative, yellow-pigmented, mucoid bacteria were isolated from the leaf spots and purified and stored in nutrient broth with 10% glycerol at –80°C. The 16S rRNA gene from a strain (PDA80951-95) typical of the cultures from these samples was sequenced (GenBank Accession No. GU573763). A BlastN search of GenBank revealed 100% nucleotide identity with the type strain of X. gardneri (XCGA2; No. AF123093). This strain also exhibited repetitive sequence-based (rep)-PCR profiles (4) identical to profiles of X. gardneri type strain XCGA2 DNA and produced a ~425-bp PCR product with BSX primers, a genetic marker indicative of X. gardneri (1). The strain was not amylolytic or pectolytic (2) and failed to utilize maltose, gentiobiose, and melezitose (3). For pathogenicity tests, inoculum was grown in nutrient broth with shaking for 24 h at 28°C. Inoculum was centrifuged, resuspended in sterile tap water, and adjusted to 2.5 × 108 CFU/ml. Lower leaf surfaces of tomato (cvs. Bonnie Best and Walter) and pepper (cvs. California Wonder and Early Niagara) plants were gently rubbed with sterile cheesecloth that was moistened with the inoculum. Strain PDA80951-95 caused leaf spots, with chlorotic haloes and occasional coalescence on both tomato and pepper, within 2 weeks at 15 s of mist per 20 min at 20 to 35°C in a secured greenhouse chamber. X. gardneri was only reisolated from symptomatic plants and its identity was confirmed by rep-PCR and absence of amylolytic and pectolytic activities. Negative controls consisting of X. campestris pv. campestris and sterile tap water did not show symptoms. A known type strain of X. gardneri was not included as a positive control for pathogenicity studies because this species is not known to occur in the United States (2). To our knowledge, this is the first report of bacterial spot on tomato plants caused by X. gardneri in Pennsylvania and the United States. Since the first occurrence in 1995, bacterial spot caused by X. gardneri reoccurred in Pennsylvania tomato fields in 2001 and consecutively from 2003 to 2009. Reference: (1) D. A. Cuppels et al. Plant Dis. 90:451, 2006. (2) J. B. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) A. M. Quezado-Duval et al. Plant Dis. 88:15, 2004. (4) D. J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

scholarly journals First Report of Alternaria Leaf Spot of Banana Caused by Alternaria alternata in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1116-1116 ◽  
Author(s):  
V. Parkunan ◽  
S. Li ◽  
E. G. Fonsah ◽  
P. Ji
Keyword(s):  
United States ◽  
Alternaria Alternata ◽  
Leaf Spot ◽  
Morphological Characteristics ◽  
The United States ◽  
Its Sequencing ◽  
Single Spore ◽  
First Report ◽  
Alternaria Leaf Spot ◽  
Leaf Spots

