First Report of Neofusicoccum parvum Associated with Stem Canker and Dieback of Asian Pear Trees in Taiwan

Asian pear tree (Pyrus pyrifolia) is an important fruit crop in Asian countries. Between the autumn of 2008 and the summer of 2009, stem cankers and twig diebacks of Asian pear trees were observed in middle Taiwan. Necrotic lesions extending from branch scars progressed with age, resulting in darkened vascular discoloration. Two cultivars of Asian pear, Taichung No. 2 grown in Changhwa County and Heng-shan grown in Taichung County, showed the same symptoms. Disease incidence increased rapidly after a rain or storm event, eventually exceeding 50%. Pycnidia on severely infected branches contained one-celled, fusiform to ellipsoidal, smooth- and thin-walled hyaline conidia, with an average length (L) and width (W) of 19.1 (11.3 to 24.8) × 5.9 (4.5 to 8.0) μm and a L/W ratio of 3.2 (n = 44). Diseased branch tissues collected from the two locations were surface sterilized in 0.6% NaOCl, rinsed with water, and plated on potato dextrose agar (PDA). Fungal isolates, recovered from both locations, produced white, aerial mycelium and became dull gray within a week after incubating plates at 25°C. To confirm the identities of the isolates, the internal transcribed spacer (ITS) regions amplified with primers ITS1/ITS4 were deposited in GenBank (Accession Nos. GU395186 and GU395187). Both of the sequences were 99% identical to that of Neofusicoccum parvum (Accession No. EU882162) over a 534-bp alignment. Thus, both morphological and molecular characters confirmed this species as N. parvum (3), reported as the anamorph of Botryosphaeria parva (1). The two voucher isolates (BCRC34605 and BCRC34609) were deposited in Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were first conducted on 2-year-old greenhouse-potted Asian pear trees utilizing N. parvum isolate BCRC34605. Ten plants of the cv. Mi-li were stem wounded with a 5-mm cork borer at a depth of 2 mm. Inoculation consisted of inserting 5-mm mycelium plugs of the pathogen into the wounds and wrapping with Parafilm. Sterile PDA plugs applied to an equal number of plants with the same methods served as the controls. After 2 months incubation at an average temperature of 21°C, all inoculated plants exhibited necrotic lesions with a mean length of 23.5 mm and the control plants remained symptomless. The pathogen was reisolated from lesions of inoculated stems, thus fulfilling Koch's postulates. Pathogenicity tests were repeated by inoculating the other N. parvum isolate (BCRC34609) on pear cv. Taichung No. 2, resulting in similar results. N. parvum has been reported causing dieback and canker in a wide range of fruit trees, including grapevine (4) and mango trees (2). To our knowledge, this is the first report of N. parvum associated with stem canker and dieback on Asian pear trees. In addition, this is a newly recorded species for the mycobiota of Taiwan. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) J. Javier-Alva et al. Plant Dis. 93:426, 2009. (3) S. R. Mohali et al. Fungal Divers. 25:103, 2007. (4) J. R. Urbez-Torres and W. D. Gubler. Plant Dis. 93:584, 2009.

Download Full-text

First Report of Lasiodiplodia theobromae Causing Stem Canker of Jatropha curcas in Malaysia

Plant Disease ◽

10.1094/pdis-06-11-0482-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 767-767 ◽

Cited By ~ 7

Author(s):

R. Sulaiman ◽

S. S. Thanarajoo ◽

J. Kadir ◽

G. Vadamalai

Keyword(s):

