scholarly journals First Record of Barley yellow striate mosaic virus, Barley stripe mosaic virus, and Wheat dwarf virus Infecting Cereal Crops in Tunisia

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1045-1045 ◽  
Author(s):  
A. Najar ◽  
K. M. Makkouk ◽  
S. G. Kumari
Keyword(s):  
Durum Wheat ◽  
Mosaic Virus ◽  
Bread Wheat ◽  
Barley Yellow Dwarf Virus ◽  
First Record ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Barley Stripe Mosaic Virus ◽  
Wheat Dwarf Virus ◽  
Field Samples

A survey conducted during April 2000 to identify viruses infecting cereal crops in different regions (Beja, Bizerte, Cap-bon, Jendouba, Kairouan, Siliana, and Zaghouan) of Tunisia covered 15 barley, 21 durum wheat, and 7 bread wheat randomly selected fields. Virus incidences were determined on the basis of laboratory testing of 100 to 200 randomly collected samples from each field. A total of 5,227 random (1,654 barley, 2,546 durum wheat, and 1,027 bread wheat) and 1,430 symptomatic (451 barley, 746 durum wheat, and 233 bread wheat) samples were collected. Samples were tested for the presence of five different viruses by tissueblot immunoassay (TBIA) (1) at the Virology Laboratory of INRAT. Antisera used were for Barley stripe mosaic virus (2), Barley yellow dwarf virus (PAV serotype) (2), Wheat streak mosaic virus (3), Barley yellow striate mosaic virus (BYSMV) provided by E. Luisoni, IFA, Turino, Italy (4), and Wheat dwarf virus (WDV) provided by J. Vacke, Research Institute of Crop Production, Prague, Chech Republic. BYDVPAV was detected in seven barley (from three fields), 25 durum wheat (10 fields), and eight bread wheat (three fields) samples from all except the Siliana region. BYSMV was detected in three barley (three fields), 16 durum wheat (six fields), and four bread wheat (three fields) samples from the Beja, Bizerte, Cap-bon, Jendouba, and Siliana regions. WDV was detected in five barley (three fields), nine durum wheat (four fields), and four bread wheat (one field) samples from the Beja, Cap-bon, and Bizerte regions. BSMV was detected in 49 barley (six fields) and 25 durum wheat (five fields) samples from the Beja, Bizerte, Cap-bon, Kairouan, and Zaghouan regions. This is the first record of BYSMV, BSMV, and WDV infecting cereal crops in Tunisia, but their incidence in fields was less than 1%. However, BSMV incidence was 10.5% in one barley field from the Cap-bon region. Virus incidence in symptomatic plants was a bit higher and ranged from 0.8% for WDV in bread wheat to 6% for BSMV in barley. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 12(1/2):24, 1993. (3) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 16(1/2):74, 1997. (4) R. G. Milne et al. Intervirology 25:83, 1986.

scholarly journals First Report of Barley yellow striate mosaic virus Infecting Barley and Wheat in Lebanon

Plant Disease ◽  
2001 ◽  
Vol 85 (4) ◽  
pp. 446-446 ◽  
Author(s):  
K. M. Makkouk ◽  
W. Ghulam ◽  
S. G. Kumari
Keyword(s):  
Durum Wheat ◽  
Mosaic Virus ◽  
Bread Wheat ◽  
Barley Yellow Dwarf Virus ◽  
Polyacrylamide Gel Electrophoresis ◽  
First Record ◽  
Barley Yellow Dwarf ◽  
M Proteins ◽  
Tissue Blot Immunoassay ◽  
Yellow Dwarf Virus

