scholarly journals First Report of Bacterial Leaf Spot of Spinach Caused by a Pseudomonas syringae Pathovar in California

Plant Disease ◽  
2002 ◽  
Vol 86 (8) ◽  
pp. 921-921 ◽  
Author(s):  
S. T. Koike ◽  
H. R. Azad ◽  
D. C. Cooksey
Keyword(s):  
Brassica Oleracea ◽  
Beta Vulgaris ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
The United States ◽  
Nutrient Broth ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Leaf Spots ◽  
Initial Symptoms

In 2000 and 2001, a new disease was observed on commercial spinach (Spinacia oleracea) in the Salinas Valley, Monterey County, CA. Initial symptoms were water-soaked, irregularly shaped leaf spots (2 to 3 mm diameter). As the disease developed, spots enlarged to as much as 1 to 2 cm, were vein-delimited, and turned dark brown. Faint chlorotic halos sometimes surrounded the spots. Death of large areas of the leaf occurred if spots coalesced. Spots were visible from the adaxial and abaxial sides of leaves, and no fungal structures were observed. The disease occurred on newly expanded and mature foliage. No fungi were isolated from the spots. However, cream-colored bacterial colonies were consistently isolated on sucrose peptone agar, and these strains were nonfluorescent on King's medium B. Strains were positive for levan and negative for oxidase, arginine dihydrolase, and nitrate reductase. Strains did not grow at 36°C, did not rot potato slices, but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Turk). These results suggested the bacterium was similar to Pseudomonas syringae. Fatty acid methyl ester (FAME) analysis (MIS-TSBA 4.10, MIDI Inc., Newark, DE) indicated the strains were highly similar (80.1 to 89.3%) to P. syringae pv. maculicola. However, in contrast to P. syringae pv. maculicola, the spinach strains did not utilize the carbon sources erythritol, L+tartrate, L lactate, and DL-homoserine. Pathogenicity of 10 strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 106 CFU/ml, and spraying 4-week-old plants of spinach cv. Bossanova. Control plants were sprayed with sterile nutrient broth. After 5 to 8 days in a greenhouse (24 to 26°C), leaf spots identical to those observed in the field developed on cotyledons and true leaves of inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. The 10 strains were also inoculated on beet (Beta vulgaris), Swiss chard (Beta vulgaris subsp. cicla), cilantro (Coriandrum sativum), and spinach. Spinach showed leaf spots after 8 days; however, none of the other plants developed symptoms. Two strains were inoculated onto spinach cvs. Califlay, Lion, Nordic IV, Polka, Resistoflay, Rushmore, RZ 11, Spinnaker, Springfield, Viroflay, and Whitney. Leaf spot developed on all cultivars, and the pathogen was reisolated. Because the FAME data indicated a similarity between the spinach pathogen and P. syringae pv. maculicola, we inoculated sets of spinach cv. Bolero, cabbage (Brassica oleracea subsp. capitata cv. Grenedere), and cauliflower (Brassica oleracea subsp. botrytis cv. White Rock) with three P. syringae pv. maculicola and three spinach strains. Cabbage and cauliflower developed leaf spots only when inoculated with P. syringae pv. maculicola; spinach had leaf spots only when inoculated with the spinach strains. All inoculation experiments were done twice, and the results of the two tests were the same. To our knowledge, this is the first report of bacterial leaf spot of spinach in California caused by a nonfluorescent P. syringae, and the first record of this disease in the United States. Biochemical characteristics and limited host range of the pathogen indicate the California strains are likely the same as the P. syringae pv. spinaciae pathogen that was reported in Italy (1) and Japan (2). References: (1) C. Bazzi et al. Phytopathol. Mediterr. 27:103, 1988. (2) K. Ozaki et al. Ann. Phytopathol. Soc. Jpn. 64:264, 1998.

scholarly journals First Report of Bacterial Leaf Spot Caused by Pseudomonas syringae pv. aptata on Swiss Chard, Beta vulgaris subsp. vulgaris, in Arizona