Research efforts were initiated in 2003 to identify and introduce banana (Musa spp.) cultivars suitable for production in Georgia (1). Selected cultivars have been evaluated since 2009 in Tifton Banana Garden, Tifton, GA, comprising of cold hardy, short cycle, and ornamental types. In spring and summer of 2012, 7 out of 13 cultivars (African Red, Blue Torres Island, Cacambou, Chinese Cavendish, Novaria, Raja Puri, and Veinte Cohol) showed tiny, oval (0.5 to 1.0 mm long and 0.3 to 0.9 mm wide), light to dark brown spots on the adaxial surface of the leaves. Spots were more concentrated along the midrib than the rest of the leaf and occurred on all except the newly emerged leaves. Leaf spots did not expand much in size, but the numbers approximately doubled during the season. Disease incidences on the seven cultivars ranged from 10 to 63% (10% on Blue Torres Island and 63% on Novaria), with an average of 35% when a total of 52 plants were evaluated. Six cultivars including Belle, Ice Cream, Dwarf Namwah, Kandarian, Praying Hands, and Saba did not show any spots. Tissue from infected leaves of the seven cultivars were surface sterilized with 0.5% NaOCl, plated onto potato dextrose agar (PDA) media and incubated at 25°C in the dark for 5 days. The plates were then incubated at room temperature (23 ± 2°C) under a 12-hour photoperiod for 3 days. Grayish black colonies developed from all the samples, which were further identified as Alternaria spp. based on the dark, brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (2). Conidia were 23 to 73 μm long and 15 to 35 μm wide, with a beak length of 5 to 10 μm, and had 3 to 6 transverse and 0 to 5 longitudinal septa. Single spore cultures of four isolates from four different cultivars were obtained and genomic DNA was extracted and the internal transcribed spacer (ITS1-5.8S-ITS2) regions of rDNA (562 bp) were amplified and sequenced with primers ITS1 and ITS4. MegaBLAST analysis of the four sequences showed that they were 100% identical to two Alternaria alternata isolates (GQ916545 and GQ169766). ITS sequence of a representative isolate VCT1FT1 from cv. Veinte Cohol was submitted to GenBank (JX985742). Pathogenicity assay was conducted using 1-month-old banana plants (cv. Veinte Cohol) grown in pots under greenhouse conditions (25 to 27°C). Three plants were spray inoculated with the isolate VCT1FT1 (100 ml suspension per plant containing 105 spores per ml) and incubated under 100% humidity for 2 days and then kept in the greenhouse. Three plants sprayed with water were used as a control. Leaf spots identical to those observed in the field were developed in a week on the inoculated plants but not on the non-inoculated control. The fungus was reisolated from the inoculated plants and the identity was confirmed by morphological characteristics and ITS sequencing. To our knowledge, this is the first report of Alternaria leaf spot caused by A. alternata on banana in the United States. Occurrence of the disease on some banana cultivars in Georgia provides useful information to potential producers, and the cultivars that were observed to be resistant to the disease may be more suitable for production. References: (1) E. G. Fonsah et al. J. Food Distrib. Res. 37:2, 2006. (2) E. G. Simmons. Alternaria: An identification manual. CBS Fungal Biodiversity Center, Utrecht, Netherlands, 2007.

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Poinsettia ‘Luv U Pink’ in Taiwan

Plant Disease ◽  
2021 ◽  
Author(s):  
Che-Chang Liang ◽  
P. Janet Chen
Keyword(s):  
United States ◽  
18S Rrna ◽  
The United States ◽  
18S Rrna Gene ◽  
Rrna Gene ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Mock Control ◽  
Haplotype 1 ◽  
Coii Region

Poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch.), originated in southern Mexico and northern Guatemala, is the most valuable potted flowering plant in the spurge family (Euphorbiaceae). The European Union and the United States are two biggest poinsettia markets (Taylor et al. 2011), with a wholesale value of $153 million in the United States in 2019. Root knot galls of poinsettia ‘Luv U Pink’ were collected from a production greenhouse located in Nantou County, Taiwan in March 2021. No aboveground symptoms were observed. A nematode population was established from a single female and used for identification and the Koch’s postulate. The perineal patterns of randomly picked 5 females are round or ovoid with moderate to high dorsal arches, but no distinct lateral lines, ventral striae are fine and smooth. The Morphometric characters of second-stage juvenile include: a vermiform body shape, tail narrow and tapering with rounded tail tips, and a distinct hyaline tail end. Measurements of 20 J2 are as follows: body length, 430 (398 - 473) μm; body width, 15.4 (13.4 - 17.8) μm; stylet length,13.4 (13.0 - 14.0) μm; dorsal esophageal gland orifice to basal knob, 3.4 (2.8 - 3.9) μm; tail length, 52.9 (47.6 - 62.2) μm. All morphometric data were consistent with the original description of Meloidogyne enterolobii (Yang and Eisenback 1983). Nematode DNA was extracted using GeneMark Tissue & Cell Genomic DNA Purification Kit (GeneMark, Taiwan) from approximately 1500 J2 and used for amplification of 18S rRNA gene, a D2-D3 region of 28S rRNA gene, and a mtDNA COII region with primer sets 1A/MelR, D2A/D3B, and C2F3/1108, respectively (Power and Harris 1993, Subbotin et al. 2006, Tigano et al. 2005). The sequence of 18S rRNA gene (accession no. MZ948800 haplotype 1 and MZ955998 haplotype 2), haplotype 1 shared 100% identity with that of M. enterolobii from the United States (KP901058) and China (MN832688); haplotype 2 shared 99.8% identity with that of KP901058 and MN832688. The sequence of the D2-D3 region (MZ955995) shared 99% identity with that M. enterolobii from the United States (KP901079). Sequence of the COII region (MZ964625) also shared 99% identity with that of M. enterolobii from the United States (AY446975) and China (MN840970). Phylogenetic trees of the three gene sequences plotted as described by Ye et al. (2021) revealed that the newly described nematode was grouped with M. enterolobii. Sequence analysis of two fragments: 236 bp and 520 bp amplified with gene specific primers Me-F/R and MK7F/R, respectively (Long et al. 2006, Tigano et al. 2010) also confirmed the identity of M. enterolobii. To measure the reproductive factor (Rf), the Poinsettia ‘Luv U Pink’ seedlings with eight true leaves were transplanted into three 12-cm diameter pots each containing 6000 eggs or water (mock control). Forty-five days after inoculation, the average Rf value of three inoculated plants was 6, and no galls were observed on mock control plant roots, confirming that poinsettia is the host of M. enterolobii. M. enterolobii has been reported in several Euphorbia species, including E. heterophylla, E. prostrata, E. punicea and E. tirucalli (Han et al. 2012, Rich et al. 2009). To the best of our knowledge, this is the first report of M. enterolobii infecting E. pulcherrima ‘Luv U Pink’. 

