scholarly journals First Report of Soilborne Wheat Mosaic Virus in the United Kingdom

Plant Disease ◽  
1999 ◽  
Vol 83 (9) ◽  
pp. 880-880 ◽  
Author(s):  
G. R. G. Clover ◽  
D. M. Wright ◽  
C. M. Henry
Keyword(s):  
United Kingdom ◽  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Protein A ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Barley Yellow Dwarf ◽  
The United Kingdom ◽  
Field Samples ◽  
Yellow Dwarf Virus

In April 1999, severe soilborne wheat mosaic virus (SBWMV) symptoms were observed in five fields of winter wheat (Triticum aestivum, cvs. Consort, Equinox, and Savannah) on one farm in Wiltshire, UK. Affected plants were markedly stunted and had a pale mosaic on their leaf sheaths that developed into bright yellow, parallel streaks on the leaves as they unfolded. Symptomatic plants were found in discrete, elliptical patches ranging in size from a few square meters to nearly a hectare. During May and June, symptoms became less marked as temperatures increased and were restricted to lower leaves. SBWMV was positively identified in all five fields (60 to 170 plants per field) by double (W. Huth, BBA-Braunschweig, Germany; Sanofi Phyto-Diagnostics, Paris) and triple (T. Wilson, SCRI, Dundee, UK) antibody sandwich enzyme-linked immunosorbent assay and by reversetranscription polymerase chain reaction (2). Identification was confirmed by immunoelectron microscopy, including protein-A gold labeling, which revealed bipartite, rod-shaped particles typical of SBWMV. Neither wheat spindle streak mosaic virus nor barley yellow dwarf virus was detected in the field samples, nor was SBWMV detected in any other field subsequently sampled, despite a survey of the surrounding area. Wheat is the most important economic crop in the United Kingdom (≈1.9 million hectares are grown annually, yielding ≈16 million tonnes), but its position is threatened by the economic impact of SBWMV, which has decreased yields by up to 50% in the United States (1). References: (1) T. A. Kucharek and J. H. Walker. Plant Dis. Rep. 58:763, 1974. (2) R. E. Pennington et al. Plant Dis. 77:1202, 1993.

scholarly journals First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Nucleotide Divergence ◽  
Yellow Dwarf Virus

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

Occurrence of barley yellow dwarf virus in autumn-sown cereal crops in the United Kingdom in relation to field characteristics

2004 ◽  
Vol 60 (2) ◽  
pp. 113-125 ◽  
Author(s):  
Garth N Foster ◽  
Shona Blake ◽  
Steve J Tones ◽  
Ian Barker ◽  
Richard Harrington
Keyword(s):  
United Kingdom ◽  
Barley Yellow Dwarf Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Barley Yellow Dwarf ◽  
The United Kingdom ◽  
Yellow Dwarf Virus

scholarly journals Optimized Yellow Dwarf Virus Multiplex PCR Assay Reveals a Common Occurrence of Barley yellow dwarf virus-PAS in Kansas Winter Wheat

2018 ◽  
Vol 19 (1) ◽  
pp. 37-43 ◽  
Author(s):  
Alma G. Laney ◽  
Rodolfo Acosta-Leal ◽  
Dorith Rotenberg
Keyword(s):  
Winter Wheat ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Mixed Infections ◽  
Rt Pcr ◽  
Barley Yellow Dwarf ◽  
Field Samples ◽  
Yellow Dwarf Virus

Barley yellow dwarf is an aphid-transmitted virus disease caused by yellow dwarf virus (YDV) species in the family Luteoviridae. Previous partial sequencing efforts conducted in Kansas revealed that Barley yellow dwarf virus-PAS (PAS) occurs in winter wheat fields, and currently available YDV multiplex reverse-transcription PCR (RT-PCR) assays do not detect this species. To enable precise determination of YDV species for research, disease diagnostic, and plant breeding programs, this study enhanced and validated the utility of a multiplex RT-PCR protocol to discriminate six YDV species, including PAS, in archived and fresh field samples. From a representative subset of samples collected from commercial and variety trial locations across nine wheat growing regions of Kansas, PAS and Barley yellow dwarf virus-PAV (PAV) were equally prevalent in single or mixed infections, and other YDVs occurred in mixed infections with PAS and/or PAV in low numbers. The optimized multiplex assay provided robust and specific detection of YDVs and showed promise as a diagnostic tool for determining species occurrence and composition of YDVs in an intensive wheat cropping region of the United States.

scholarly journals Coordination of Diagnostic Efforts in the Great Plains: Wheat Virus Survey and Modeling of Disease Onset