Plant Disease ◽  
2021 ◽  
Author(s):  
Marilen Nampijja ◽  
Mike Derie ◽  
Lindsey J. du Toit
Keyword(s):  
Beta Vulgaris ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Phosphate Buffer ◽  
Negative Control ◽  
Bacterial Suspension ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Leaf Spots ◽  
Swiss Chard

Arizona is an important region of the USA for winter production of baby leaf crops such as spinach (Spinacia oleracea), table beet (Beta vulgaris subsp. vulgaris Condivita Group), and Swiss chard (B. vulgaris subsp. vulgaris Cicla Group). In the winter of 2019, severe leaf spots were observed at 80% incidence and 40% severity per plant in a 1-ha baby leaf Swiss chard crop of an (unknown cultivar) in Arizona. The lesions were circular to irregular, necrotic, water-soaked, and 1 to 5 mm in diameter. Symptomatic leaf sections (1-cm2) were surface-sterilized with 0.6% NaOCl, rinsed, and macerated in sterilized, deionized water. An aliquot of each macerate was streaked onto King’s B (KB) agar medium. Cream-colored, non-fluorescent colonies typical of Pseudomonas were isolated consistently, and all were non-fluorescent. A dozen isolates selected randomly were all negative for potato soft rot, oxidase, and arginine dihydrolase, and positive for levan production and tobacco hypersensitivity, which is typical of fluorescent P. syringae isolates, but can also include non-fluorescent strains (Lelliot et al. 1966). Three isolates were tested for pathogenicity on the table beet cv. Red Ace and Swiss chard cv. Silverado. Strain Pap009 of P. syringae pv. aptata (Psa), demonstrated previously to be pathogenic on Swiss chard and table beet, served as a positive control strain (Derie et al. 2016; Safni et al. 2016). Each isolate was grown inoculated into medium 523 broth and incubated on a shaker at 175 rpm overnight at 25°C. Each bacterial suspension was adjusted to an optical density (OD) of 0.3 at 600 nm (108 CFU/ml), and diluted in 0.0125M phosphate buffer to 107 CFU/ml. Thirty-day-old seedlings grown in Redi-Earth Plug and Seedling Mix in a greenhouse at 22 to 26°C were inoculated by rubbing the abaxial and adaxial leaf surfaces of each plant with a cotton swab dipped in inoculum to which Carborundum had been added (0.06 g/10 ml). The negative control plants were treated similarly with phosphate buffer with Carborundum. The experiment was set up as a randomized complete block design with 4 replications per treatment and 6 seedlings per experimental unit. In both trials, leaf spots resembling those on the original plants developed on all table beet and Swiss chard plants inoculated with the Arizona isolates and Pap009, but not on negative control plants. Disease severity was greater on Swiss chard (average 39% leaf area with spots) than on table beet (14%). Re-isolates obtained from inoculated seedlings using the same method as the original isolations resembled Psa. Multilocus sequence analysis (MLSA) was carried out for the original three Arizona isolates and the re-isolates using DNA amplified from the housekeeping genes gyrB, rpoD, gapA, and gltA (Hwang et al. 2005; Sarkar and Guttman 2004). Sequence identities of these genes of the Arizona isolates (GenBank accession numbers MW291615 to MW291618 for strain Pap089; MW291619 to MW291622 for Pap095; and MW291623 to MW291626 for Pap096 for gltA, gyrB, rpoD, and gapA, respectively) and the re-isolates ranged from 98 to 100% with those of Psa pathotype strain CFBP 1617 in the PAMDB database (Almeida et al. 2010; Altschul et al. 1997). Based on Koch’s postulates, colony characteristics, and MLSA, Psa was the causal agent of leaf spots in the Arizona Swiss chard crop. To our knowledge, this is the first report of bacterial leaf spot on chard in Arizona. The pathogen could have been introduced on infected seed as Psa is readily seedborne and seed transmitted.

scholarly journals First Report of Bacterial Leaf Spot of Swiss Chard Caused by Pseudomonas syringae pv. aptata in California