scholarly journals First Report of Web Blight on Yellow-Sage (Lantana camara) Caused by Rhizoctonia solani in Europe

Plant Disease ◽  
2003 ◽  
Vol 87 (7) ◽  
pp. 875-875 ◽  
Author(s):  
A. Garibaldi ◽  
A. Minuto ◽  
D. Bertetti ◽  
R. Nicoletti ◽  
M. L. Gullino
Keyword(s):  
United States ◽  
Rhizoctonia Solani ◽  
The United States ◽  
The Philippines ◽  
Lantana Camara ◽  
First Report ◽  
Leaf Spots ◽  
Entire Plant ◽  
Pathogenicity Tests ◽  
Web Blight

Lantana camara is increasingly grown in northern Italy as a potted plant and contributes to the diversification of offerings in the ornamental market. During the spring of 2001, selections of L. camara cuttings growing at a commercial farm located at Albenga (Riviera coast) exhibited tan leaf spots of irregular size and shape. Spots were at first isolated, 4 to 8 mm in diameter, and later coalesced and affected the entire plant. Heavily infected leaves, stems, and branches became blighted and were killed. Infected rooted cuttings also eventually died. Diseased cuttings showed a progressive reduction (to less than 20%) in rooting ability. Isolations from infected leaves and stems on potato dextrose agar (PDA), supplemented with 100 mg/liter of streptomycin sulphate, consistently yielded a fungus with mycelial and cultural characteristics resembling Rhizoctonia solani. The fungal isolates were further characterized as R. solani Kühn AG-4 based on hyphal anastomoses with several AG-4 tester isolates. Pathogenicity tests were performed by placing 5-day-old-fungal mycelial plugs, grown on PDA, at the base of five healthy yellow-sage stems and holding plants in a dew chamber at 18 to 22°C. After 2 days, foliage blight appeared on leaves of inoculated plants, and after 3 days, stems also became infected and entire plants wilted. Five noninoculated plants remained healthy. The fungal pathogen was reisolated from all inoculated plants. R. solani has been observed on L. camara in the United States (1) and the Philippines (2). To our knowledge, this is the first report of R. solani on L. camara in Europe. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) F. T. Orillo and R. B. Valdez. Philipp. Agric. A. 42:292, 1958.

scholarly journals First Report of Bacterial Leaf Spot of Spinach Caused by a Pseudomonas syringae Pathovar in California

Plant Disease ◽  
2002 ◽  
Vol 86 (8) ◽  
pp. 921-921 ◽  
Author(s):  
S. T. Koike ◽  
H. R. Azad ◽  
D. C. Cooksey
Keyword(s):  
Brassica Oleracea ◽  
Beta Vulgaris ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
The United States ◽  
Nutrient Broth ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Leaf Spots ◽  
Initial Symptoms