Symptoms suggestive of virus infection in barley, bread wheat, and durum wheat were observed at high incidence in November 2000 in Terbol, Beqa'a Valley, Lebanon. The symptoms were mainly stunting, accompanied by leaf striping and yellowing. Symptomatic plant samples (27 barley, 37 bread wheat, and 81 durum wheat) were collected and tested for the presence of four different viruses by tissue-blot immunoassay (TBIA) (1) at the Virology Laboratory of ICARDA, Aleppo, Syria. Antisera used were for Barley stripe mosaic virus (BSMV, genus Hordeivirus) (2); Barley yellow dwarf virus (BYDV, genus Luteovirus, family Luteoviridae) (PAV serotype) (2); Wheat streak mosaic virus (WSMV, genus Tritimovirus, family Potyviridae) (3); and Barley yellow striate mosaic virus (BYSMV, genus Cytorhabdovirus, family Rhabdoviridae) provided by M. Conti, Instituto di Fitovirologia applicata, Turino, Italy. BYSMV was detected in 12 barley, 18 bread wheat, and 56 durum wheat samples; the corresponding numbers of barley, bread wheat, and durum wheat plants testing positive for BYDV-PAV were 4, 7, and 6, respectively. BSMV and WSMV were not detected in any of the samples tested. BYSMV was purified from infected wheat plants, and the purified preparation had a UV 260:280 ratio of 1.18, typical of Rhabdoviruses. In SDS-polyacrylamide gel electrophoresis, the purified virus preparation indicated the presence of 66, 47, and 15 kDa structural proteins, typical of the G, N and M proteins of Rhabdoviruses. In western blot, the 66 and 47 kDa protein bands reacted strongly with BYSMV antiserum. This is the first record of BYSMV infecting barley and wheat in Lebanon. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 12:24, 1993. (3) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 16:74, 1997.

scholarly journals First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Nucleotide Divergence ◽  
Yellow Dwarf Virus

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

scholarly journals Wheat dwarf virus and its impact on the 2020 harvest in some regions of Ukraine

2021 ◽  
pp. 3-9
Author(s):  
L. Mishchenko ◽  
A. Dunich ◽  
I. Mishchenko ◽  
A. Dashchenko ◽  
O. Boyko ◽  
...  
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Negative Impact ◽  
Brome Mosaic Virus ◽  
Wheat Streak Mosaic Virus ◽  
Dwarf Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Wheat Dwarf Virus ◽  
Dwarf Wheat

Goal. Identify the virus that causes symptoms of dwarfism and non-earing of winter wheat (reduced or no ear formation), and investigate its effect on plant yields. Methods. Visual diagnostics, enzyme-linked immunosorbent assay in double sandwich modification (DAS-ELISA), polymerase chain reaction, biometric, determination of yield and its structure, statistical data processing. Results. A study of winter wheat varieties from Vinnytsia, Khmelnytsky, Kyiv, Chernihiv and Cherkasy regions with symptoms of dwarfism, yellowing of leaves and non-earing. ELISA and PCR have shown that the disease is caused by Wheat dwarf virus. The absence of Wheat streak mosaic virus, Barley yellow dwarf virus, Brome mosaic virus and Wheat spindle mosaic virus (Wheat streak mosaic virus) was shown in the studied samples. It was found that the dwarf wheat virus significantly reduces the number of grains in the ear (3.3 times), the weight of grains from the ear (3.4 times) and the weight of 1000 grains (1.9—3.3 times) depending on the degree of damage plants (from moderate to severely affected). Conclusions. The circulation of dwarf wheat virus in agrocenoses of five regions of Ukraine and a significant negative impact of the disease on the yield of winter wheat plants have been established. The obtained results indicate the need for constant monitoring and testing of plants for the presence of wheat dwarf virus in Ukraine.

Survey of Barley yellow dwarf virus incidence in winter cereal crops, and assessment of wheat and barley resistance to the virus

2016 ◽  
Vol 67 (10) ◽  
pp. 1054 ◽  
Author(s):  
Eva Beoni ◽  
Jana Chrpová ◽  
Jana Jarošová ◽  
Jiban Kumar Kundu
Keyword(s):  
Barley Yellow Dwarf Virus ◽  
Rhopalosiphum Padi ◽  
Wheat Breeding ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Winter Cereal ◽  
Barley Yellow Dwarf ◽  
Significant Difference ◽  
Yellow Dwarf Virus