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1397-1397 ◽  
Author(s):  
S. T. Koike ◽  
D. M. Henderson ◽  
C. T. Bull ◽  
P. H. Goldman ◽  
R. T. Lewellen
Keyword(s):  
Fatty Acid ◽  
Sugar Beet ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Nutrient Broth ◽  
Pcr Analysis ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Leaf Spots ◽  
Swiss Chard

From 1999 through 2003, a previously unreported disease was found on commercial Swiss chard (Beta vulgaris subsp. cicla) in the Salinas Valley, (Monterey County) California. Each year the disease occurred sporadically throughout the long growing season from April through September. Initial symptoms were water-soaked leaf spots that measured 2 to 3 mm in diameter. As disease developed, spots became circular to ellipsoid, 3 to 8 mm in diameter, and tan with distinct brown-to-black borders. Spots were visible from the adaxial and abaxial sides. Cream-colored bacterial colonies were consistently isolated from spots. Strains were fluorescent on King's medium B, levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction on tobacco (Nicotiana tabacum cv. Turk). The isolates, therefore, belong in LOPAT group 1 (1). Fatty acid methyl esters (FAME) analysis (MIS-TSBA version 4.10, MIDI Inc., Newark, DE) gave variable results that included Pseudomonas syringae, P. cichorii, and P. viridiflava with similarity indices ranging from 0.91 to 0.95. BOX-polymerase chain reaction (PCR) analysis gave identical banding patterns for the chard isolates and for known P. syringae pv. aptata strains, including the pathotype strain CFBP1617 (2). The bacteria were identified as P. syringae. Pathogenicity of 11 strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 10 × 6 CFU/ml, and spraying onto 5-week-old plants of Swiss chard cvs. Red, White, Silverado, and CXS2547. Untreated control plants were sprayed with sterile nutrient broth. After 7 to 10 days in a greenhouse (24 to 26°C), leaf spots similar to those observed in the field developed on all inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. To investigate the host range of this pathogen, the same procedures were used to inoculate three strains onto other Chenopodiaceae plants: five cultivars of sugar beet (B. vulgaris), and one cultivar each of spinach (Spinacia oleracea) and Swiss chard. In addition, five chard strains and strain CFBP1617 were inoculated onto two cultivars of sunflower (Helianthus annuus), and one cultivar each of cantaloupe (Cucumis melo), sugar beet, spinach, and Swiss chard. All Swiss chard, cantaloupe, sunflower, and sugar beet plants developed leaf spots after 7 days. The pathogen was reisolated from spots and confirmed to be the same bacterium using BOX-PCR analysis. Spinach and untreated controls failed to show symptoms. All inoculation experiments were done at least twice and the results were the same. The phenotypic data, fatty acid and genetic analyses, and pathogenicity tests indicated that these strains are P. syringae pv. aptata. To our knowledge this is the first report of bacterial leaf spot of commercially grown Swiss chard in California caused by P. syringae pv. aptata. The disease was particularly damaging when it developed in Swiss chard fields planted for “baby leaf” fresh market products. Such crops are placed on 2-m wide beds, planted with high seed densities, and are sprinkler irrigated. This disease has been reported from Asia, Australia, Europe, and other U.S. states. References: (1) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (2) J. L. W. Rademaker et al. Mol. Microbiol. Ecol. Man. 3.4.3:1–27, 1998.

scholarly journals First Report of Bacterial Leaf Spot of Italian Dandelion (Cichorium intybus) Caused by a Pseudomonas syringae Pathovar in California

Plant Disease ◽  
2006 ◽  
Vol 90 (2) ◽  
pp. 245-245 ◽  
Author(s):  
S. T. Koike ◽  
C. T. Bull
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Late Summer ◽  
Hypersensitive Reaction ◽  
Cichorium Intybus ◽  
Nutrient Broth ◽  
Bacterial Strains ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Leaf Spots