Jatropha Curcas ◽

Disease Incidence ◽

Stem Canker ◽

Molecular Characteristics ◽

Width Ratio ◽

Commonwealth Mycological Institute ◽

Lasiodiplodia Theobromae ◽

First Report ◽

Wide Range ◽

Vascular Discoloration

Physic nut (Jatropha curcas L.) is an important biofuel crop worldwide. Although it has been reported to be resistant to pests and diseases (1), stem cankers have been observed on this plant at several locations in Peninsular Malaysia since early February 2008. Necrotic lesions on branches appear as scars with vascular discoloration in the tissue below the lesion. The affected area is brownish and sunken in appearance. Disease incidence of these symptomatic nonwoody plants can reach up to 80% in a plantation. Forty-eight samples of symptomatic branches collected from six locations (University Farm, Setiu, Gemenceh, Pulau Carey, Port Dickson, and Kuala Selangor) were surface sterilized in 10% bleach, rinsed twice with sterile distilled water, air dried on filter paper, and plated on water agar. After 4 days, fungal colonies on the agar were transferred to potato dextrose agar (PDA) and incubated at 25°C. Twenty-seven single-spore fungal cultures obtained from all locations produced white, aerial mycelium that became dull gray after a week in culture. Pycnidia from 30-day-old pure cultures produced dark brown, oval conidia that were two celled, thin walled, and oval shape with longitudinal striations. The average size of the conidia was 23.63 × 12.72 μm with a length/width ratio of 1.86. On the basis of conidial morphology, these cultures were identified as Lasiodiplodia theobromae. To confirm the identity of the isolates, the internal transcribed spacer (ITS) region was amplified with ITS1/ITS4 primers and sequenced. The sequences were deposited in GenBank (Accession Nos. HM466951, HM466953, HM466957, GU228527, HM466959, and GU219983). Sequences from the 27 isolates were 99 to 100% identical to two L. theobromae accessions in GenBank (Nos. HM008598 and HM999905). Hence, both morphological and molecular characteristics confirmed the isolates as L. theobromae. Pathogenicity tests were performed in the glasshouse with 2-month-old J. curcas seedlings. Each plant was wound inoculated by removing the bark on a branch to a depth of 2 mm with a 10-mm cork borer. Inoculation was conducted by inserting a 10-mm-diameter PDA plug of mycelium into the wound and wrapping the inoculation site with wetted, cotton wool and Parafilm. Control plants were treated with plugs of sterile PDA. Each isolate had four replicates and two controls. After 6 days of incubation, all inoculated plants produced sunken, necrotic lesions with vascular discoloration. Leaves were wilted and yellow above the point of inoculation on branches. The control plants remained symptomless. The pathogen was successfully reisolated from lesions on inoculated branches. L. theobromae has been reported to cause cankers and dieback in a wide range of hosts and is common in tropical and subtropical regions of the world (2,3). To our knowledge, this is the first report of stem canker associated with L. theobromae on J. curcas in Malaysia. References: (1) S. Chitra and S. K. Dhyani. Curr. Sci. 91:162, 2006. (2) S. Mohali et al. For. Pathol. 35:385, 2005. (3) E. Punithalingam. Page 519 in: CMI Descriptions of Pathogenic Fungi and Bacteria. Commonwealth Mycological Institute, Kew, Surrey, UK. 1976.

Download Full-text

First Report of Anthracnose of Papaya (Carica papaya L.) Caused by Colletotrichum siamense in China

Plant Disease ◽

10.1094/pdis-10-20-2154-pdn ◽

2021 ◽

Author(s):

Yujie Zhang ◽

Wenxiu Sun ◽

Ping Ning ◽

Tangxun Guo ◽

SuiPing Huang ◽

...

Keyword(s):