In 2000 and 2001, a new disease was observed on commercial spinach (Spinacia oleracea) in the Salinas Valley, Monterey County, CA. Initial symptoms were water-soaked, irregularly shaped leaf spots (2 to 3 mm diameter). As the disease developed, spots enlarged to as much as 1 to 2 cm, were vein-delimited, and turned dark brown. Faint chlorotic halos sometimes surrounded the spots. Death of large areas of the leaf occurred if spots coalesced. Spots were visible from the adaxial and abaxial sides of leaves, and no fungal structures were observed. The disease occurred on newly expanded and mature foliage. No fungi were isolated from the spots. However, cream-colored bacterial colonies were consistently isolated on sucrose peptone agar, and these strains were nonfluorescent on King's medium B. Strains were positive for levan and negative for oxidase, arginine dihydrolase, and nitrate reductase. Strains did not grow at 36°C, did not rot potato slices, but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Turk). These results suggested the bacterium was similar to Pseudomonas syringae. Fatty acid methyl ester (FAME) analysis (MIS-TSBA 4.10, MIDI Inc., Newark, DE) indicated the strains were highly similar (80.1 to 89.3%) to P. syringae pv. maculicola. However, in contrast to P. syringae pv. maculicola, the spinach strains did not utilize the carbon sources erythritol, L+tartrate, L lactate, and DL-homoserine. Pathogenicity of 10 strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 106 CFU/ml, and spraying 4-week-old plants of spinach cv. Bossanova. Control plants were sprayed with sterile nutrient broth. After 5 to 8 days in a greenhouse (24 to 26°C), leaf spots identical to those observed in the field developed on cotyledons and true leaves of inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. The 10 strains were also inoculated on beet (Beta vulgaris), Swiss chard (Beta vulgaris subsp. cicla), cilantro (Coriandrum sativum), and spinach. Spinach showed leaf spots after 8 days; however, none of the other plants developed symptoms. Two strains were inoculated onto spinach cvs. Califlay, Lion, Nordic IV, Polka, Resistoflay, Rushmore, RZ 11, Spinnaker, Springfield, Viroflay, and Whitney. Leaf spot developed on all cultivars, and the pathogen was reisolated. Because the FAME data indicated a similarity between the spinach pathogen and P. syringae pv. maculicola, we inoculated sets of spinach cv. Bolero, cabbage (Brassica oleracea subsp. capitata cv. Grenedere), and cauliflower (Brassica oleracea subsp. botrytis cv. White Rock) with three P. syringae pv. maculicola and three spinach strains. Cabbage and cauliflower developed leaf spots only when inoculated with P. syringae pv. maculicola; spinach had leaf spots only when inoculated with the spinach strains. All inoculation experiments were done twice, and the results of the two tests were the same. To our knowledge, this is the first report of bacterial leaf spot of spinach in California caused by a nonfluorescent P. syringae, and the first record of this disease in the United States. Biochemical characteristics and limited host range of the pathogen indicate the California strains are likely the same as the P. syringae pv. spinaciae pathogen that was reported in Italy (1) and Japan (2). References: (1) C. Bazzi et al. Phytopathol. Mediterr. 27:103, 1988. (2) K. Ozaki et al. Ann. Phytopathol. Soc. Jpn. 64:264, 1998.

scholarly journals First Report of Leaf Spot Caused by a Cercosporella sp. on Centaurea solstitialis in Greece

Plant Disease ◽  
2004 ◽  
Vol 88 (12) ◽  
pp. 1382-1382 ◽  
Author(s):  
F. M. Eskandari ◽  
D. K. Berner ◽  
J. Kashefi ◽  
L. Strieth
Keyword(s):  
United States ◽  
Biological Control ◽  
Biological Control Agent ◽  
Aqueous Suspension ◽  
The United States ◽  
Centaurea Solstitialis ◽  
Voucher Specimen ◽  
Disease Symptoms ◽  
First Report ◽  
Leaf Spots