Italian dandelion (Cichorium intybus) is a leafy, nonhead forming chicory plant that is eaten as a fresh vegetable in salads. During the late summer (August through October) of 2002, in the Salinas Valley (Monterey County) in California, a previously unreported disease was found in commercial Italian dandelion fields. Early symptoms were angular, vein delimited, dark, water-soaked leaf spots that measured 2 to 7 mm in diameter. As disease developed, spots retained angular edges but exhibited various irregular shapes. Spots commonly formed along the edges of the leaves; in some cases these spots developed into lesions that measured between 10 and 30 mm long. Spots were visible from adaxial and abaxial sides and were dull black in color. A cream-colored pseudomonad was consistently isolated from leaf spots that were macerated and streaked onto sucrose peptone agar. Fungi were not recovered from any of the spots. Recovered strains were blue-green fluorescent when streaked onto King's medium B agar. Bacterial strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction on tobacco (Nicotiana tabacum cv. Turk). These data indicated that the bacteria belonged to LOPAT group 1 of Pseudomonas syringae (1). Pathogenicity of six strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 106 CFU/ml, and spraying onto 12 6-week-old plants of Italian dandelion cv. Catalogna Special. Untreated control plants were sprayed with sterile nutrient broth. After 10 to 12 days in a greenhouse (24 to 26°C), leaf spots similar to those observed in the field developed on all inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. These inoculation experiments were done twice and the results were the same. Amplification of repetitive bacterial sequences (repetitive sequence-based polymerase chain reaction [rep-PCR]) demonstrated that all Italian dandelion strains had the same rep-PCR fingerprint, which differed from fingerprints of P. syringae pv. tagetis and P. syringae pv. tabaci. Additionally, toxin specific primers did not amplify tagetitoxin or tabtoxin biosynthesis genes from Italian dandelion strains. To our knowledge, this is the first report of bacterial leaf spot of commercially grown Italian dandelion in California caused by a P. syringae pathovar. Because fields were irrigated with overhead sprinklers, the disease was severe in several fields and as much as 30% of those plantings were not harvested. Reference: (1) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966.

scholarly journals First Report of Syringae Leaf Spot Caused by Pseudomonas syringae pv. syringae on Tomato in Italy

Plant Disease ◽  
2007 ◽  
Vol 91 (11) ◽  
pp. 1518-1518 ◽  
Author(s):  
A. Garibaldi ◽  
A. Minuto ◽  
M. Scortichini ◽  
M. L. Gullino
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Test Group ◽  
The United States ◽  
Nutrient Broth ◽  
Tomato Plants ◽  
First Report ◽  
Initial Symptoms ◽  
Leaf Tissues