Plant Disease ◽  
2016 ◽  
Vol 100 (6) ◽  
pp. 1037-1045 ◽  
Author(s):  
Mary Burrows ◽  
Carla Thomas ◽  
Neil McRoberts ◽  
Richard M. Bostock ◽  
Len Coop ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Great Plains ◽  
Barley Yellow Dwarf Virus ◽  
Laboratory Data ◽  
Disease Onset ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus

Following the discovery of two new wheat virus diseases in the United States, the Great Plains region (Colorado, Kansas, Montana, Nebraska, North Dakota, Oklahoma, South Dakota, Texas, and Wyoming) of the National Plant Diagnostic Network (NPDN) initiated a project to measure the prevalence of five wheat diseases using indirect ELISA. Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), and Triticum mosaic virus (TriMV) were found in all nine states. WSMV was the most prevalent, averaging 23 to 47% of samples each year. TriMV and WMoV were detected with WSMV (in up to 76% of the samples). All three mite-transmitted viruses were present in 26% or fewer of the samples. Aphid-transmitted viruses in the barley yellow dwarf complex Barley yellow dwarf virus, and Cereal yellow dwarf virus-RPV were less frequent (fewer than 65% of the samples). This paper presents the first case-control methodology paper using plant diagnostic laboratory data and the first signed diagnostic data-sharing agreement between the NPDN and its regulatory stakeholders. Samples collected when <700 cumulative degree-days base 0°C, were twice as likely to be virus negative. This proof-of-concept effort highlights the potential of the NPDN and its National Data Repository to develop knowledge about emerging diseases.

scholarly journals Occurrence of Winter Cereal Viruses in New South Wales, Australia, 2006 to 2014

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 313-317 ◽  
Author(s):  
Andrew Milgate ◽  
Dante Adorada ◽  
Grant Chambers ◽  
Mary Ann Terras
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
New South ◽  
New South Wales ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Winter Cereal ◽  
Barley Yellow Dwarf ◽  
South Wales ◽  
Yellow Dwarf Virus

Winter cereal viruses can cause significant crop losses; however, detailed knowledge of their occurrence in New South Wales, Australia is very limited. This paper reports on the occurrence of Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and their serotypes between 2006 and 2014. Detection of WMoV is confirmed in eastern Australia for the first time. The BYDV and CYDV 2014 epidemic is examined in detail using 139 samples of wheat, barley, and oat surveyed from southern New South Wales. The presence of virus was determined using enzyme-linked immunosorbent assays. The results reveal a high frequency of the serotype Barley yellow dwarf virus - MAV as a single infection present in 27% of samples relative to Barley yellow dwarf virus - PAV in 19% and CYDV in 14%. Clear differences emerged in the infection of different winter cereal species by serotypes of BYDV and CYDV. These results are contrasted to other Australian and international studies.

The incidence of barley yellow dwarf viruses in wheat in Victoria

1987 ◽  
Vol 38 (5) ◽  
pp. 821 ◽  
Author(s):  
RJ Sward ◽  
RM Lister
Keyword(s):  
Immunosorbent Assay ◽  
Barley Yellow Dwarf Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Barley Yellow Dwarf ◽  
Specific Antisera ◽  
Yellow Dwarf Virus ◽  
One Year ◽  
Pooled Samples

Wheat crops from all major wheat-growing districts throughout Victoria were sampled during September 1984. Examination of pooled samples by enzyme-linked immunosorbent assay (ELISA) with an antiserum to a mixture of two barley yellow dwarf virus (BYDV) types ('V1') showed that 10 out of 26 crops were infected with BYDV and 3 out of 26 had a BYDV incidence greater than 10%. The overall loss in yield likely to result from BYDV was estimated at 2% with a far greater loss in some crops. Frozen-stored samples from four crops with high levels of BYDV were retested after one year with isolate-specific antisera. The results indicated that in these crops, PAV-related isolates were the most common, followed by RPV-related isolates.

scholarly journals First Report of Barley yellow striate mosaic virus Infecting Barley and Wheat in Lebanon

Plant Disease ◽  
2001 ◽  
Vol 85 (4) ◽  
pp. 446-446 ◽  
Author(s):  
K. M. Makkouk ◽  
W. Ghulam ◽  
S. G. Kumari
Keyword(s):  
Durum Wheat ◽  
Mosaic Virus ◽  
Bread Wheat ◽  
Barley Yellow Dwarf Virus ◽  
Polyacrylamide Gel Electrophoresis ◽  
First Record ◽  
Barley Yellow Dwarf ◽  
M Proteins ◽  
Tissue Blot Immunoassay ◽  
Yellow Dwarf Virus