Carica Papaya ◽

Disease Incidence ◽

Aerial Mycelium ◽

Postharvest Disease ◽

Distilled Water ◽

First Report ◽

Surface Samples ◽

Initial Symptoms ◽

Colletotrichum Siamense ◽

Pathogenicity Tests

Papaya (Carica papaya L.) is a rosaceous plant widely grown in China, which is economically important. Anthracnose caused by Colletotrichum sp. is an important postharvest disease, which severely affects the quality of papaya fruits (Liu et al., 2019). During April 2020, some mature papaya fruits with typical anthracnose symptoms were observed in Fusui, Nanning, Guangxi, China with an average of 30% disease incidence (DI) and over 60% DI in some orchards. Initial symptoms of these papayas appeared as watery lesions, which turned dark brown, sunken, with a conidial mass appearing on the lesions under humid and warm conditions. The disease severity varied among fruits, with some showing tiny light brown spots, and some ripe fruits presenting brownish, rounded, necrotic and depressed lesions over part of their surface. Samples from two papaya plantations (107.54°E, 22.38°N) were collected, and brought to the laboratory. Symptomatic diseased tissues were cut into 5 × 5 mm pieces, surface sterilized with 2% (v/v) sodium hypochlorite for 1 minute, and rinsed three times with sterilized water. The pieces were then placed on potato dextrose agar (PDA). After incubation at 25°C in the dark for one week, colonies with uniform morphology were obtained. The aerial mycelium on PDA was white on top side, and concentric rings of salmon acervuli on the underside. A gelatinous layer of spores was observed on part of PDA plates after 7 days at 28°C. The conidia were elliptical, aseptate and hyaline (Zhang et al., 2020). The length and width of 60 conidia were measured for each of the two representative isolates, MG2-1 and MG3-1, and these averaged 13.10 × 5.11 μm and 14.45 × 5.95 μm. DNA was extracted from mycelia of these two isolates with the DNA secure Plant Kit (TIANGEN, Biotech, China). The internal transcribed spacer (ITS), partial actin (ACT), calmodulin (CAL), chitin synthase (CHS), β-tubulin 2 (TUB2) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) regions were amplified by PCR and sequenced. The sequences were deposited into GenBank with accessions MT904003, MT904004, and MT898650 to MT898659. BLASTN analyses against the GenBank database showed that they all had over 99% identity to the type strain of Colletotrichum siamense isolate ICMP 18642 (GenBank accession numbers JX010278, GQ856775, JX009709, GQ856730, JX010410, JX010019) (Weir et al., 2012). A phylogenetic tree based on the combined ITS, ACT, CAL, CHS, TUB2 and GAPDH sequences using the Neighbor-joining algorithm also showed that the isolates were C. siamense. Pathogenicity tests were conducted on 24 mature, healthy and surface-sterilized papaya fruits. On 12 papaya fruits, three well separated wounded sites were made for inoculation, and for each wounded site, six adjacent pinhole wounds were made in a 5-mm-diameter circular area using a sterilized needle. A 10 µl aliquot of 1 × 106 conidia/ml suspension of each of the isolates (MG2-1 and MG3-1) was inoculated into each wound. For each isolate, there were six replicate fruits. The control fruits were inoculated with sterile distilled water. The same inoculation was applied to 12 non-wound papaya fruits. Fruits were then placed in boxes which were first washed with 75% alcohol and lined with autoclaved filter paper moistened with sterilized distilled water to maintain high humidity. The boxes were then sealed and incubated at 28°C. After 10 days, all the inoculated fruits showed symptoms, while the fruits that were mock inoculated were without symptoms. Koch's postulates were fulfilled by re-isolation of C. siamense from diseased fruits. To our knowledge, this is the first report of C. siamense causing anthracnose of papaya in China. This finding will enable better control of anthracnose disease caused by C. siamense on papaya.

Download Full-text

Characterization of Botryosphaeriaceae Species as Causal Agents of Trunk Diseases on Grapevines

Plant Disease ◽

10.1094/pdis-03-15-0286-re ◽

2015 ◽

Vol 99 (12) ◽

pp. 1678-1688 ◽

Cited By ~ 16

Author(s):

Antonia Carlucci ◽

Francesca Cibelli ◽

Francesco Lops ◽

Maria Luisa Raimondo

Keyword(s):