In the spring of 2006 and 2007, grafted and nongrafted tomato plants (scion cv. Cuore di Bue, rootstock Lycopersicon lycopersicum × L. hirsutum cv. Beaufort) displaying stem and petiole necrosis were observed in many commercial greenhouses in the Piedmont of northern Italy. Initial symptoms that developed 2 to 10 days after transplanting consisted of water-soaked circular lesions (2 to 3 mm in diameter) on stems and petioles. These lesions eventually coalesced into brown-to-black areas as much as 1 cm in diameter. In some cases, necrotic areas progressed from stem petioles to leaf tissues. Thereafter, plants wilted and died within a few days. In some greenhouses, more than 80% of young plants exhibited symptoms and production was severely reduced. Two to three sections of symptomatic tissue from stems and petioles from 20 affected plants were surface disinfested in 0.5% NaOCl for 1 min and repeatedly washed in sterile deionized water. Samples were macerated in nutrient yeast dextrose broth, streaked onto nutrient yeast dextrose agar (NYDA), and incubated at 22 ± 1°C for 48 h. Light yellow colonies typical of Pseudomonas spp. were consistently isolated on NYDA. All colonies fluoresced under UV light when grown on King's B medium (3). Colonies were levan positive, oxidase negative, potato soft rot negative, arginine dihydrase negative, and tobacco hypersensitivity positive (LOPAT test; group Ia). In addition, all isolates were positive for arbutin and aesculin hydrolysis and utilized erythitol, but not adonitol, l(+)-tartrate or dl-homoserine as a carbon source. The isolates also caused severe necrotic lesions on lemon fruits and lilac leaves (4). The bacterial colonies were identified as Pseudomonas syringae pv. syringae (1). Also, repetitive-sequence PCR using the BOXA1R primer indicated that the isolates belong to pattern 4 of P. syringae pv. syringae (4). The pathogenicity of three isolates was tested twice by growing the bacterium in nutrient broth shake cultures for 48 h, pelleting the suspension, resuspending the cell pellet in sterile water to a concentration of 106 CFU/ml, and spraying 35-day-old healthy tomato plants (cv. Cuore di Bue) with the inoculum. Ten grafted and 10 nongrafted plants were inoculated, and the same number of plants was sprayed with sterile nutrient broth as a control. After inoculation, plants were covered with plastic bags for 48 h and placed in the greenhouse at 22 ± 1°C. Six days postinoculation, stem lesions, similar to those seen in the field, and leaf spots were observed on all bacteria-inoculated plants, but not on the controls. Leaf tissues did not develop symptoms. Isolations were made from the lesion margins and the resulting bacterial colonies were again identified as P. syringae pv. syringae. To our knowledge, this is the first report of Syringae leaf spot caused by P. syringae pv. syringae in Italy as well as in Europe. A bacterial spot of tomato caused by P. syringae pv. syringae has been reported in the United States (2). References: (1) A. Braun-Kiewnick and D. C. Sands. Pseudomonas. Page 84 in: Laboratory Guide for the Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (2) J. B. Jones et al. Phytopathology, 71:1281, 1981. (3) E. O. King et al. J. Lab. Clinic. Med. 44:301, 1954. (4) M. Scortichini et al. Plant Pathol. 52:277, 2003.

scholarly journals A New Bacterial Leaf Spot Disease of Broccolini, Caused by Pseudomonas syringae pathovar maculicola, in California

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1207-1207 ◽  
Author(s):  
N. A. Cintas ◽  
C. T. Bull ◽  
S. T. Koike ◽  
H. Bouzar
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Similarity Index ◽  
Acid Methyl Ester ◽  
Hypersensitive Reaction ◽  
Nutrient Broth ◽  
Leaf Spot Disease ◽  
Fluorescent Pseudomonad ◽  
Bacterial Leaf Spot ◽  
Initial Symptoms

In 1998, a new disease was detected on 3-week-old commercial broccolini (Brassica oleracea L. var. botrytis × B. alboglabra) transplants in a Salinas Valley, Monterey County, CA greenhouse. Initial symptoms were small (2 to 4 mm diameter) circular to angular, water-soaked spots. As the disease progressed, spots remained relatively small, but turned tan to brown. When diseased tissues were macerated and streaked on King's medium B, a blue-green fluorescent pseudomonad was consistently isolated. Strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices, but induced a hypersensitive reaction on tobacco (Nicotiana tabacum L. ‘Turk’). Fatty acid methyl ester analysis (MIS-TSBA, version 4.10, MIDI Inc., Newark, DE) indicated that strains had a high similarity index (0.82 or higher) to Pseudomonas syringae, and GN (version 3.50, Biolog, Inc., Hayward, CA) profiles also identified strains as P. syringae. The bacterium associated with the disease, therefore, was identified as P. syringae van Hall. Pathogenicity was demonstrated by growing inoculum in nutrient broth shake cultures for 48 h, misting the broth cultures (1×106 CFU/ml) onto broccolini (cv. Aspabrock), and subjecting the plants to 48 h of high humidity. Control plants were misted with sterile nutrient broth. After 4 to 5 days in a greenhouse, leaf spot symptoms developed on all inoculated broccolini plants, and reisolated strains were characterized and found to be P. syringae. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. Repetitive sequence-based polymerase chain reaction using the BOXA1R primer resulted in identical banding patterns for the broccolini pathogen and for known isolates of P. syringae pv. maculicola from crucifers. In host range testing, P. syringae pv. maculicolawas pathogenic to broccolini plants. The broccolini isolates and P. syringae pv. maculicola isolates had the same pathogenicity results when crucifers and tomatoes were tested as hosts; broccoli and cauliflower (B. oleracea var. botrytis) were infected, and tomato results were variable. These tests suggest that the broccolini pathogen is the bacterial leaf spot pathogen, Pseudomonas syringae pv. maculicola, that occurs on broccoli and cauliflower transplants (1). To our knowledge, this is the first report of this pathogen causing a disease on commercially grown broccolini. Reference: (1) S. T. Koike et al. Plant Dis. 82:727, 1998.