Centaurea solstitialis L. (yellow starthistle [YST]), family Asteraceae, an invasive weed in California and the western United States is targeted for biological control. During the spring of 2004, an epidemic of dying YST plants was found near Kozani, Greece (40°22′07″N, 21°52′35″E, 634 m elevation). Rosettes of YST had small, brown leaf spots on most of the lower leaves. In many cases, these spots coalesced and resulted in necrosis of many of the leaves and death of the rosette. Along the roadside where the disease was found, >100 of the YST plants showed disease symptoms. Diseased plants were collected, air dried, and sent to the quarantine facility of the Foreign Disease-Weed Science Research Unit (FDWSRU), USDA, ARS, Fort Detrick, MD. Diseased leaves were surface disinfested and placed on moist filter paper in petri dishes. Conidiophores and conidia were observed after 48 h. The fungal isolate, DB04-011, was isolated from these diseased leaves. Pathogenicity tests were performed by spray inoculating the foliage of 20 4-week-old YST rosettes with an aqueous suspension of 1 × 106 conidia per ml. Conidia were harvested from 2-week-old cultures grown on modified potato carrot agar (MPCA). Inoculated plants were placed in an environmental chamber at 23°C with 8 h of daily light and continuous dew for 48 h. Inoculated and control plants were moved to a 20°C greenhouse bench and watered twice per day. After 7 days, leaf spots were observed first on lower leaves. After 10–12 days, all inoculated plants showed typical symptoms of the disease. No symptoms developed on control plants. The pathogen, DB04-011, was consistently isolated from symptomatic leaves of all inoculated plants. Disease symptoms were scattered, amphigenous leaf spots in circular to subcircular spots that were 0.2 to 7 mm in diameter and brownish with distinct dark green margins. Intraepidermal stromata, 14 to 77 μm in diameter and pale yellow to brown, were formed within the spots. Conidiophores that arose from the stromata were straight, subcylindrical, simple, 70 to 95 × 2.8 to 4 μm, hyaline, smooth, and continuous or septate with conidial scars that were somewhat thickened, colorless, and refractive. Primary conidia were subcylindrical, slightly obclavate or fusiform, ovoid, 21 to 49 × 5 to 7.5 μm, 0 to 5 septate, hyaline, smooth, had a relatively rounded apex, and the hilum was slightly thickened. Conidial dimensions on MPCA were 11.2 to 39.2 × 4.2 to 7 μm (average 25.5 × 5.5 μm). Koch's postulates were repeated two more times with 20 and 16 plants. On the basis of fungal morphology, the organism was identified as a Cercosporella sp., (1,2; U. Braun and N. Ale-Agha, personal communication). To our knowledge, this is the first report of this genus of fungus parasitizing YST. Results of host range tests will establish if this isolate of Cercosporella has potential as a biological control agent of YST in the United States. A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI 844247). Live cultures are being maintained at FDWSRU and European Biological Control Laboratoryt (EBCL), Greece. References: (1) U. Braun. A Monograph of Cercosporella, Ramularia and Allied Genera (Phytopathogenic Hyphomycetes) Vol. 1. IHW-Verlage, Eching-by-Munich, 1995. (2) U. Braun. A Monograph of Cercosporella, Ramularia and Allied Genera (Phytopathogenic Hyphomycetes) Vol. 2. IHW-Verlage, 1998.

scholarly journals First Report of Leaf Spot of Sesame Caused by Xanthomonas sp. In the United States

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1222-1222 ◽  
Author(s):  
T. Isakeit ◽  
B. T. Hassett ◽  
K. L. Ong
Keyword(s):  
United States ◽  
Leaf Area ◽  
Its Region ◽  
The United States ◽  
Pcr Analysis ◽  
Sterile Water ◽  
First Report ◽  
Genomic Dna Isolation ◽  
Leaf Spots ◽  
Mist Chamber