Elongation Factor ◽

Phylogenetic Study ◽

Translation Elongation ◽

Neofusicoccum Parvum ◽

Grapevine Trunk Diseases ◽

General Decline ◽

Wide Range ◽

Trunk Diseases ◽

Pathogenicity Tests

Botryosphaeriaceae spp. have a cosmopolitan distribution and a wide range of plant hosts. Over the last 15 years, worldwide, 21 species of this family have been associated with grapevine trunk diseases that cause cankers and dieback on grapevines. Here, we surveyed vineyards of Vitis vinifera ‘Lambrusco’, ‘Sangiovese’, and ‘Montepulciano’ in three areas of the Foggia province (Cerignola, Foggia, and San Severo) in southern Italy. Wood samples from grapevines showing general decline, dieback, cankers, and wood and foliar discoloration yielded 344 fungal isolates identified as Botryosphaeriaceae spp. A phylogenetic study combining internal transcribed spacer and translation elongation factor 1-α sequences of 60 representative isolates identified nine botryosphaeriaceous species: Botryosphaeria dothidea, Diplodia corticola, D. mutila, D. seriata, Dothiorella iberica, Do. sarmentorum, Lasiodiplodia citricola, L. theobromae, and Neofusicoccum parvum. Pathogenicity tests confirmed that all nine species cause canker and dieback of grapevines. However, this is the first report of L. citricola as causal agent of wood cankers and dieback of grapevine. To date, including L. citricola, there are 25 botryosphaeriaceous species associated with V. vinifera worldwide, of which 12 have been reported for grapevines in Italy.

Download Full-text

First Report of Neofusicoccum parvum Causing Stem Canker and Necrosis of Phoebe sheareri in Zhejiang Province, China

Plant Disease ◽

10.1094/pdis-01-19-0006-pdn ◽

2019 ◽

Vol 103 (7) ◽

pp. 1780-1780 ◽

Cited By ~ 1

Author(s):

Y. Chen ◽

H. Wei ◽

J. Shen ◽

B. Jiang ◽

L. Zhu ◽

...

Keyword(s):

Stem Canker ◽

Zhejiang Province ◽

Neofusicoccum Parvum ◽

First Report

Download Full-text

First Report in Mali of Xanthomonas citri pv. mangiferaeindicae Causing Mango Bacterial Canker on Mangifera indica

Plant Disease ◽

10.1094/pdis-01-12-0001-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 581-581 ◽

Cited By ~ 2

Author(s):

O. Pruvost ◽

C. Boyer ◽

K. Vital ◽

C. Verniere ◽

L. Gagnevin ◽

...

Keyword(s):