A survey of Barley yellow dwarf virus (BYDV) incidence in cereal crops in the Czech Republic over 4 years showed, on average, 13.3% BYDV-positive, randomly tested wheat and barley samples. The cultivated wheat and barley cultivars had different levels of susceptibility to BYDV infection. Field trials were performed with different barley and wheat breeding lines and cultivars, and resistance traits were evaluated after artificial inculcation by the viruliferous aphid vector Rhopalosiphum padi L. with BYDV-PAV. Our results showed high variability of visual symptom score (VSS) and reduction in grain weight per spike (GWS-R) in trials within the tested lines and cultivars. The barley line (WBON 96-123) and cultivars (Wysor, Travira) that contained RYd2 differed significantly from other cultivars in VSS. Line WBON 96-123 and cvv. Wysor and Yatzi showed the lowest GWS-R. Wheat line PSR 3628 and cvv. Altigo, Elan, Sparta, Aladin and Hewit showed significant difference from other cultivars in VSS. PSR 3628, Sparta, and Elan showed the lowest GWS-R. Similar results were obtained from BYDV titre analysis by RT-qPCR corresponding to the VSS and GWS-R traits. A low virus titre corresponded to low VSS and GWS-R. Hence, our results suggest that laborious and time-consuming GWS-R analysis could be replaced in some cases by qPCR-based BYDV titre analysis and, together with VSS evaluation, could enhance the efficiency of resistance assessment.

scholarly journals First Report of Soilborne Wheat Mosaic Virus in the United Kingdom

Plant Disease ◽  
1999 ◽  
Vol 83 (9) ◽  
pp. 880-880 ◽  
Author(s):  
G. R. G. Clover ◽  
D. M. Wright ◽  
C. M. Henry
Keyword(s):  
United Kingdom ◽  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Protein A ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Barley Yellow Dwarf ◽  
The United Kingdom ◽  
Field Samples ◽  
Yellow Dwarf Virus

In April 1999, severe soilborne wheat mosaic virus (SBWMV) symptoms were observed in five fields of winter wheat (Triticum aestivum, cvs. Consort, Equinox, and Savannah) on one farm in Wiltshire, UK. Affected plants were markedly stunted and had a pale mosaic on their leaf sheaths that developed into bright yellow, parallel streaks on the leaves as they unfolded. Symptomatic plants were found in discrete, elliptical patches ranging in size from a few square meters to nearly a hectare. During May and June, symptoms became less marked as temperatures increased and were restricted to lower leaves. SBWMV was positively identified in all five fields (60 to 170 plants per field) by double (W. Huth, BBA-Braunschweig, Germany; Sanofi Phyto-Diagnostics, Paris) and triple (T. Wilson, SCRI, Dundee, UK) antibody sandwich enzyme-linked immunosorbent assay and by reversetranscription polymerase chain reaction (2). Identification was confirmed by immunoelectron microscopy, including protein-A gold labeling, which revealed bipartite, rod-shaped particles typical of SBWMV. Neither wheat spindle streak mosaic virus nor barley yellow dwarf virus was detected in the field samples, nor was SBWMV detected in any other field subsequently sampled, despite a survey of the surrounding area. Wheat is the most important economic crop in the United Kingdom (≈1.9 million hectares are grown annually, yielding ≈16 million tonnes), but its position is threatened by the economic impact of SBWMV, which has decreased yields by up to 50% in the United States (1). References: (1) T. A. Kucharek and J. H. Walker. Plant Dis. Rep. 58:763, 1974. (2) R. E. Pennington et al. Plant Dis. 77:1202, 1993.