In July 2010 in Texas, extensive leaf spots (10 to 30% leaf area affected) occurred on a commercial planting of sesame (Sesamum indicum L.) in Hidalgo County and to a lesser extent (1 to 5% leaf area) on leaves of several varieties in experimental trials in Colorado and Victoria Counties. The leaf spots were light to dark brown, somewhat circular, and 1 to 3 mm in diameter. A symptomatic leaf from each of three to five plants per county was sampled for isolations. Leaves were sprayed with 70% ethanol and immediately blotted dry with a paper towel. The margins of spots (2 mm2) were excised with a scalpel and placed in a drop of sterile water for 5 min. Drops were streaked on nutrient agar (NA) and incubated at 30°C. The 12 isolations consistently yielded gram-negative, rod-shaped bacteria with yellow, translucent colonies that were visible after 2 days of incubation. The DNA of 11 isolates was extracted with the Norgen (Thorold, ON) Bacterial genomic DNA isolation kit (Cat. #17900) and the ITS region was amplified by 16S uni 1330 and 23S uni 322 anti primers (1). PCR products were treated with the ZymoResearch (Irvine, CA) DNA clean & concentrator kit (Cat. #D4003) and sequenced. With the NCBI database, a BLAST search of the 1,100 bp amplicons showed 93 to 99% identity with pathovars of either Xanthomonas oryzae or X. axonopodis (GenBank Accession Nos. CP003057.1 and CP002914.1, respectively). Amplicon sequences of the sesame isolates were deposited in GenBank as Accession Nos. JQ975037 through JQ975047. The reported species on sesame is X. campestris pv. sesami (2). To fulfill Koch's postulates, potted sesame plants (var. Sesaco 25), 15 to 20 cm tall, were sprayed until runoff with a suspension of bacteria (106 to 107 CFU/ml) from a 2-day-old NA culture. All 12 isolates were evaluated, with five to seven plants per isolate. Plants were maintained in a mist chamber in a greenhouse at 27 to 30°C and 100% relative humidity. The pathogenicity trial was repeated once. Leaf spots were first seen 7 days after inoculation and were prevalent 14 days after inoculation. All 12 isolates were pathogenic. There were no symptoms on leaves sprayed with sterile water. Bacteria that produced colonies consistent with Xanthomonas were reisolated on NA from symptomatic leaves but not from controls. The identities of three isolates were reconfirmed with PCR analysis and sequencing. In 2007, more than 2,000 ha of sesame were grown in the continental United States, with 80% of that in Texas. Currently, acreage of shatter-free varieties of sesame is increasing in arid areas of Texas, Oklahoma, and Kansas. In such areas, the yield impact of this disease is likely to be minimal, except in years with above-average rainfall. To our knowledge, this is the first report of this disease in the United States. References: (1) E. R. Gonçalves and Y. B. Rosato. Int. J. Syst. Evol. Microbiol. 52:355, 2002. (2) J. M. Young et al., New Zealand J. Agric. Res. 21:153, 1978.

scholarly journals First Report of Leaf Spot Caused by Cercospora bizzozeriana on Lepidium draba in the United States

Plant Disease ◽  
2009 ◽  
Vol 93 (1) ◽  
pp. 108-108 ◽  
Author(s):  
A. J. Caesar ◽  
R. T. Lartey ◽  
D. K. Berner ◽  
T. Souissi
Keyword(s):  
United States ◽  
North America ◽  
Sugar Beet ◽  
Leaf Spot ◽  
The United States ◽  
Initial Report ◽  
Voucher Specimen ◽  
First Report ◽  
Leaf Spots ◽  
Lepidium Draba

The herbaceous perennial Lepidium draba L. is an invasive weed of rangelands and riparian areas in North America and Australia. As of 2002, it had infested 40,500 ha of rangeland in Oregon and large areas in Wyoming and Utah. Little is known of plant pathogens occurring on L. draba, especially in the United States, that could be useful for biological control of the weed. Leaf spots were first noted on a stand of L. draba near Shepherd, MT in 1997. The spots were mostly circular but sometimes irregularly shaped and whitish to pale yellow. The pathogen was erroneously assumed to be Cercospora beticola since its morphological traits closely resembled that species and the area had large fields of sugar beet with heavy Cercospora leaf spot incidence. Diseased leaves of L. draba were collected in 1997 and 2007. Conidia, borne singly on dark gray, unbranched conidiophores produced on dark stromata late in the season, were elongate, hyaline, multiseptate, 38 to 120 × 2 to 6 μm (mostly 38 to 50 × 2 to 5 μm) and had bluntly rounded tips and wider, truncate bases. These characteristics were consistent with the description of C. bizzozeriana Saccardo & Berlese (2). To isolate the fungus, spores were picked from fascicles of conidiophores with a fine-tipped glass rod, suspended in sterile water, and spread on plates of water agar. Germinated spores were transferred to potato dextrose agar (PDA). The ITS1, 5.8S, and ITS2 sequences of this fungus (GenBank Accession No. EU887131) were identical to sequences of an isolate of C. bizzozeriana from Tunisia (GenBank Accession No. DQ370428). However, these sequences were also identical to those of a number of Cercospora spp. in GenBank, including C. beticola. We also compared the actin gene sequences of the Montana isolate of C. bizzozeriana (GenBank Accession No. FJ205397) and an isolate of C. beticola from Montana (GenBank Accession No. AF443281); the sequences were 94.6% similar, an appreciable difference. For pathogenicity tests, cultures were grown on carrot leaf decoction agar. Aqueous suspensions of 104 spores per ml from cultures were sprayed on 6-week-old L. draba plants. Plants were covered with plastic bags and placed on the greenhouse bench at 20 to 25°C for 96 h. Koch's postulates were completed by reisolating the fungus from the circular leaf spots that appeared within 10 days, usually on lower leaves. Spores of C. bizzozeriana were also sprayed on seedlings of sugar beet, collard, mustard, radish, cabbage, and kale under conditions identical to those above. No symptoms occurred. After the discovery of the disease in 1997, plants of L. draba in eastern Montana, Wyoming, and Utah were surveyed from 1998 to 2003 for similar symptoms and signs, but none were found. This, to our knowledge, is the first report of C. bizzozeriana in the United States. The initial report of the fungus in North America was from Manitoba in 1938 (1). It has recently been reported as occurring on L. draba in Tunisia (4) and Russia (3) and is reported as common in Europe (2). A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) G. R. Bisby. The Fungi of Manitoba and Saskatchewan. Natl. Res. Council of Canada, Ottawa, 1938. (2) C. Chupp. A Monograph of the Fungus Genus Cercospora. C. Chupp, Ithaca, NY, 1953. (3) Z. Mukhina et al. Plant Dis. 92:316, 2008. (4) T. Souissi et al. Plant Dis. 89:206, 2005.