Disease Incidence ◽

Mangifera Indica ◽

Negative Control ◽

Tris Buffer ◽

Control Treatment ◽

Bacterial Canker ◽

Xanthomonas Citri ◽

First Report ◽

Infection Pattern ◽

Wide Range

Bacterial canker (or black spot) of mango caused by Xanthomonas citri pv. mangiferaeindicae is an important disease in tropical and subtropical areas (1). X. citri pv. mangiferaeindicae can cause severe infection in a wide range of mango cultivars and induces raised, angular, black leaf lesions, sometimes with a chlorotic halo. Severe leaf infection may result in abscission. Fruit symptoms appear as small, water-soaked spots on the lenticels that later become star shaped, erumpent, and exude an infectious gum. Often, a “tear stain” infection pattern is observed on the fruit. Severe fruit infections cause premature drop. Twig cankers are potential sources of inoculum and weaken branch resistance to winds. Yield loss up to 85% has been reported at grove scale for susceptible cultivars (1). Suspected leaf lesions of bacterial canker were collected in July 2010 from mango trees in four, six, and three localities of the Koulikoro, Sikasso, and Bougouni provinces of Mali, respectively (i.e., the major mango-growing areas in this country). Nonpigmented Xanthomonas-like colonies were isolated on KC semiselective medium (3). Twenty-two strains from Mali were identified as X. citri pv. mangiferaeindicae based on IS1595-ligation-mediated PCR (4) and they produced fingerprints fully identical to that of strains isolated from Ghana and Burkina Faso. Five Malian strains (LH409, LH410, LH414, LH415-3, and LH418) were compared by multilocus sequence analysis (MLSA) to the type strain of X. citri and the pathotype strain of several X. citri pathovars, including pvs. anacardii and mangiferaeindicae. This assay targeted the atpD, dnaK, efp, and gyrB genes, as described previously (2). Nucleotide sequences were 100% identical to those of the pathotype strain of X. citri pv. mangiferaeindicae whatever the gene assayed, but differed from any other assayed X. citri pathovar. Leaves of mango cv. Maison Rouge from the youngest vegetative flush were infiltrated (10 inoculation sites per leaf for three replicate leaves on different plants per bacterial strain) with the same five strains from Mali. Bacterial suspensions (~1 × 105 CFU/ml) were prepared in 10 mM Tris buffer (pH 7.2) from 16-h-old cultures on YPGA (7 g of yeast, 7 g of peptone, 7 g of glucose, and 18 g of agar/liter, pH 7.2). The negative control treatment consisted of three leaves infiltrated with sterile Tris buffer (10 sites per leaf). Plants were incubated in a growth chamber at 30 ± 1°C by day and 26 ± 1°C by night (12-h/12-h day/night cycle) at 80 ± 5% relative humidity. All leaves inoculated with the Malian strains showed typical symptoms of bacterial canker a week after inoculation. No lesions were recorded from the negative controls. One month after inoculation, mean X. citri pv. mangiferaeindicae population sizes ranging from 5 × 106 to 1 × 107 CFU/lesion were recovered from leaf lesions, typical of a compatible interaction (1). To our knowledge, this is the first report of the disease in Mali. Investigations from local growers suggest that the disease may have been present for some years in Mali but likely less than a decade. A high disease incidence and severity were observed, suggesting the suitability of environmental conditions in this region for the development of mango bacterial canker. References: (1) N. Ah-You et al. Phytopathology 97:1568, 2007. (2) L. Bui Thi Ngoc et al. Int. J. Syst. Evol. Microbiol. 60:515, 2010. (3) O. Pruvost et al. J. Appl. Microbiol. 99:803, 2005. (4) O. Pruvost et al. Phytopathology 101:887, 2011.

Download Full-text

First Report of Leaf Blight Caused by Nigrospora sphaerica on Curcuma in China

Plant Disease ◽

10.1094/pdis-04-11-0284 ◽

2011 ◽

Vol 95 (9) ◽

pp. 1190-1190

Author(s):

L. X. Zhang ◽

J. H. Song ◽

G. J. Tan ◽

S. S. Li

Keyword(s):

Disease Incidence ◽

Its Region ◽

Leaf Blight ◽

Morphological Data ◽

Future Research ◽

Leaf Margin ◽

Academic Press ◽

First Report ◽

Pathogenicity Tests ◽

Leaf Pathogen

Curcuma (family Zingiberaceae) is commonly cultivated for the use of rhizomes within traditional Chinese medicines. In October 2009 and 2010, severe leaf blight was observed on Curcuma wenyujin Y.H. Chen & C. Ling (4) in fields located in Ruian, China. The area of cultivation in Ruian encompasses 90% of the production in Zhejiang Province. Disease incidence was approximately 90% of plants observed in affected fields. Early symptoms were yellow-to-brown, irregular-shaped lesions on the leaf margin or tip. After several days, lesions expanded along the mid-vein until the entire leaf was destroyed. Blighted leaves turned grayish to dark brown and withered, and severely affected plants died. Eight fungal isolates were recovered from symptomatic C. wenyujin leaves, collected from eight different fields, on potato dextrose agar (PDA). These fungal colonies were initially white, becoming light to dark gray and produced black, spherical to subspherical, single-celled conidia (14 to 17 × 12 to 15 μm), which were borne on a hyaline vesicle at the tip of the conidiophores. On the basis of these morphological features, the isolates appeared to be similar to Nigrospora sphaerica (2). Strain ZJW-1 was selected as a representative for molecular identification. Genomic DNA was extracted from the isolate, and the internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1-5.8S-ITS2) was amplified using ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) primers (3). The ITS region was further cloned and sequenced (GenBank Accession No. JF738028) and was 99% identical to N. sphaerica (GenBank Accession No. FJ478134.1). On the basis of morphological data and the ITS rDNA sequence, the isolate was determined to be N. sphaerica. Pathogenicity tests were conducted on four leaves of four C. wenyujin plants by placing agar pieces (5 mm in diameter) from 8-day-old cultures on pushpin-wounded leaves. An equal number of control plants were wounded and inoculated with noncolonized PDA agar pieces. Plants were placed in moist chambers at 25°C with a 12-h photoperiod. Brown-to-black lesions were observed on wounded leaves after 3 days and expanded to an average of 56 × 40 mm 15 days after inoculation. No symptoms developed on the control leaves. The pathogen was reisolated from the margins of necrotic tissues but not from the controls. The pathogen has been reported as a leaf pathogen on several hosts worldwide (1). To our knowledge, this is the first report of N. sphaerica as a leaf pathogen of C. wenyujin in China. Future research will focus primarily on management of this disease. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, USDA-ARS, Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , March 31, 2011. (2) E. W. Mason. Trans. Brit. Mycol. Soc. 12:152, 1927. (3) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (4) J. Zhao et al. Molecules 15:7547, 2010.