scholarly journals First Report of Pseudomonas syringae pv. aptata Causing Bacterial Leaf Spot on Common Beet (Beta vulgaris) in Ohio

Plant Disease ◽  
2020 ◽  
Vol 104 (2) ◽  
pp. 561-561
Author(s):  
F. Rotondo ◽  
C. M. Vrisman ◽  
R. Rani ◽  
A. L. Testen ◽  
L. Deblais ◽  
...  
Keyword(s):  
Beta Vulgaris ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Bacterial Leaf Spot ◽  
First Report

scholarly journals First Report of Bacterial Leaf Spot Disease Caused by Pseudomonas syringae pv. syringae on Panax notoginseng

Plant Disease ◽  
2013 ◽  
Vol 97 (5) ◽  
pp. 685-685 ◽  
Author(s):  
L.-H. Zhou ◽  
Y. Han ◽  
G.-H. Ji ◽  
Z.-S. Wang ◽  
F. Liu
Keyword(s):  
16S Rdna ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Panax Notoginseng ◽  
Rdna Sequence ◽  
Bacterial Leaf Spot ◽  
16S Rdna Sequence ◽  
First Report ◽  
Leaf Spots ◽  
Phosphate Buffered Saline

Panax notoginseng is a species that produces a rare type of Chinese herbal medicine and is cultivated primarily in Yunnan Province. P. notoginseng has a 3-year-long crop cycle before harvest. A new bacterial disease was observed on P. notoginseng plants in the Wenshan Mountain area of Yunnan in 2012. The disease affected primarily leaves. Symptoms were circular or irregular brown leaf spots, surrounded by a yellow halo, located on the edges of the leaves. Eight creamy white pigmented, rounded strains were isolated consistently from leaf spots on Luria-Bertani agar (LB) medium, incubated at 28°C. Three strains (SQYB-1, SQYB-2, SQYB-3) of eight isolates were prepared for further study. Three isolates were purified and characterized: all were gram-negative, rod-shaped, motile, aerobic, non-spore forming, and negative for oxidase, potato soft rot, arginine dehydrolase, presence of tyrosinase and urease, nitrate, and fluorescent pigment production. Moreover, they were positive for levan production, presence of catalase, and for tobacco hypersensitivity. All three strains isolated were identified as Pseudomonas syringae pv. syringae (Pss) based on morphology, metabolic profile (Biolog Microbial ID System), and 16S rDNA sequence analysis (1). The metabolic similarity index between experiment strain SQYB-1 and a type of strain Pss was 0.619. The primers of 16S rDNA sequence amplification were 27F/1492R. Before sequencing, we cloned the PCR products. There was 99% homology in 16S rDNA sequences between one isolate, SQYB-1 (NCBI Accession No. JX876901) and Pss (HQ840766), supporting the identification of the P. notoginseng strains as Pss (3). For Koch's postulates, 10 surface-disinfected young leaves on three plants were inoculated with SQYB-1 isolates by spraying a phosphate-buffered saline cell suspension (3.0 × 108 CFU/ml) onto the leaves (4). Controls were inoculated similarly with sterile phosphate-buffered saline. Plants were covered with polyethylene bags for 24 h at 25°C and then transferred to a greenhouse. Circular or irregular brown spots were observed on all bacteria-inoculated leaves within 9 to 14 days after inoculation. No symptoms were observed on controls. Bacteria reisolated from inoculated leaves were identical to the original isolates as determined by the methods described above. The present study indicated that isolate SQYB-1 could independently infect P. notoginseng leaves, which was different from the finding of Luo et al. concerning involvement of Pss in root rot (2). To our knowledge, this is the first report of Pseudomonas syringae pv. syringae causing bacterial leaf spot on P. notoginseng in China. References: (1) M. R. Gillings et al. PNAS 12:102, 2005. (2) W. F. Luo et al. J. Yunnan Agric. Univ. 14:123, 1999 (in Chinese). (3) C. L. Oliver et al. Plant Dis. 4:96, 2012. (4) H. Ornek et al. New Dis. Rep. 13:40, 2006.