scholarly journals First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 633-633 ◽  
Author(s):  
H.-Y. Liu ◽  
J. L. Sears
Keyword(s):  
United States ◽  
The United States ◽  
Rt Pcr ◽  
Spot Virus ◽  
Chenopodium Amaranticolor ◽  
Tomato Plants ◽  
First Report ◽  
Chenopodium Murale ◽  
Tomato Field ◽  
Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

scholarly journals First Report of Black Leg of Hydroponic Basil in the United States Caused by Plectosporium tabacinum

Plant Disease ◽  
2010 ◽  
Vol 94 (4) ◽  
pp. 484-484 ◽  
Author(s):  
D. Egel ◽  
G. Ruhl ◽  
S. Hoke ◽  
M. B. Dicklow ◽  
R. Wick
Keyword(s):  
United States ◽  
The United States ◽  
Deionized Water ◽  
Rrna Gene ◽  
Diseased Plant ◽  
Poor Growth ◽  
First Report ◽  
Laboratory Bench ◽  
Black Leg ◽  
Stem Lesions

During August 2007 and again in January 2008, compact sweet basil (Ocimum basilicum ‘Genovese’) plants grown hydroponically in Indiana displayed dark, irregular, stem lesions extending 2 to 3 cm above the interface of the nutrient solution. These necrotic stem lesions (black leg), observed on 20 to 30% of the basil plants caused very weak, brittle stems so that they could not be marketed fresh. Although no wilting was noted, reduced plant height was observed. Similar symptoms of blackleg and poor growth have been reported from Italy on greenhouse-grown basil infected with Microdochium tabacinum (1,2). Diseased plant samples were sent to diagnostic clinics at Purdue University and the University of Massachusetts. Stem samples were surface sterilized and plated on potato dextrose agar (PDA) acidified with 1 ml of 85% lactic acid per liter as well as onto one-quarter-strength PDA. A fungus morphologically consistent with Plectosporium tabacinum (van Beyma) M.E. Palm, W. Gams, & H.I. Nirenberg (synonyms M. tabacinum (von Arx, 1984) and Fusarium tabacinum (Gams & Gerlagh, 1968) (3) was cultured from the basil stems and identified as P. tabacinum by R. Wick. Cultures sent to J. McKemy and J. Bischof (USDA/APHIS/PPQ) and W. Elmer (Connecticut Agricultural Experiment Station) also were identified as P. tabacinum. Amplification of the 323-bp internal transcribed spacer (ITS) region (ITS1, 5.8S rRNA gene, ITS2) and subsequent BLAST alignments of the resulting sequence indicated a 98% match for Plectosphaerella cucumerina (anamorph P. tabacinum) (GenBank Accession No. U17399; MIDI Inc., Newark, DE). Inoculations were performed on basil plants grown in peat-based soilless medium in a greenhouse for 6 weeks. Immediately before inoculation, the roots were washed with tap water to remove the peat-based medium. A single basil plant was placed in each of eight, 125-ml Erlenmeyer flasks. Four flasks were filled with 100 ml of deionized water as negative controls and four were filled with a 1 × 106 CFU/ml water suspension of P. tabacinum so that the liquid reached the crown of the basil plant. Basil plants in the Erlenmeyer flasks were incubated on a laboratory bench at 23°C. After 24 h, the solutions in all flasks were discarded and each flask and root system was rinsed three times with deionized water. The plants were then incubated in deionized water on the laboratory bench for four to five additional days. Within 4 days, dark brown-to-black stem lesions similar to those observed originally on basil plants in the hydroponic production greenhouse developed on the plants at the water interface and extended up the stem. Lesions extended a mean of 22 mm above the water level on inoculated plants. Control plants remained symptomless. P. tabacinum was recovered from symptomatic tissue of inoculated plants to complete Koch's postulates. The experiment was repeated several times with similar results. Further evidence of pathogenicity was obtained by stem inoculation of basil plants growing in a soilless medium. These data indicate that P. tabacinum was the causal agent of the symptoms observed on the hydroponic basil. To our knowledge, this is the first report of P. tabacinum causing ‘black leg’ and reduced growth on basil in the United States and the first report in the world of P. tabacinum on hydroponic basil. References: (1) A. Garibaldi et al. Plant Dis. 81:124.1997. (2) A. Matta. Riv. Patol. Veg. Ser. IV 14:119, 1978. (3) M. Palm et al. Mycologia. 87:397.1995.