Download Full-text

First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

Plant Disease ◽

10.1094/pdis-01-21-0139-pdn ◽

2021 ◽

Author(s):

Jinjie Hu ◽

Qian Zhou ◽

Chaohui Shi ◽

Yexin Ke ◽

Shun Xiao ◽

...

Keyword(s):

Disease Incidence ◽

Solanum Melongena ◽

Stem Canker ◽

Morphological Characters ◽

Single Spore ◽

Specific Primers ◽

Fujian Province ◽

Phomopsis Longicolla ◽

Fungal Isolation ◽

First Report

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus’s pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

Download Full-text

(338) Effect of Germanium Supply by Trunk Injection on Tree Growth and Fruit Quality of `Niitaka' Asian Pear (Pyrus pyrifolia)

HortScience ◽

10.21273/hortsci.40.4.1084a ◽

2005 ◽

Vol 40 (4) ◽

pp. 1084A-1084

Author(s):

Wol-Soo Kim ◽

Jung-An Jo

Keyword(s):

Foliar Application ◽

Fruit Weight ◽

Soluble Solids ◽

Pyrus Pyrifolia ◽

Fruit Firmness ◽

Asian Pear ◽

Trunk Injection ◽

Pear Trees ◽

Flesh Browning

Many trials to supply germanium to fruit have been carried out since tests have confirmed germanium's role as a medical substance. Supplying germanium in orchards by soil and foliar application was not effective because of loss from rainfall. In order to increase germanium absorption by fruit, this study carried out tree trunk injections during the growing season. Two types of germanium, GeO (inorganic type) and Ge-132 (organic type), in concentrations of 5, 10, 25, and 50 mg·L–1 were supplied to `Niitaka' pear trees by trunk injection (1.5 L/tree), four times at 15-day intervals from June 2004. The treatment with 50 mg·L–1 GeO showed decreased fruit weight, but 50 mg·L–1 Ge-132 showed no difference to the control and other treatments. Fruit lenticels were increased in size by all of the Ge treatments in comparison to control fruit. Soluble solids as well as Hunter value `a' of the fruits of all Ge treatments were higher than that of the control. Flesh browning after peeling the fruit was delayed by the germanium treatment, and polyphenoloxidase (PPO) activities were lowered. Postharvest potentials were maintained at high levels for fruit firmness, physiological disorders, and decayed fruit during cold storage at 0 to 1 °C for 2 months.

Download Full-text

First Report of Neofusicoccum parvum Causing Stem Canker and Dieback in Rhododendron in China

Plant Disease ◽

10.1094/pdis-12-14-1346-pdn ◽

2015 ◽

Vol 99 (8) ◽

pp. 1179 ◽

Cited By ~ 1

Author(s):

X. M. Yang ◽

J. H. Wang ◽

Y. P. Zhang ◽

L. H. Wang ◽

W. J. Xie ◽

...