scholarly journals First Report of Bacterial Leaf Spot on Snow Lotus Caused by Pseudomonas syringae in China

Plant Disease ◽  
2009 ◽  
Vol 93 (2) ◽  
pp. 204-204 ◽  
Author(s):  
S. F. Zhao ◽  
Y. N. Luo ◽  
H. Y. Zhao ◽  
J. Du ◽  
X. Y. Fang
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Unknown Etiology ◽  
Leaf Spot Disease ◽  
Sterile Water ◽  
Bacterial Leaf Spot ◽  
Saussurea Involucrata ◽  
First Report ◽  
Initial Symptoms ◽  
Snow Lotus

Snow lotus (Saussurea involucrata (Kar. & Kir.) Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. During the summer and autumn of 2005, 2006, and 2007, a necrosis of unknown etiology was observed on leaves in commercial production areas in Xinjiang Province of China. Disease incidence was approximately 40 to 50% of the plants during the 2005 and 2007 growing seasons. Initial symptoms consisted of pronounced water-soaked, dark brown-to-black spots that were 1 to 2 mm in diameter on young, expanding leaves. Later, some leaf spots on older leaves enlarged and coalesced, causing leaf desiccation. Leaf samples were collected in 2005, 2006, and 2007 from the affected hosts. Bacterial streaming was evident from these samples, and 28 strains were isolated on nutrient agar or King's medium B (KMB). All strains were gram negative and fluoresced bluegreen under UV light after 48 h of growth at 28°C on KMB. On the basis of LOPAT tests, the strains were identified as Pseudomonas syringae (1). The identity of two strains was confirmed by sequencing the 16S rDNA gene, which revealed 98% similarity to P. syringae strains in NCBI (Accession Nos. FJ001817 and FJ001818 for XJSNL 111 and 107, respectively). Infiltration of tobacco leaves with bacterial suspensions resulted in typical hypersensitivity reactions within 24 h. Pathogenicity of the strains was confirmed by spray inoculating five snow lotus leaves of a six-leaf stage plant with 108 CFU ml–1 bacterial suspensions in sterile water and five plants sprayed with sterile distilled water served as controls. Inoculated and sterile water-sprayed controls were maintained in the growth chamber with 90% relative humidity for 15 days at 15 ± 2°C. Symptoms similar to the original symptoms were observed on inoculated plants after 2 weeks. No symptoms developed on controls. Bacteria reisolated from inoculated plants were identified as strains of P. syringae. Isolates were deposited at the Key Laboratory for Oasis Crop Disease Prevention and Cure, Shihezi University. Rust caused by Puccinia carthami and leaf spot disease caused by Alternaria carthami of snow lotus have been reported (2,3). To our knowledge, this is the first report of P. syringae as the cause of bacterial leaf spot on snow lotus in China. References: (1) A. Braun-Kiewnick and D. C. Sands. Pseudomonas. Page 84 in: Laboratory Guide for the Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (2) S. Zhao et al. Plant Dis. 91:772, 2007. (3) S. Zhao et al. Plant Dis. 92:318, 2008.