Symptoms suggestive of virus infection in barley, bread wheat, and durum wheat were observed at high incidence in November 2000 in Terbol, Beqa'a Valley, Lebanon. The symptoms were mainly stunting, accompanied by leaf striping and yellowing. Symptomatic plant samples (27 barley, 37 bread wheat, and 81 durum wheat) were collected and tested for the presence of four different viruses by tissue-blot immunoassay (TBIA) (1) at the Virology Laboratory of ICARDA, Aleppo, Syria. Antisera used were for Barley stripe mosaic virus (BSMV, genus Hordeivirus) (2); Barley yellow dwarf virus (BYDV, genus Luteovirus, family Luteoviridae) (PAV serotype) (2); Wheat streak mosaic virus (WSMV, genus Tritimovirus, family Potyviridae) (3); and Barley yellow striate mosaic virus (BYSMV, genus Cytorhabdovirus, family Rhabdoviridae) provided by M. Conti, Instituto di Fitovirologia applicata, Turino, Italy. BYSMV was detected in 12 barley, 18 bread wheat, and 56 durum wheat samples; the corresponding numbers of barley, bread wheat, and durum wheat plants testing positive for BYDV-PAV were 4, 7, and 6, respectively. BSMV and WSMV were not detected in any of the samples tested. BYSMV was purified from infected wheat plants, and the purified preparation had a UV 260:280 ratio of 1.18, typical of Rhabdoviruses. In SDS-polyacrylamide gel electrophoresis, the purified virus preparation indicated the presence of 66, 47, and 15 kDa structural proteins, typical of the G, N and M proteins of Rhabdoviruses. In western blot, the 66 and 47 kDa protein bands reacted strongly with BYSMV antiserum. This is the first record of BYSMV infecting barley and wheat in Lebanon. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 12:24, 1993. (3) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 16:74, 1997.

Further studies on the incidence of virus infection in white clover pastures

1997 ◽  
Vol 48 (1) ◽  
pp. 31 ◽  
Author(s):  
S. J. McKirdy ◽  
R. A. C. Jones
Keyword(s):  
Virus Infection ◽  
Mosaic Virus ◽  
Perennial Ryegrass ◽  
White Clover ◽  
Barley Yellow Dwarf Virus ◽  
Alfalfa Mosaic Virus ◽  
Virus Transmission ◽  
Subterranean Clover ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yellow Dwarf Virus

Leaf samples of white clover were collected from 19 irrigated white clover (Trifolium repens) pastures in the south-west of Western Australia and tested for virus infection by enzyme-linked immunosorbent assay. Clover yellow vein virus (CYVV) was found in 16 pastures at infection levels of up to 23% and white clover mosaic virus (WCMV) in 10 at levels up to 83%. None of the white clover pastures with a high incidence of WCMV had been resown with white clover within the last 10 years, whereas those resown within the last 5 years had little or no infection. As previously reported in tests on different white clover pastures in the same irrigation area, widespread infection with alfalfa mosaic virus (AMV) and occasional infection with subterranean clover red leaf virus (SCRLV) was also found. Two or more viruses were found within 16 of the pastures with at least 3 having all 4 viruses. AMV and WCMV were detected in flatweed (Hypochaeris glabra) and AMV was detected in clustered dock (Rumex conglomeratus), both commonly occurring weeds in the pastures. In tests on the perennial ryegrass (Lolium perenne) component of 18 white clover pastures, infection with barley yellow dwarf virus was found in 14 at levels up to 5%. In addition, 11 of the pastures contained a virus which reacted with potyvirus-specific monoclonal antibodies, presumably ryegrass mosaic virus (RyMV), which was detected at levels up to 34%. Live aphids were trapped at 8 different times during 1995 in one pasture that was infected with WCMV, CYVV, AMV, and SCRLV. Blue-green aphid (Acyrthosiphon kondoi) and oat aphid (Rhopalosiphum padi) were the only species caught, both reaching peak populations in midwinter, but only the latter was found in summer. No virus transmission was detected when the aphids caught were fed individually on subterranean clover (T. subterraneum) indicator plants. It is concluded that WCMV poses a threat to the productivity of white clover within irrigated pastures, especially when present in mixed infection with AMV. CYVV is also commonly found but normally not at high enough incidences to pose a serious threat. RyMV may pose a threat to the productivity of the perennial ryegrass component within white clover-based pastures.

Sign in / Sign up

Export Citation Format

Share Document