Keyword(s):

Stem Canker ◽

Neofusicoccum Parvum ◽

First Report

Download Full-text

First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Guangdong, China

Plant Disease ◽

10.1094/pdis-07-13-0790-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 426-426 ◽

Cited By ~ 4

Author(s):

C. Shu ◽

J. Chen ◽

H. Huang ◽

Y. He ◽

E. Zhou

Keyword(s):

Disease Incidence ◽

Guangdong Province ◽

Stem Canker ◽

Universal Primers ◽

Distilled Water ◽

Conidial Suspension ◽

Phomopsis Longicolla ◽

Fungal Isolation ◽

First Report ◽

Absorbent Cotton

Eggplant (Solanum melongena L.) is an economically important vegetable crop worldwide. In August 2012, severe stem cankers were observed on eggplant at the early stage of maturation in several fields in Guangdong Province, China. Diseased plants raised cankers on the stems and branches, which resulted in wilting and stunting. No symptoms developed on eggplant fruit. Disease incidence was as high as 40% within affected fields. By using routine fungal-isolation methods and single-spore purification technique, five single-conidial isolates were obtained from each diseased stem. Colonies were grayish-white, circular, and got yellow pigmentation when placed in acidified potato dextrose agar (PDA) in an incubator at pH 4.5 and 25°C with a 12-h photoperiod. Stromata were black, large, and spreading in a concentric pattern. Conidiomata were pycnidial, and the pycnidia were round, oblate, triangular or irregular, and unilocular. Conidiophores were colorless, separated, dichotomous, and 10.0 to 18.0 × 1.5 to 2.0 μm. Alpha conidia were single-celled, ellipsoidal to fusiform, guttulate, and 6.0 to 8.0 × 2.0 to 2.5 μm. Beta conidia, produced on oat meal agar in 2 weeks at 25°C in the dark, were filiform, hamate, and 16.0 to 28.0 × 0.7 to 1.0 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla Hobbs (1). The ITS-rDNA sequence (GenBank Accession No. KC886605) of the isolate EPPL1 of this fungus (P. longicolla EPPL1) was obtained by using universal primers ITS5/ITS4 (1). BLAST searches showed a 98% homology with the sequence of the ITS region of rDNA of P. longicolla. Phylogenetic analysis showed that P. longicolla EPPL1 clustered with P. longicolla SYJM15 and formed a distinct clade distantly related to P. vexans PV3 (GU373630), a well-known pathogen of eggplant. Digestion of PCR-amplified DNA with Alu I yielded two restriction fragments of sizes consistent with those reported for P. longicolla (2). Pathogenicity tests were performed on 30-day-old plants of cv. Yuefengzihongqie grown in a plastic pot (1 liter) in a greenhouse by using mycelial plugs and conidial suspensions of isolate EPPL1 as inocula. A mycelial plug (4 mm in diameter) from a 7-day-old PDA culture was placed on stems of both wounded and non-wounded plants and covered with sterile absorbent cotton moistened with sterile distilled water. Both wounded and non-wounded plants were inoculated with 0.5 ml of conidial suspension (1 × 106 conidia ml–1) dropped onto sterile absorbent cotton covering the stems. Control assays were performed with agar plugs and sterile distilled water only. Inoculated plants were placed in a greenhouse with a 12-h photoperiod at 28°C. Each treatment was replicated on five plants, and the test was repeated. Twenty-five days after inoculation, both wounded and non-wounded plants inoculated with either method showed raised cankers at the points of inoculation and canker lesions similar to those observed in the field expanded up and down the stems to reach lengths of 15 to 30 mm. Later, sparse, small, black pycnidia formed on the surface of the lesions. The inoculated plants exhibited stunting and premature senescence compared to controls. P. longicolla was re-isolated from the infected stems of inoculated plants. Control plants were asymptomatic. To our knowledge, this is the first report of P. longicolla causing stem canker in eggplant in Guangdong, China. Considering the economic importance of eggplant in Guangdong Province and throughout the world, further study of phomopsis stem canker of eggplant is warranted. References: (1) T. W. Hobbs et al. Mycologia 77:535, 1985. (2) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Download Full-text