scholarly journals First Report of Downy Mildew Caused by Peronospora lamii on Salvia splendens and Salvia coccinea

Plant Disease ◽  
2000 ◽  
Vol 84 (10) ◽  
pp. 1154-1154 ◽  
Author(s):  
G. E. Holcomb
Keyword(s):  
United States ◽  
Downy Mildew ◽  
Pathogenic Fungi ◽  
The United States ◽  
Commonwealth Mycological Institute ◽  
First Report ◽  
Leaf Spots ◽  
Salvia Splendens ◽  
Leaf Surfaces ◽  
Pathogenicity Tests

Angular chlorotic spots were observed on adaxial leaf surfaces of Salvia splendens (scarlet sage cvs. Empire Purple, Empire White, Red Pillar, and Red Hot Sally) and S. coccinea (scarlet or Texas sage cv. Lady in Red) in early May in Baton Rouge area nurseries. Leaf spots sometimes became necrotic and resulted in leaf drop. Abaxial leaf surfaces contained scattered patches of white mycelia with brown spores. Microscopic examination of mycelia revealed irregular dichotomously branched conidiophores with pointed tips and brown oval conidia. Conidiophores averaged 485 × 9 µm and conidia averaged 21 × 18 µm (16 to 26 × 15 to 23 µm) in dimensions. The fungus was identified as Peronospora lamii A. Braun (= P. swinglei Ellis & Everh.) based on these characters and its known occurrence on Salvia spp. and five other genera in the family Lamiaceae (2). Pathogenicity tests were performed by washing conidia from infected leaves into distilled water and mistinoculating S. coccinea cv. Lady in Red and S. splendens cv. Empire Purple with 50,000 spores/ml. Plants were held in a dew chamber at 20°C for 3 days, then moved to a greenhouse where temperatures ranged from 18 to 32°C. Typical angular chlorotic leaf spots developed on inoculated plants within 6 to 8 days and noninoculated plants remained healthy. The fungus did not sporulate under these greenhouse temperatures, but infected leaves that were removed and placed in a moist chamber at 25°C produced conidiophores and brown conidia typical of P. lamii within 2 to 3 days. P. lamii has been reported previously on S. officinalis (3) and S. reflexa (1) in the United States. This is the first report of downy mildew on S. coccinea and S. splendens. Appearance of the disease in retail nurseries that obtained plants from out of state (Arkansas) suggests a widespread occurrence of the disease on these host plants. References: (1) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN. (2) S. M. Francis. 1981. Peronospora lamii. Descriptions of Pathogenic Fungi and Bacteria No. 688. Commonwealth Mycological Institute, Kew, England. (3) R. T. McMillan and W. R. Graves. Plant Dis. 78:317, 1994.

Sign in / Sign up

Export Citation Format

Share Document