Occurrence of Viruses in Wheat in the Great Plains Region, 2008

2009 ◽  
Vol 10 (1) ◽  
pp. 14 ◽  
Author(s):  
Mary Burrows ◽  
Gary Franc ◽  
Charlie Rush ◽  
Tamla Blunt ◽  
Dai Ito ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Great Plains ◽  
Barley Yellow Dwarf Virus ◽  
Average Frequency ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
High Plains ◽  
Virus Infections ◽  
Yellow Dwarf Virus ◽  
First Time

Field surveys in 2008 determined the prevalence and diversity of viruses present in the Great Plains wheat crops. Symptomatic plants (n = 754) in nine states were tested for Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV, formerly known as High Plains virus), Triticum mosaic virus (TriMV), Barley yellow dwarf virus-PAV (BYDV-PAV), and Cereal yellow dwarf virus-RPV (CYDV-RPV), using indirect ELISA. Virus prevalence varied greatly, with average frequency of detection highest for WSMV (47%), followed by WMoV (19%), TriMV (17%), BYDV-PAV (7%), and lowest for CYDV-RPV (2%). Most positive plant samples (37%) had one virus present, with decreasing frequencies for co-infection by two (19%), three (5%), or four viruses (1%). TriMV was detected for the first time in Colorado, Nebraska, Oklahoma, South Dakota, Texas, and Wyoming. WMoV was identified for the first time in Montana and Wyoming. Chlorotic streaks were more frequently associated with WSMV, WMoV, and TriMV (R = 0.166 to 0.342; P < 0.05), and stunting was more frequently associated with WMoV (R = 0.142; P = 0.004) or TriMV (R = 0.107; P = 0.033) than WSMV. Symptom severity did not increase with co-infection as compared to single virus infections, with the exception of plants co-infected with mite transmitted viruses in Texas. Accepted for publication 1 May 2009. Published 6 July 2009.

scholarly journals First Record of Barley yellow striate mosaic virus Affecting Wheat Summer-Nurseries in Syria

Plant Disease ◽  
2004 ◽  
Vol 88 (1) ◽  
pp. 83-83 ◽  
Author(s):  
Khaled M. Makkouk ◽  
Safaa G. Kumari ◽  
Widad Ghulam ◽  
Nouran Attar
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Polyclonal Antibodies ◽  
Polyacrylamide Gel Electrophoresis ◽  
Sodium Dodecyl ◽  
First Record ◽  
Structural Protein ◽  
Western Blots ◽  
N Protein ◽  
Yellow Dwarf Virus

A limited survey to identify virus diseases affecting wheat in summer nurseries in agricultural stations in southern Syria was conducted during October 2002. A total of 94 bread and durum wheat samples with symptoms suggestive of virus infection (stripping, stunting, and yellowing) were collected. All samples were tested for the presence of four viruses by tissue-blot immunoassay (2) at the Virology Laboratory of ICARDA, Aleppo, Syria using the following polyclonal antibodies: Barley stripe mosaic virus (BSMV); Barley yellow dwarf virus-PAV (BYDV-PAV) and Wheat streak mosaic virus (WSMV) from the Virology Laboratory at ICARDA; and Barley yellow striate mosaic virus (BYSMV) isolated from Italy (BYSMV-Italy) and provided by M. Conti, Instituto di Fitovirologia applicata, Turino, Italy. Serological results obtained indicated that BYSMV was the most commonly encountered virus (78.7%) followed by BYDV-PAV (22.3%), whereas, BSMV and WSMV were not detected in any of the samples tested. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by western blots, purified BYSMV preparations were observed to contain a 47-kDa structural protein typical of the N protein of Rhabdoviruses that reacted strongly with three BYSMV antisera (BYSMV-Italy, BYSMV-Lebanon [4], and BYSMV-Morocco [1]). Samples that reacted with BYSMV antisera were transmitted from wheat to wheat, barley, and oat plants by the planthopper Laodelphax striatella (Fallen) (Hemiptera: family Delphacidae) in a persistent manner, and the major symptoms of BYSMV on cereal crops were stripping and stunting. BYDV-PAV has been reported from Syria earlier (3) but to our knowledge, this is the first report of BYSMV affecting wheat in Syria. References: (1) B. E. Lockhart et al. Plant Dis. 70:1113, 1986. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) K. M. Makkouk et al. Phytopathol. Mediterr. 28:164, 1989. (4) K. M. Makkouk et al. Plant Dis. 85:446, 2001.

Sign in / Sign up

Export Citation Format

Share Document