scholarly journals First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 418-418 ◽  
Author(s):  
M. Gupta ◽  
N. Bharat ◽  
A. Chauhan ◽  
A. Vikram
Keyword(s):  
Host Range ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Molecular Techniques ◽  
Bacterial Suspension ◽  
Leaf Spot Disease ◽  
Rrna Gene ◽  
First Report ◽  
Leaf Spots ◽  
Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

scholarly journals First Report of Bacterial Leaf Spot on Leafy Brassica Greens Caused by Pseudomonas syringae pv. maculicola in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (5) ◽  
pp. 683-683 ◽  
Author(s):  
A. P. Keinath ◽  
W. P. Wechter ◽  
J. P. Smith
Keyword(s):  
South Carolina ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Acid Methyl Ester ◽  
The United States ◽  
Dna Fingerprint ◽  
Bacterial Leaf Spot ◽  
First Report ◽  
Turnip Greens ◽  
Salad Greens

As of 2001, South Carolina ranked second in the United States in acreage of turnip greens (Brassica rapa) and collard (B. oleracea) and third in acreage of mustard (B. juncea). In June 2001, a leaf disease was found on turnip greens (cv. Alamo), mustard (cvs. Southern Giant Curled and Florida Broadleaf), and rape salad greens (B. napus var. napus cv. Essex) on a commercial farm in Lexington County, South Carolina. Symptoms appeared after a heavy rainstorm that included blowing sand. The disease was found in May and June 2002 on three additional farms in the same county on turnip greens cv. Topper and Royal Crown and collard cv. Top Bunch. Symptoms included small tan spots, water soaking, yellowing, and brown necrosis of leaves after spots coalesced on the lower halves of plants. Yellowing was more prevalent on older than on younger leaves. Leaf samples were collected in 2001 and 2002 from the affected hosts on the four farms. Bacterial streaming was evident from these samples and 27 strains were isolated on nutrient agar or King's medium B (KMB). All strains were gram negative and fluoresced bluegreen or yellow under UV light after 48-h growth at 28°C on Pseudomonas agar F (PAF). On the basis of LOPAT tests, the strains were identified as P. syringae (2). All 27 strains were tested for pathogenicity to rape salad greens cv. Essex and then to turnip greens cv. Topper. Plants were grown in peat-vermiculite potting mix in 10-cm-diameter pots in a greenhouse. P. syringae pv. maculicola F41, isolated from turnip in Oklahoma, and P. syringae pv. tomato F33, isolated from tomato in Oklahoma, were included as positive and negative controls along with a noninoculated control. Bacteria were grown on KMB for 48 h at 24°C, and bacterial suspensions were prepared and adjusted to 0.1 optical density at 600 nm. Three-week-old plants were held at 95 to 100% relative humidity (RH) for 48 h before they were sprayed just to runoff with inoculum and then held at 95 to 100% RH for 48 h after inoculation (4). After an additional 5 to 8 days in a greenhouse, nine strains and F41 caused symptoms on both Topper and Essex similar to symptoms observed in the field. No symptoms were observed on noninoculated plants or plants inoculated with F33. On the basis of repetitive sequence-based polymerase chain reactions with the BOXA1R primer, the DNA fingerprint of each of the nine pathogenic strains from South Carolina was nearly identical to that of F41. Bacteria isolated from inoculated, symptomatic turnip leaves had identical LOPAT and BOXA1R profiles to the corresponding original strains. Pathogenic strains had bluegreen fluorescence on PAF, whereas nonpathogenic strains fluoresced yellow. Five pathogenic strains, as well as F41, were further identified to species and pathovar with fatty acid methyl ester profiles as P. syringae pv. maculicola. To our knowledge, this is the first report of P. syringae pv. maculicola from South Carolina. Over the past 10 years, P. syringae pv. maculicola has been found in Oklahoma (4), California (1), and Ohio (3). Bacterial leaf spot has occurred yearly in South Carolina since the initial outbreaks. Currently, it is the disease that causes the greatest yield losses of leafy brassica greens in the state. References: (1) N. A. Cintas et al. Plant Dis. 85:1207, 2001. (2) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (3) M. L. Lewis Ivey et al. Plant Dis. 86:186, 2002. (4) Y. F. Zhao et al. Plant Dis. 84:1015, 2000.

Sign in / Sign up

Export Citation Format

Share Document